Application of deubiquitinase USP2 as target spot in screening or preparing medicine for preventing and / or treating depression
By studying the expression characteristics and molecular mechanisms of USP2 in a mouse depression model, this study reveals the role of USP2 in depression. Overexpression of USP2 improves depressive symptoms, providing a new drug development strategy and addressing the lack of effective drugs for treating depression in existing technologies.
Patent Information
- Application Number
- CN202511509513.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-22
- Publication Date
- 2025-12-26
AI Technical Summary
Current technologies lack effective drugs for treating depression, and the relationship between deubiquitinase USP2 and depression is unknown, making it unsuitable as a target for drug development.
By establishing a corticosterone-induced mouse model of depression and combining virus-mediated gene overexpression technology, this study investigated the expression characteristics of USP2 in different nerve cells and its effects on corticosterone-induced depressive-like behavior. The focus was on the regulatory role of USP2 in hippocampal neuronal damage, neurogenesis, microglia activation, and the NF-κB signaling pathway, revealing the molecular mechanism of USP2 in depression.
This study confirmed the role of USP2 in the pathogenesis and treatment of depression. Overexpression of USP2 can improve corticosterone-induced depressive-like behavior, reduce neuronal damage and microglia overactivation by upregulating IL-1R2 expression and inhibiting NF-κB signaling pathway activation, thus providing a new target for antidepressant drugs.
Smart Images

Figure CN121208342A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical technology and relates to the application of using deubiquitinase USP2 as a target in screening or preparing drugs for the prevention and / or treatment of depression. Background Technology
[0002] Depression is a common mental disorder with a complex pathogenesis involving multiple factors such as impaired neuroplasticity, neuroinflammatory responses, and neurogenesis disorders. Hyperfunction of the hypothalamus-pituitary-adrenal (HPA) axis leading to elevated glucocorticoid levels is considered one of the important pathological mechanisms in the development of depression. Corticosterone, the main glucocorticoid in rodents, can cause hippocampal neuronal damage, reduced neurogenesis, and excessive microglial activation with prolonged exposure, thereby inducing depressive-like behaviors. Extensive efforts have been made to study the pathological mechanisms of depression in order to find effective treatment strategies; however, a comprehensive understanding of the pathophysiological mechanisms of depression remains lacking. Currently, there are no better clinical treatments.
[0003] Deubiquitin-specific protease 2 (USP2) is an important member of the deubiquitinase family, participating in various physiological and pathological processes by regulating the transport, degradation, and stability of substrate proteins. Currently, research on deubiquitinases mainly focuses on oncology, with limited research on their relationship with mental illness. Deubiquitinases participate in regulating neuronal synaptic plasticity and microglia activation—two key mechanisms that play important roles in the pathology of depression—but the link between USP2 and depression remains unknown. Therefore, investigating the relationship between USP2 and depression, and using USP2 as a target for screening or developing drugs for the prevention and / or treatment of depression, has practical application value. Summary of the Invention
[0004] The purpose of this invention is to study the relationship between the deubiquitinase USP2 and depression, and to provide the application of USP2 as a target in screening or preparing drugs for the prevention and / or treatment of depression.
[0005] To achieve the objectives of this invention, a corticosterone-induced mouse model of depression was established. Venlafaxine, a first-line clinical antidepressant, was selected as a positive control. Using virus-mediated gene overexpression technology, the expression characteristics of USP2 in different nerve cells and its effects on corticosterone-induced depressive-like behavior and their molecular mechanisms were investigated. The study focuses on the regulatory role of USP2 in hippocampal neuronal damage, neurogenesis, microglia activation, and microglia phagocytosis, and further explores its potential involvement in anti-inflammatory receptors and the NF-κB signaling pathway, providing an experimental basis for developing novel antidepressant drug targets.
[0006] The details are as follows: 1. Expression characteristics of USP2 in normal mouse brain tissue cells: Using healthy male C57BL / 6 mice, the expression of USP2 in hippocampal neurons, microglia and astrocytes was analyzed by immunofluorescence staining.
[0007] 2. Changes in USP2 expression in a mouse model of depression: A corticosterone-induced depression model was established, and animal behavior was assessed by forced swimming and tail suspension tests. Changes in USP2 expression were detected by Western blotting.
[0008] 3. In a corticosterone-induced in vivo depression model, USP2 expression was downregulated, and directly reducing USP2 expression could induce depressive-like behavior in mice. This result confirms that USP2 causes depression and reveals a new pathogenesis of depression.
[0009] 4. Effects of USP2 overexpression on depressive-like behavior and its molecular mechanisms: USP2-overexpressing lentivirus was injected into the hippocampus to observe its effects on the behavior of normal and depressed model mice. Western blotting, HE staining, and immunofluorescence were used to analyze related molecular and neuronal changes. Results: (a) USP2 was expressed in mature neurons, newborn neurons, microglia, and astrocytes in the hippocampus. (b) Depressed model mice exhibited depressive-like behavior and decreased USP2 expression in the hippocampus. (c) USP2 overexpression had no effect on the behavior of normal mice, but it improved corticosterone-induced depressive behavior in mice, upregulated the expression of USP2 and IL-1R2 in the hippocampus of depressed model mice, downregulated the levels of p-IκBα and p-NF-κB p65, and alleviated neuronal damage, reduced newborn neurons, excessive microglia activation, and microglia phagocytosis of neurons.
[0010] 5. Direct overexpression of USP2 was found to improve corticosterone-induced depressive-like behavior and hippocampal neuronal damage in mice. It also inhibited the reduction of IL-1R2 expression, activation of NF-κB signaling pathway, neuronal damage / degeneration / loss, and microglia phagocytosis of neurons in a corticosterone-induced depression model. This study reveals that upregulating USP2 in the brain can serve as a new approach to treating depression and a new drug target for antidepressant drug development, providing a new strategy for the treatment of depression.
[0011] Innovations and advantages of this invention: 1. The role and specific molecular mechanism of USP2 in the pathogenesis and treatment of depression were confirmed. Similar to the effects of corticosterone, downregulation of USP2 expression directly leads to depressive-like behavior and hippocampal neuronal damage in animals, while upregulation of USP2 expression inhibits corticosterone-induced depressive-like behavior and hippocampal neuronal damage in animals, which is closely related to the regulation of neuroinflammation by the USP2-mediated IL-1R2 and NF-κB signaling pathways. Furthermore, it was discovered for the first time that USP2 regulates depressive-like behavior in animals by acting on microglia to phagocytose neurons.
[0012] 2. It was confirmed that overexpression of USP2 in mature neurons, new neurons, microglia, or astrocytes in the hippocampus of the brain is beneficial for the treatment or prevention of depression, and has important application value for the development of drugs that use USP2 as a target for screening or preparation of drugs for the prevention and / or treatment of depression. Attached Figure Description
[0013] Figure 1 The expression and distribution of USP2 in the hippocampus of normal mice; Figure 2 The expression characteristics of USP2 in an in vivo depression model; Figure 3 To induce depression-like behavior in mice by silencing USP2 in the hippocampus; Figure 4 To investigate the effect of hippocampal overexpression of USP2 on improving corticosterone-induced depressive-like behavior in mice; Figure 5 The effect of overexpression of USP2 in the hippocampus on the inhibition of USP2 downregulation by corticosterone; Figure 6 The effect of overexpression of USP2 in the hippocampus on the inhibition of corticosterone-induced downregulation of IL-1R2; Figure 7 The inhibitory effect of overexpression of USP2 in the hippocampus on the corticosterone-activated NF-κB signaling pathway; Figure 8 To investigate the ameliorative effect of USP2 overexpression in the hippocampus on corticosterone-induced neuronal damage; Figure 9 The inhibitory effect of overexpression of USP2 in the hippocampus on the loss of new neurons induced by corticosterone; Figure 10 To investigate the ameliorative effect of hippocampal overexpression of USP2 on corticosterone-induced neurodegeneration; Figure 11 The inhibitory effect of USP2 overexpression in the hippocampus on corticosterone-induced microglial cell activation; Figure 12 This study aimed to improve the effect of overexpression of USP2 in the hippocampus on corticosterone-induced phagocytosis of neurons by microglia.
[0014] The genes involved in the present invention are shown in the nucleotide sequence list. Specific embodiments
[0015] To better illustrate the present invention, the following examples are given. Unless otherwise specified, the percentages mentioned below are all mass percentages: Example 1 Materials and methods I. Experimental animals Adult male C57BL / 6 mice, weighing 22 - 24 g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. [Animal Production License No.: SCXK (Beijing) 2016 - 0006]. They were housed in a SPF - level animal laboratory. During the experiment, all animals had free access to food and water, and maintained a normal day - night cycle. This experiment was approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University (Approval No.: 2021 - KY - 1203 - 002).
[0016] II. Immunofluorescence double - labeling staining to detect the distribution of USP2 in the hippocampus of normal mice The paraffin sections (4 μm thick) were dewaxed to water. After antigen retrieval of the sections, they were blocked with 3% BSA for 30 min. Add primary antibodies: USP2 (1:50, 10392 - 1 - AP, Proteintech, USA) was mixed with DCX (1:50, Catalog No. sc - 271390, Santa Cruz, USA), USP2 (1:150, Catalog No. 10392 - 1 - AP, Proteintech, USA) was mixed with NeuN (1:300, Catalog No. ab279297, Abcam, UK), USP2 (1:50, Catalog No. 10392 - 1 - AP, Proteintech, USA) was mixed with IBA - 1 (1:500, Catalog No. GB15105, Servicebio, Wuhan), USP2 (1:50, Catalog No. 10392 - 1 - AP, Proteintech, USA) was mixed with GFAP (1:500, Catalog No. GB12096, Servicebio, Wuhan), and incubated overnight. Add the corresponding fluorescent secondary antibodies and incubate at room temperature for 50 min. DAPI staining solution was incubated at room temperature for 10 min. Image acquisition was performed using a high - resolution pathological section scanning analysis system (3DHISTECH / Pannoramic SCAN).
[0017] III. Establishment of a depression animal model and behavioral detection 1. Establishment of a depression model: Healthy male C57BL / 6 mice were selected, and depressive-like behaviors were induced in the animals using corticosterone. Experimental groups: negative control group and corticosterone group. Modeling method: Mice in the solvent group were given 0.45% hydroxypropyl-β-cyclodextrin (dissolved in drinking water), and mice in the corticosterone group were given 35 μg / mL corticosterone (dissolved in solvent), for 21 consecutive days. After the administration period, subsequent behavioral and molecular biological tests were performed. Corticosterone was purchased from Dalian Meilun Biotechnology Co., Ltd., catalog number MB1891. Hydroxypropyl-β-cyclodextrin was purchased from Beijing Solarbio Technology Co., Ltd., catalog number C7070.
[0018] 2. Forced swimming and tail suspension tests were used to detect depressive-like behaviors in mice. Forced swimming test: Mice in each group were placed in an acrylic glass container (16 cm in diameter; 14 cm in water depth; 24±2℃). Video recordings of each mouse were conducted for 6 minutes, and the cumulative immobility time within the last 5 minutes was recorded. Tail suspension test: The tails of each mouse were taped to a tail suspension device, suspending the mouse upside down with its head approximately 50 cm above the platform. Video recordings of each mouse were conducted for 6 minutes, and the cumulative immobility time within the last 5 minutes was recorded.
[0019] IV. USP2 Silent-Induced Depression Model USP2 silencing virus induces downregulation of USP2 expression and induces depressive-like behavior in mice: Two USP2 silencing interference sequences (Sequence 1: AAGGGAAGACAGTCGGATT; Sequence 2: ACGCTTCATGGGCTATAAT) were selected. Mice were randomly divided into a solvent control group, a negative control virus group, and two USP2 silencing virus groups: a negative control virus group and a USP2 silencing virus group 2. The solvent control group was given virus dilution; the negative control virus group was given negative control virus; the USP2 silencing virus group 1 was given USP2 silencing virus sequence 1; and the USP2 silencing virus group 2 was given USP2 silencing virus sequence 2. Hippocampal injection method: USP2 overexpressing lentivirus, negative control virus, or viral dilution was injected into the mouse hippocampus using a stereotaxic instrument. The intracranial positioning coordinates were (AP = -2.0 mm, ML = 1.2 mm, DV = -2.0 mm). The injection volume was 1 μL per side, with a viral titer of 1 x 10⁹ TU / ml. The injection rate was 0.2 μL / min, followed by a 10-minute rest period after injection. Animals were allowed at least 3 days of recovery before subsequent experiments. Behavioral assessments and hippocampal brain tissue collection were performed on all animals 21 days after intracranial injection.
[0020] V. Effects of USP2 overexpression on depressive-like behavior and its molecular mechanism in mice 1. Overexpression of USP2 improves corticosterone-induced depressive-like behavior in mice: Healthy male C57BL / 6 mice were used. Experimental groups: negative control group (negative control virus / 0.45% hydroxypropyl-β-cyclodextrin / saline), USP2 overexpression group (USP2 overexpression virus / 0.45% hydroxypropyl-β-cyclodextrin / saline), corticosterone group (negative control virus / 35 μg / mL corticosterone / saline), corticosterone + USP2 overexpression group (USP2 overexpression virus / 35 μg / mL corticosterone / saline), corticosterone + venlafaxine group (positive control virus / 35 μg / mL corticosterone / venlafaxine). Hippocampal injection method: USP2 overexpressing lentivirus, negative control virus, or viral dilution were injected into the mouse hippocampus using a stereotaxic instrument. The intracranial positioning coordinates were (AP = -2.0 mm, ML = 1.2 mm, DV = -2.0 mm). 1 μL was injected per side, with a viral titer of 4 x 10⁷ TU / ml. The injection rate was 0.2 μL / min, with a 10-minute resting time after injection. Animals were allowed at least 3 days of recovery before subsequent experiments. The USP2 overexpressing lentivirus was prepared by Shanghai Jikai Gene Technology Co., Ltd. (The USP2 overexpressing virus contains the following gene sequence: forward 5'‐AGGTCGACTCTAGAGGATCCCGCCACCATGTCCCAGCTCTCCTCCAC‐3', reverse ... (5'-GGAAAGAACAGCTAGCCTACATACGGGAGGGTGGACTGGCCAGTTCATAG‐3'). Modeling and Dosage Regimen: Starting on day 7 after intracortical injection of the virus into the hippocampus, venlafaxine or 0.45% hydroxypropyl-β-cyclodextrin (drinking water) was administered for 21 consecutive days. On day 14 after intracortical injection, venlafaxine or saline was administered intraperitoneally at a dose of 5 mg / kg / day for 14 consecutive days. Following the completion of treatment, subsequent behavioral and molecular biological tests were performed. Venlafaxine was purchased from Dalian Meilun Biotechnology Co., Ltd., catalog number MB7524.
[0021] 2. Western blotting was used to detect the expression of USP2 and inflammation-related proteins in the hippocampus of mice in each group. Hippocampal tissues from each group of mice were added to RIPA lysis buffer (containing protease inhibitors and phosphatase inhibitors), homogenized using a tissue disperser until the tissues were dispersed, incubated on ice for 30 min, centrifuged at 12,000 rpm / min at 4 ℃, and the supernatant was collected. Protein concentration was detected using a BCA protein quantification kit. After transfer, PVDF membranes were washed with PBST for 10 min × 3 times at room temperature; blocked with 5% skim milk powder at room temperature for 2 h; and incubated overnight at 4 ℃ with primary antibody diluted in blocking buffer. The primary antibodies used were: USP2 (1:400, AF5804, R&D Systems, USA), IL-1R2 (1:1000, A14072, Abclonal, Wuhan), p-IκBα (Ser32 / 36) (1:500, 9246, CST, USA), IκBα (1:1000, 10268-1-AP, Proteintech, USA), p-NF-κB p65 (Ser536) (1:1000, 3033, CST, USA), NF-κB p65 (1:2000, 10745-1-AP, Proteintech, USA), and GAPDH (1:20000, 60004-1-Ig, Proteintech, USA). The HRP-labeled secondary antibody was diluted with PBST and incubated at room temperature for 1 h; it was then developed using ECL chemiluminescence solution, images were acquired using a gel imaging system, and grayscale values were calculated using ImageJ software.
[0022] 3. HE staining to detect hippocampal neuronal damage in each group of mice. Tissue samples were obtained, fixed, embedded, and sectioned in paraffin using standard methods, followed by HE staining. Images were acquired using a high-resolution pathological section scanning and analysis system (3DHISTECH / Pannoramic SCAN). Damaged neurons mainly exhibited deeply stained and pyknotted nuclei and reduced cell body size. The relative number of damaged neurons was defined as the ratio of the number of damaged neurons in the hippocampal DG region to the area of the hippocampal DG region.
[0023] 4. Immunofluorescence staining was used to detect the expression level of DCX in the hippocampus of mice in each group. After incubation with mouse-derived DCX primary antibody (1:50, sc-271390, Santa Cruz Biotechnology, USA), DAPI staining was performed. The method was the same as above. The main fluorescence characteristics of DCX were hollow circles surrounding DAPI or solid circles co-localizing with DAPI, and a clear cell body outline. The relative number of DCX+ cells was calculated as the ratio of the number of DCX-positive cells to the area of the hippocampal DG region.
[0024] 5. The co-expression levels of CD68 and IBA-1 in the hippocampus of mice in each group were detected by immunofluorescence double staining. Rabbit-derived CD68 (1:50, GB113109, Wuhan Servicebio) and mouse-derived IBA-1 (1:500, GB15105, Wuhan Servicebio) were mixed and incubated, followed by DAPI staining. The method was the same as above. The main fluorescence characteristics of CD68 and IBA-1 co-expression were that CD68 was irregularly dispersed on IBA-1 with obvious cell body outlines. The ratio of the number of CD68, IBA-1, and DAPI triple positives in the hippocampus to the hippocampal area was used as the relative number of CD68+IBA-1+.
[0025] 6. The co-expression levels of FJC, NeuN, and / or IBA-1 in the hippocampus of mice in each group were detected using FJC combined with immunofluorescence staining. NeuN (1:200, GB15138, Servicebio, Wuhan) and IBA-1 (1:500, GB113502, Servicebio, Wuhan) were mixed and incubated overnight at 4°C; then, the corresponding secondary antibody was added and incubated at room temperature in the dark for 50 min. FJC was stained with 1:10, TR-100-FJT, Biosensis, Australia, according to the manufacturer's instructions. The fluorescence characteristics of degenerative neurons showed co-localization of FJC and NeuN positivity. The ratio of the number of FJC and NeuN double-positive neurons in the hippocampal DG region to the hippocampal DG area was used as the relative number of FJC+NeuN+ neurons. The fluorescence characteristics of neurons phagocytosed by microglia showed co-localization of FJC negative neurons with NeuN and IBA-1 positivity. The ratio of the number of FJC-negative, IBA-1-positive, and NeuN-positive cells in the hippocampus to the hippocampal area is the relative number of FJC-IBA-1+NeuN+ cells.
[0026] Example 2 Experimental Results The expression and distribution of USP2 in the hippocampus of normal mice are as follows: Figure 1 As shown, USP2 is primarily located in mature neurons (NeuN+), but is also expressed in newborn neurons (DCX+), microglia (IBA-1+), and astrocytes (GFAP+). USP2 is expressed to varying degrees in all neuronal cells. The image below is a magnified view of the content within the white box in the image above; the top image is magnified 5 times, and the bottom image is magnified 50 times.
[0027] Expression characteristics of USP2 in an in vivo depression model, as follows: Figure 2As shown in the figure, compared with the solvent control group, the cumulative immobility time in the corticosterone group was significantly prolonged in both the forced swimming and tail suspension tests (P<0.05), indicating a significant increase in depressive-like behaviors. Compared with the solvent control group, the expression level of USP2 protein in the hippocampus of the corticosterone group was significantly decreased (P<0.05). Corticosterone induces depressive-like behaviors in animals while simultaneously downregulating USP2 expression in the hippocampus.
[0028] Hippocampal silencing of USP2 induces depressive-like behavior in mice, such as Figure 3 As shown. Compared with the solvent control group, the cumulative immobility time of mice in the negative control virus group was not significantly different in both the forced swimming and tail suspension tests (P > 0.05). Compared with the negative control virus group, the cumulative immobility time of mice in the USP2 silencing virus 1 group was significantly prolonged in both the forced swimming and tail suspension tests (P < 0.05). Compared with the negative control virus group, the cumulative immobility time of mice in the USP2 silencing virus 2 group was also significantly prolonged in both the forced swimming and tail suspension tests (P < 0.05). Compared with the solvent control group, there was no significant change in USP2 expression in the hippocampus of mice in the negative control virus group (P > 0.05). Compared with the negative control virus group, the expression of USP2 in the hippocampus of mice in the USP2 silencing virus 1 group was significantly decreased (P < 0.05). Compared with the negative control virus group, the expression of USP2 in the hippocampus of mice in the USP2 silencing virus 2 group was significantly decreased (P < 0.05). USP2 silencing virus successfully induced a decrease in USP2 expression and simultaneously induced depressive-like behavior in the animals.
[0029] The effect of hippocampal overexpression of USP2 on improving corticosterone-induced depressive-like behavior in mice, such as Figure 4 As shown in the figure. Compared with the negative control group, the cumulative immobility time in the corticosterone group was significantly prolonged in the forced swimming and tail suspension tests (P < 0.05). Compared with the corticosterone group, the cumulative immobility time in the corticosterone + USP2 overexpression group was significantly reduced in the forced swimming and tail suspension tests (P < 0.05). Compared with the corticosterone group, the cumulative immobility time in the corticosterone + venlafaxine group was significantly reduced in the forced swimming and tail suspension tests (P < 0.05). In the corticosterone-induced depression model, similar to the effect of the antidepressant venlafaxine, USP2 overexpression has a significant antidepressant effect.
[0030] The inhibitory effect of hippocampal overexpression of USP2 on corticosterone-induced downregulation of USP2, such as Figure 5As shown in the figure, compared with the negative control group, USP2 expression in the hippocampus of mice in the USP2 overexpression group was significantly increased (P < 0.05), while USP2 expression in the hippocampus of mice in the corticosterone group was significantly decreased (P < 0.05). Compared with the corticosterone group, USP2 expression in the hippocampus of mice in the corticosterone + USP2 overexpression group was significantly restored (P < 0.05). In the corticosterone-induced depression model, USP2 overexpression can reverse the corticosterone-induced downregulation of USP2 expression, and its antidepressant effect is related to the upregulation of USP2 expression in the hippocampus.
[0031] The inhibitory effect of overexpression of USP2 in the hippocampus on the downregulation of IL-1R2 by corticosterone, as shown in the example. Figure 6 As shown in the figure, compared with the negative control group, the expression of IL-1R2 in the hippocampus of mice in the corticosterone group was significantly decreased (P < 0.05). Compared with the corticosterone group, the expression of IL-1R2 in the hippocampus of mice in the corticosterone + USP2 overexpression group was significantly upregulated (P < 0.05). In the corticosterone-induced depression model, USP2 overexpression can reverse the downregulation of IL-1R2 expression caused by corticosterone, and its antidepressant effect is related to the upregulation of IL-1R2 expression in the hippocampus.
[0032] The inhibitory effect of USP2 overexpression in the hippocampus on the corticosterone-activated NF-κB signaling pathway, such as Figure 7 As shown in the figure, compared with the negative control group, the expression of p-IκBα and p-NF-κB in the hippocampus of mice in the corticosterone group was significantly increased (P < 0.05). Compared with the corticosterone group, the expression of p-IκBα and p-NF-κB in the hippocampus of mice in the corticosterone + USP2 overexpression group was significantly decreased (P < 0.05). In the corticosterone-induced depression model, USP2 overexpression can reverse the corticosterone-induced overactivation of the NF-κB signaling pathway, and its antidepressant effect is related to the inhibition of the overactivation of the NF-κB signaling pathway in the hippocampus.
[0033] The ameliorative effect of hippocampal overexpression of USP2 on corticosterone-induced neuronal damage, such as Figure 8 As shown in the image. HE staining revealed a significant increase in the number of damaged neurons in the hippocampal DG region of mice in the corticosterone group compared to the negative control group (P < 0.05). Compared to the corticosterone group, the number of damaged neurons in the hippocampal DG region of mice in the corticosterone + USP2 overexpression group was significantly reduced (P < 0.05). In a corticosterone-induced depression model, USP2 overexpression can improve corticosterone-induced hippocampal neuronal damage, and its antidepressant effect is related to the improvement of hippocampal neuronal damage. The image is magnified 20 times.
[0034] The inhibitory effect of USP2 overexpression in the hippocampus on corticosterone-induced loss of new neurons, such as Figure 9As shown. Compared with the negative control group, the number of newly formed neurons (DCX+) in the hippocampal DG region of mice in the corticosterone group was significantly reduced (P < 0.05). Compared with the corticosterone group, the number of newly formed neurons (DCX+) in the hippocampal DG region of mice in the corticosterone + USP2 overexpression group was significantly increased (P < 0.05). In the corticosterone-induced depression model, USP2 overexpression can improve the reduction of newly formed neurons in the hippocampus induced by corticosterone, and its antidepressant effect is related to improving the loss of newly formed neurons in the hippocampus. The image is magnified 10 times.
[0035] The ameliorative effect of hippocampal overexpression of USP2 on corticosterone-induced neurodegeneration, such as Figure 10 As shown. Compared with the negative control group, the number of degenerative neurons (FJC+NeuN+) in the hippocampal DG region of mice in the corticosterone group was significantly increased (P<0.05). Compared with the corticosterone group, the number of degenerative neurons (FJC+NeuN+) in the hippocampal DG region of mice in the corticosterone + USP2 overexpression group was significantly reduced (P<0.05). In the corticosterone-induced depression model, USP2 overexpression can improve corticosterone-induced hippocampal neurodegeneration, and its antidepressant effect is related to the improvement of hippocampal neurodegeneration. The image magnification is 20x.
[0036] The inhibitory effect of hippocampal overexpression of USP2 on corticosterone-induced microglial cell activation, such as Figure 11 As shown in the figures. Rows 5-8 are magnified views of the contents within the white boxes in rows 1-4, with the top image magnified 5x and the bottom image magnified 50x. Compared to the negative control group, the number of activated microglia (CD68+IBA-1+) in the hippocampus of mice in the corticosterone group was significantly increased (P<0.05). Compared to the corticosterone group, the number of activated microglia in the corticosterone + USP2 overexpression group was significantly reduced (P<0.05). In the corticosterone-induced depression model, USP2 overexpression can improve corticosterone-induced excessive activation of hippocampal microglia, and its antidepressant effect is related to the inhibition of excessive activation of hippocampal microglia.
[0037] The effect of hippocampal overexpression of USP2 on improving corticosterone-induced phagocytosis of neurons by microglia, as shown in... Figure 12 As shown. Compared with the negative control group, the number of microglia phagocytosing live neurons (FJC-IBA-1+NeuN+) in the hippocampus of mice in the corticosterone group was significantly increased (P<0.05). Compared with the corticosterone group, the number of microglia phagocytosing live neurons (FJC-IBA-1+NeuN+) in the corticosterone + USP2 overexpression group was significantly reduced (P<0.05). In the corticosterone-induced depression model, USP2 overexpression can improve the corticosterone-induced phagocytosis of neurons by hippocampal microglia, and its antidepressant effect is related to the inhibition of phagocytosis of neurons by hippocampal microglia. The image is magnified 20 times.
[0038] In summary, this invention, through systematic experimental design, de-ubiquitinating enzyme USP2 and its molecular mechanism in a corticosterone-induced depression model. The results not only revealed the expression characteristics of USP2 in various nerve cells, but more importantly, elucidated the multiple protective mechanisms by which USP2 improves depressive-like behavior by mediating the IL-1R2 / NF-κB signaling pathway to regulate neurons and microglia.
[0039] This invention reveals that USP2 is highly expressed in mature neurons, and is also distributed in newborn neurons, microglia, and astrocytes. High expression in mature neurons suggests that USP2 may be involved in the maintenance and regulation of neuronal function; expression in newborn neurons suggests that it may affect hippocampal neurogenesis; and expression in glial cells indicates that USP2 may be involved in the regulation of neuroinflammation. Corticosterone-induced downregulation of USP2 may affect neuronal function through multiple pathways: first, as a deubiquitinating enzyme, reduced USP2 expression may lead to the abnormal degradation of its target proteins; second, USP2 downregulation may disrupt protein homeostasis in neurons; and finally, it may affect the stability of proteins related to neuroplasticity.
[0040] This invention experimentally demonstrates that USP2 overexpression has a significant effect on improving corticosterone-induced depressive-like behavior, manifested in anti-inflammatory, neuroprotective, neurogenesis-promoting, microglia activation-regulating, and microglia phagocytosis-inhibiting effects.
[0041] USP2 overexpression significantly upregulated IL-1R2 expression and simultaneously inhibited excessive activation of the NF-κB signaling pathway, suggesting that USP2 may exert its anti-inflammatory effect through a dual mechanism: on the one hand, by upregulating IL-1R2 to inhibit inflammatory signal transduction; on the other hand, by inhibiting IκBα phosphorylation and NF-κB signaling pathway activation, thereby alleviating neuroinflammatory responses. In the hippocampus of corticosterone-induced mice, the increased IL-1R2 levels induced by USP2 overexpression should be a direct result of USP2 regulation, while the decreased levels of p-IκBα and p-NF-κB p65 are achieved through indirect regulatory mechanisms.
[0042] USP2 overexpression significantly alleviated corticosterone-induced neuronal damage. This protective effect may be related to USP2's ability to maintain neuronal protein homeostasis. This invention demonstrates that USP2 overexpression significantly increases the number of new neurons in the hippocampal DG region, suggesting that USP2 may be a novel molecular node connecting neurogenesis and depression.
[0043] USP2 overexpression can significantly inhibit the excessive activation of microglia, which is related to its anti-inflammatory mechanism.
[0044] This invention reveals that the deubiquitinating enzyme USP2 targets the IL-1R2 and NF-κB signaling pathways, simultaneously regulating neuronal and microglial function, significantly inhibiting neuroinflammation and exhibiting a potent antidepressant effect. This provides significant potential for developing antidepressant therapies targeting USP2.
[0045] Furthermore, this invention experimentally demonstrates that USP2 overexpression has no significant effect on any indicators in normal mice, indicating that the regulatory effect of USP2 is pathologically specific. This characteristic makes it a safer potential therapeutic target. Moreover, the efficacy of USP2 overexpression is comparable to that of the commonly used antidepressant venlafaxine, and its mechanism of action is more diverse, making the development of USP2-targeted drugs for treating depression more widely applicable.
Claims
1. The application of deubiquitinating enzyme USP2 as a target in the screening or preparation of drugs for the prevention and / or treatment of depression, characterized in that, USP2 is overexpressed in mature neurons, newborn neurons, microglia, or astrocytes in the hippocampus of the brain.
2. The application of the deubiquitinating enzyme USP2 as a target in the screening or preparation of drugs for the prevention and / or treatment of depression according to claim 1, characterized in that, Overexpression of the deubiquitinase USP2 inhibits corticosterone-induced depression by reducing IL-1R2 expression, activating the NF-κB signaling pathway, inhibiting neuronal damage, degenerative changes, loss of new neurons, and inhibiting microglia from phagocytizing neurons.
3. The application of the deubiquitinating enzyme USP2 as a target in the screening or preparation of drugs for the prevention and / or treatment of depression according to claim 1, characterized in that, The depression mentioned includes depression caused by downregulation of USP2.