Use of LOXL2 gene in resisting avian leukosis virus infection
By identifying and utilizing the LOXL2 gene as a target to regulate the replication of avian leukosis virus, the bottleneck problem of resistance to multiple subpopulations of avian leukosis virus was solved, and technical support for the construction of avian leukosis virus infection models and breeding of avian leukosis virus resistant strains was realized.
Patent Information
- Application Number
- CN202511785667.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-01
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2045-12-01
AI Technical Summary
Existing technologies cannot effectively address resistance to multiple subgroups of avian leukosis virus, resulting in bottlenecks in the breeding or preparation of avian leukosis-resistant chickens.
By identifying and utilizing the LOXL2 gene as a target to regulate the replication of avian leukosis virus, and using biological materials such as LOXL2 gene nucleotide molecules, proteins, recombinant vectors, or recombinant microorganisms, the LOXL2 gene can be overexpressed or inhibited for the preparation of anti-avian leukosis virus products and animal models.
It provides new target genes to promote or inhibit avian leukosis virus replication, supports the construction of avian leukosis virus infection models and breeding of avian leukosis virus-resistant species, and enhances the disease resistance of chickens.
Smart Images

Figure CN121221778B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of the LOXL2 gene in the fight against avian leukosis virus infection. Background Technology
[0002] Avian leukosis is a widespread infectious disease in poultry, causing significant economic losses to the poultry industry and seriously threatening the safety of poultry breeds. The pathogen is avian leukosis virus (ALV), and its main transmission route is vertical transmission; therefore, control can only be achieved through population eradication. Although continuous eradication measures have brought avian leukosis under some control in China, the epidemic persists, especially in certain local breeds where infection rates remain high. Furthermore, in recent years, avian leukosis outbreaks have also occurred in imported broiler breeder flocks, leading to decreased hatching rates and increased culling rates, resulting in severe losses. Therefore, avian leukosis remains one of the most serious diseases threatening the safety of poultry breeds and healthy poultry farming, urgently requiring further effective prevention and eradication measures.
[0003] Identification of host target genes is a necessary prerequisite for the breeding or preparation of avian leukosis-resistant chickens. Because avian leukosis virus (ALV) subgroups are very diverse, and different subgroups infect different cells, the currently screened host resistance target genes cannot simultaneously address resistance to multiple ALV subgroups. This is a bottleneck problem that urgently needs to be solved in the breeding or preparation of ALV-resistant chickens. This invention addresses this problem by employing various methods to identify target genes regulating ALV invasion and replication in ALV-infected chicken embryonic fibroblasts (DF1) and their application in resistance to ALV infection. This provides new target genes for the breeding or preparation of ALV-resistant chickens and is of great significance for improving the level of chicken disease resistance breeding research. Summary of the Invention
[0004] The purpose of this invention is to provide the application of the LOXL2 gene in combating avian leukosis virus infection, thereby addressing the problems existing in the prior art. This invention provides a novel gene target, LOXL2, related to resistance to avian leukosis virus infection, and demonstrates the role of the LOXL2 gene in regulating avian leukosis virus replication. Inhibiting LOXL2 gene expression in host cells promotes avian leukosis virus replication, while overexpressing the LOXL2 gene in host cells inhibits avian leukosis virus replication. This invention provides favorable theoretical guidance and technical support for the application of the LOXL2 gene as a target in the development of drugs for treating avian leukosis, the breeding of transgenic animals resistant to avian leukosis, and the construction of avian leukosis virus infection models.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides the use of biomaterials that promote LOXL2 gene expression in any of the following:
[0007] A1. To prepare products that inhibit the replication of avian leukosis virus;
[0008] A2. Preparation of products for treating avian leukosis virus infection;
[0009] A3. To prepare drugs for treating avian leukosis;
[0010] A4. Prepare cell or animal models resistant to avian leukosis virus;
[0011] A5. Animal breeding for resistance to avian leukosis virus;
[0012] The nucleotide sequence of the LOXL2 gene is shown in SEQ ID NO.1.
[0013] Furthermore, the biomaterial that promotes LOXL2 gene expression includes any one of the following:
[0014] B1. The nucleotide molecules of the LOXL2 gene;
[0015] The proteins encoded by the nucleotide molecules described in B2.B1;
[0016] B3. An expression cassette, recombinant vector, or recombinant microorganism containing the nucleotide molecules described in B1.
[0017] The present invention also provides the above-mentioned biological materials for promoting LOXL2 gene expression.
[0018] The present invention also provides a drug for treating avian leukosis, wherein the drug uses the above-mentioned biological material as an active ingredient.
[0019] This invention also provides the use of biomaterials that inhibit LOXL2 gene expression in any of the following:
[0020] C1. Preparation of cell models sensitive to avian leukosis virus;
[0021] C2. Preparation of animal models susceptible to avian leukosis virus;
[0022] The nucleotide sequence of the LOXL2 gene is shown in SEQ ID NO.1.
[0023] Furthermore, the biomaterial that inhibits LOXL2 gene expression includes any one of the following:
[0024] B1. siRNA that interferes with the expression of the LOXL2 gene;
[0025] B2. Knock out the sgRNA of the LOXL2 gene;
[0026] B3. An expression cassette, recombinant vector, or recombinant microorganism containing the sgRNA described in B2.
[0027] Furthermore, the sense strand of the siRNA is shown in SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7, and the antisense strand is shown in SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8;
[0028] The upstream primer of the sgRNA is shown in SEQ ID NO.15 or SEQ ID NO.17, and the downstream primer is shown in SEQ ID NO.16 or SEQ ID NO.18.
[0029] The present invention also provides the above-mentioned biological material for inhibiting LOXL2 gene expression.
[0030] This invention also provides any of the following methods:
[0031] Method I: A method for constructing a cell model resistant to avian leukosis virus, comprising the steps of using genetic transformation technology and the above-mentioned biological materials to overexpress the LOXL2 gene in cells;
[0032] Method II: A method for breeding animals resistant to avian leukosis virus, comprising the steps of using genetic transformation technology, using the above-mentioned biological materials, to overexpress the LOXL2 gene in animal fertilized eggs and stably inherit it, thereby breeding animals resistant to avian leukosis virus;
[0033] Method III: A method for constructing a cell model sensitive to avian leukosis virus, comprising the steps of using genetic transformation technology and the above-mentioned biological materials to interfere with, silence or knock out the LOXL2 gene in cells, thereby making the cells sensitive to avian leukosis virus;
[0034] Method IV: A method for constructing an animal model susceptible to avian leukosis virus, comprising the steps of using genetic transformation technology, using the above-mentioned biological materials, interfering with, silencing or knocking out the LOXL2 gene in animal fertilized eggs, and making it stably inherited, thereby constructing an animal model susceptible to avian leukosis virus.
[0035] The nucleotide sequence of the LOXL2 gene is shown in SEQ ID NO.1.
[0036] The present invention also provides the application of the cell model constructed by method III or the animal model constructed by method IV above in screening drugs that have therapeutic effects on avian leukosis.
[0037] The present invention discloses the following technical effects:
[0038] This invention provides a novel gene target, LOXL2 (lysyl oxidase-like 2 gene), associated with resistance to avian leukosis virus infection, and for the first time utilizes molecular biology combined with cellular biology experiments to demonstrate the role of the LOXL2 gene in regulating avian leukosis virus replication. Molecular biological techniques have confirmed the interaction between the LOXL2 protein and proteins related to avian leukosis virus reverse transcription, suggesting it could serve as a potential key protein for inhibiting avian leukosis virus replication. This invention provides valuable theoretical guidance and technical support for the application of the LOXL2 gene as a target in the development of drugs for treating avian leukosis, the breeding of transgenic animals resistant to avian leukosis, and the construction of avian leukosis virus infection models, exhibiting broad application prospects and extremely high market value. Attached Figure Description
[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0040] Figure 1 The graph shows the relative expression levels of the J-type ALV gp85 gene in the LOXL2 gene expression interference groups (siLOXL2-1, siLOXL2-2, and siLOXL2-3) and the control group (NC).
[0041] Figure 2 The graph shows the relative expression levels of the K-type ALV gp85 gene in the LOXL2 gene expression interference groups (siLOXL2-1, siLOXL2-2, and siLOXL2-3) and the control group (NC).
[0042] Figure 3 For the LOXL2 gene knockout group (LOXL2) KO DF1 strain 1 and LOXL2 KO Figure showing the relative expression levels of the J-type ALV gp85 gene in DF1 strain 2 and the wild-type group (WT DF1);
[0043] Figure 4 For the LOXL2 gene knockout group (LOXL2) KO DF1 strain 1 and LOXL2 KO Figure showing the relative expression levels of the K-type ALV gp85 gene in DF1 strain 2 and the wild-type group (WT DF1);
[0044] Figure 5To detect the LOXL2 gene knockout group (LOXL2) using immunofluorescence technology KO DF1 strain 1 and LOXL2 KO Plots showing the J-type ALV viral load in the DF1strain 2 group and the wild-type group (WT DF1);
[0045] Figure 6 The graph shows the relative expression levels of the J-type ALV gp85 gene in the LOXL2 gene overexpression group and the empty vector control group.
[0046] Figure 7 Figure 1 shows the relative expression levels of the K-type ALV gp85 gene in the LOXL2 gene overexpression group and the empty vector control group.
[0047] Figure 8 A diagram showing the expression of ALV reverse transcriptase RT protein in 293T cells;
[0048] Figure 9 This is a diagram showing the expression of LOXL2 protein in 293T cells;
[0049] Figure 10 This diagram illustrates the interaction between LOXL2 and RT proteins in 293T cells. Detailed Implementation
[0050] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0051] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0052] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0053] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0054] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0055] The CDS sequence of the chicken LOXL2 gene involved in the following examples is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0056] SEQ ID NO.1:
[0057]
[0058] SEQ ID NO.2:
[0059] MEGFLGFNHNHCFIVLFFVSLSLAQYEHWPYLPGYPEPPPQVYQPPRRPADVPKIQLRLAGQKRKHNEGRVEVFYNGEWGTVCDDDFSIHAAHVICRELGYVEAVSWLPSSKYGKGEGKIWMDNVHCNGKEATLAACTSNGWGVTDCKHTEDVGVVCSEKRIPGFKFDNSLLNQIENMNIQVEDIRIRPILATYRKRVPVTEGYVEVKDEGTWKQICDKHWTMKNSRVVCGMFGFPSERKYNTKVYKMFASRRKQHYWAYSMDCTGNEAHISSCKLGNHLNVDTEKNATCDNGMPAVASCVPGRAFAPSSHSGFRKAFRQEQPLVRLKGGANTGEGRVEVLKNGEWGTVCDDNWNLVSASVVCRELGFGSAKEAITGARLGQGMGPIHLNEIDCTGFEKSLTDCKFNMESQGCNHEEDAAVRCNVPAMGFQNQLRLVGGRNPYEGRVEVLAERNGTLRWGTVCSQGWSTVEAMVVCRQLGLGFASHAFQETWYWHGDVSADSVVMSGVKCSGTEMSLAHCRHDGADVSCPRGGGRFGAGVSCSETAPDLVLNAELVEQTAYLEDRPMFMLQCAQEENCLASSAVNTSVTSGYRRLLRFSSQIHNNGQSDFRPKNGRHAWVWHDCHRHYHSMEVFTHYDLLNLNGTKVAEGHKASFCLEDTECEADVQKQYECANFGEQGITVGCWDVYRHDIDCQWIDITDVPPGDYLFQVVINPNYEVAESDYSNNVMKCRSRYDGQRIWMYNCHTGGSFSDETEQKFDHFSGLTNNKVSTR。
[0060] Example 1: Significantly promoted replication of avian leukosis virus after LOXL2 gene silencing
[0061] 1. Design of interfering RNA (siRNA)
[0062] The RNA interference sequences LOXL2 siRNA (SEQ ID NO.3-8) and control NC siRNA (SEQ ID NO.9-10) for the LOXL2 gene were designed, and the specific sequences are as follows:
[0063] LOXL2 siRNA-1 positive strand: 5'-GGGUUACGUGGAGGUGAAATT-3', SEQ ID NO.3;
[0064] LOXL2 siRNA-1 antisense strand: 5'-UUUCACCUCCACGUAACCCTT-3', SEQ ID NO.4;
[0065] LOXL2 siRNA-2 positive strand: 5'-GCGAUGACAACUGGAACCUTT-3', SEQ ID NO.5;
[0066] LOXL2 siRNA-2 antisense strand: 5'-AGGUUCCAGUUGUCAUCGCTT-3', SEQ ID NO.6;
[0067] LOXL2 siRNA-3 positive strand: 5'-GGAAGACACCGAAUGUGAATT-3', SEQ ID NO.7;
[0068] LOXL2 siRNA-3 antisense strand: 5'-UUCACAUUCGGUGUCUUCCTT-3', SEQ ID NO.8;
[0069] NC siRNA positive strand: 5'-UUCUCCGAACGUGUCACGUTT-3', SEQ ID NO.9;
[0070] NC siRNA antisense strand: 5'-ACGUGACACGUUCGGAGAATT-3', SEQ ID NO.10.
[0071] 2. Evaluate the effect of the LOXL2 gene on avian leukosis virus infection.
[0072] (1) Construction of LOXL2 gene knockdown chicken embryo fibroblast (DF1) cells
[0073] The interfering RNA (siRNA) sequence described above was synthesized by Shanghai Gemma Company. The siRNA was processed according to the company's "RNAi Product User Manual" and transfected using JetPRIME (PolyPlus, B180306) reagent from PolyPlus Company.
[0074] Chicken embryo fibroblast (DF1) cells were cultured in 1640 medium (Gibco) containing 10% fetal bovine serum (Gibco), 100 U / mL penicillin, and 100 U / mL streptomycin, and incubated at 37°C in a 5% CO2 incubator. DF1 cells were then cultured at a rate of 5 × 10⁻⁶ cells / mL. 5 The cells were seeded at a density of cells / well in 48-well plates and incubated overnight in a 37°C incubator with 5% CO2. The cells were then randomly divided into NC group, siLOXL2-1 group, siLOXL2-2 group and siLOXL2-3 group.
[0075] Following the recommended siRNA dosage in the JetPRIME instructions, add LOXL2-siRNA and NC-siRNA to Jetprime Buffer, gently pipette to mix, then add Jetprime regent, gently pipette to mix again, let stand at room temperature for 10 min, then carefully add LOXL2-siRNA and NC-siRNA to the corresponding culture medium, gently shake to mix, and place in a cell culture incubator. After culturing for 8 h, change the medium and continue culturing for 24 h.
[0076] (2) Infection efficacy of avian leukosis virus (ALV)
[0077] 0.1 MOI avian leukosis virus was inoculated into the cells prepared in step (1). After 24 h of infection, the ALV-specific gp85 gene fragment in each group of cells was detected by real-time quantitative RT-PCR using specific primers (J type: SEQ ID NO.11-12; K type: SEQ ID NO.13-14). -ΔΔCT The relative expression level is calculated using this method.
[0078] The specific primer sequences are as follows:
[0079] SEQ ID NO.11:TTGCAGGCATTTCTGACTGG;
[0080] SEQ ID NO.12:ACACGTTTCCTGGTTGTTGC;
[0081] SEQ ID NO.13: TTCCCAGTCTCTCCCTAACATTACT;
[0082] SEQ ID NO. 14: GCTGTCACCACCGTAAATGGTT.
[0083] The results are as follows Figure 1 and Figure 2As shown, compared with the NC group cells, the replication of J-type ALV virus and K-type ALV virus was significantly increased in the LOXL2 gene expression interference group cells (siLOXL2-1 group, siLOXL2-2 group and siLOXL2-3 group).
[0084] Example 2: LOXL2 gene knockout significantly promoted avian leukosis virus replication.
[0085] 1. Design of Small Guide RNA (sgRNA)
[0086] The Cas9 protein guide RNA sequence LOXL2 sgRNA (SEQ ID NO.15-18) targeting the LOXL2 gene was designed, and the specific sequence is as follows:
[0087] LOXL2 sgRNA-1 upstream primer: 5'- CACCgcacgatgaaacagtggtta-3', SEQ ID NO.15;
[0088] LOXL2 sgRNA-1 downstream primer: 5'- CACCGtggctaccgagctcaaaata-3', SEQ ID NO.16;
[0089] LOXL2 sgRNA-2 upstream primer: 5'-gtatgaacactggccctacctc-3', SEQ ID NO.17;
[0090] LOXL2 sgRNA-2 downstream primer: 5'- ttgagctcggtagccaagacac-3', SEQ ID NO.18.
[0091] 2. Evaluate the effect of the LOXL2 gene on avian leukosis virus infection.
[0092] (1) Construction of DF1 cell line with LOXL2 gene knockout
[0093] The sgRNA sequence described above was synthesized by Qingke Company. The sgRNA sequence was inserted into the Cas9 vector (lentiCRISPR v2 (Addgene #52961) plasmid) and transfected using the JetPRIME (PolyPlus, B180306) reagent from PolyPlus Company.
[0094] DF1 cells were loaded at 5 × 10 5 Seeded at a density of 100 cells / well in 48-well plates, incubated overnight at 37°C in a 5% CO2 incubator, and then randomly divided into wild-type (WT DF1) and LOXL2 groups. KODF1 strain group 1 and LOXL2 KO DF1 strain, group 2.
[0095] Following the dosage recommended in the JetPRIME instructions, the plasmid containing recombinant LOXL2 sgRNA and a puromycin selection tag was added to Jetprime Buffer. After gentle pipetting and mixing, Jetprime Regent was added, and the mixture was gently pipetted and mixed again. After standing at room temperature for 10 min, the mixture was carefully added to the corresponding culture medium, gently shaken, and placed in a cell culture incubator. After culturing for 24 h, the culture medium was replaced with puromycin-containing medium, and the cells were cultured for another 72 h. Then, flow cytometry was used for sorting, and LOXL2 gene knockout single-cell clones were detected by PCR. The single-cell clones were expanded and sequenced to obtain the LOXL2 gene knockout chicken embryo fibroblast (DF1) cell line.
[0096] (2) Infection efficacy of avian leukosis virus (ALV)
[0097] 0.1 MOI avian leukosis virus was inoculated into the cells prepared in step (1). After 24 h of infection, the ALV-specific gp85 gene fragment was detected by real-time quantitative RT-PCR.
[0098] The results are as follows Figure 3 and Figure 4 As shown, compared with wild-type cells, LOXL2 gene knockout cells (LOXL2) KO DF1strain 1 group and LOXL2 KO In DF1 strain 2, the replication of type J ALV virus and type K ALV virus was significantly increased.
[0099] Indirect immunofluorescence assay was performed using the avian leukosis virus protein antibody p27. Results are as follows: Figure 5 As shown, compared with wild-type cells, LOXL2 gene knockout cells (LOXL2) KO DF1 strain group 1 and LOXL2 KO The viral load of type J ALV was significantly increased in DF1 strain group 2.
[0100] Example 3: Overexpression of the LOXL2 gene significantly inhibited the replication of avian leukosis virus.
[0101] 1. Construct LOXL2-overexpressing DF1 cells
[0102] The LOXL2 gene sequence (SEQ ID NO.1) was ligated into the eukaryotic overexpression vector pCAGGS-HA to form the recombinant plasmid pCAGGS-LOXL2-HA. After the protein expression cassette was verified to be normal by sequencing, DF1 cells were transfected using JetPRIME reagent (PolyPlus, B180306) from PolyPlus.
[0103] DF1 cells were loaded at 5 × 10 5 Cells were seeded at a density of cells / well in 48-well plates and cultured overnight at 37°C with 5% CO2. Following the JetPrime instructions, 0.25 μg, 0.5 μg, and 1 μg of pCAGGS-LOXL2-HA were added to JetPrime Buffer, respectively. After gentle pipetting and mixing, JetPrime Regent was added, and the mixture was gently pipetted and mixed again. The mixture was allowed to stand at room temperature for 10 min, then carefully added to the culture medium, gently shaken, and placed in a cell culture incubator. After 8 h of culture, the medium was changed, and the cells were cultured for another 24 h. An empty control group was transfected with an equal amount of pCAGGS-HA plasmid.
[0104] 2. Evaluate the effect of the LOXL2 gene on avian leukosis virus infection.
[0105] 0.1 MOI avian leukosis virus was inoculated into the cells prepared in step 1. After 24 h of infection, the ALV-specific gp85 gene fragment was detected by real-time quantitative RT-PCR.
[0106] The results are as follows Figure 6 and Figure 7 As shown, compared with the empty vector control group, the replication of type J ALV virus and type K ALV virus was significantly reduced in the LOXL2 gene overexpression group. Furthermore, with increasing pCAGGS-LOXL2-HA transfection dose, the viral load of both type J ALV and type K ALV virus gradually decreased.
[0107] Example 4: Interaction analysis between LOXL2 protein and viral reverse transcriptase protein RT
[0108] 1. Construction of viral reverse transcriptase RT gene overexpression plasmid
[0109] The avian leukosis virus reverse transcriptase RT gene sequence (SEQ ID NO.19) was ligated into the eukaryotic overexpression vector pCAGGS-Flag to form the recombinant plasmid pCAGGS-RT-Flag. After the protein expression cassette was verified to be normal by sequencing, 293T cells were transfected using the JetPRIME reagent (PolyPlus, B180306) from PolyPlus.
[0110] SEQ ID NO.19:
[0111]
[0112] 2. Verification of the interaction between host protein LOXL2 and viral reverse transcriptase protein RT
[0113] 293T cells, as the main cell model for studying the interaction between eukaryotic and viral proteins, can be used to transfect the host gene LOXL2 overexpression plasmid pCAGGS-LOXL2-HA and the viral reverse transcriptase protein RT overexpression plasmid pCAGGS-RT-Flag, either separately or co-transfected.
[0114] 293T cells were used at a rate of 5 × 10 5 Cells were seeded at a density of [number] cells / well in 6-well plates and incubated overnight at 37°C with 5% CO2. Following the JetPrime manual's recommended amount of plasmid DNA, pCAGGS-LOXL2-HA and / or pCAGGS-RT-Flag were added to JetPrime Buffer, gently mixed by pipetting, and then JetPrime Regent was added. The mixture was gently mixed again, allowed to stand at room temperature for 10 min, and then carefully added to the culture medium. After gentle shaking, the cells were placed in a cell culture incubator and incubated for 8 h. The medium was then changed, and the cells were incubated for another 24 h. Control cells were transfected with an equal amount of pCAGGS-HA or pCAGGS-Flag plasmid. Samples were collected for subsequent immunoprecipitation and Western blot analysis.
[0115] The results are as follows Figures 8-10 As shown, the viral reverse transcriptase protein RT can be normally expressed in cells ( Figure 8 The host protein LOXL2 can also be normally expressed in cells. Figure 9 Furthermore, LOXL2 protein can be retrieved by RT-mediated immunoprecipitation in co-transfected cells. Figure 10 This indicates an interaction between the host protein LOXL2 and the viral reverse transcriptase protein RT.
[0116] In summary, this study found that inhibiting LOXL2 gene expression in cells increases ALV viral replication capacity, while overexpressing LOXL2 gene in cells decreases ALV viral replication capacity. Furthermore, it was found that the LOXL2 protein has a strong binding affinity to the viral reverse transcriptase protein p27. These studies indicate that the lysyl oxidase-like protein LOXL2 in chicken cells can mediate the replication of multiple ALV subsets and is directly associated with ALV infection.
[0117] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Use of a biomaterial that promotes expression of a LOXL2 gene in any one of the following: A1. Preparation of a product that inhibits replication of avian leukosis virus; A2. Preparation of a product that is resistant to infection by avian leukosis virus; A3. Preparation of a drug that treats avian leukosis; A4. Preparation of a cell model or an animal model that is resistant to avian leukosis virus; A5. Breeding of an animal that is resistant to avian leukosis virus; the nucleotide sequence of the LOXL2 gene is shown as SEQ ID NO. 1; the biomaterial that promotes expression of the LOXL2 gene is a recombinant vector that contains a nucleotide molecule of the LOXL2 gene.
2. Use of a biomaterial that inhibits expression of a LOXL2 gene in any one of the following: C1. Preparation of a cell model that is susceptible to avian leukosis virus; C2. Preparation of an animal model that is susceptible to avian leukosis virus; the nucleotide sequence of the LOXL2 gene is shown as SEQ ID NO. 1; the biomaterial that inhibits expression of the LOXL2 gene includes any one of the following: B1. siRNA that interferes with expression of the LOXL2 gene; B2. sgRNA that knocks out the LOXL2 gene; B3. an expression cassette, a recombinant vector, or a recombinant microorganism that contains the sgRNA of B2; the siRNA is selected from siRNA-1, siRNA-2, or siRNA-3; the sense strand of the siRNA-1 is shown as SEQ ID NO. 3, and the antisense strand is shown as SEQ ID NO. 4; the sense strand of the siRNA-2 is shown as SEQ ID NO. 5, and the antisense strand is shown as SEQ ID NO. 6; the sense strand of the siRNA-3 is shown as SEQ ID NO. 7, and the antisense strand is shown as SEQ ID NO. 8; the sgRNA is selected from sgRNA-1 or sgRNA-2; the upstream primer of the sgRNA-1 is shown as SEQ ID NO. 15, and the downstream primer is shown as SEQ ID NO. 16; the upstream primer of the sgRNA-2 is shown as SEQ ID NO. 17, and the downstream primer is shown as SEQ ID NO.
18.
3. Any one of the following methods: Method I: a method for constructing a cell model that is resistant to avian leukosis virus, comprising the step of overexpressing a LOXL2 gene in a cell using a genetic transformation technique and a biomaterial that promotes expression of the LOXL2 gene; Method II: a method for breeding an animal that is resistant to avian leukosis virus, comprising the step of overexpressing a LOXL2 gene in a fertilized egg of the animal using a genetic transformation technique and a biomaterial that promotes expression of the LOXL2 gene, and stably hereditarily transmitting the LOXL2 gene, thereby breeding the animal that is resistant to avian leukosis virus; the nucleotide sequence of the LOXL2 gene is shown as SEQ ID NO. 1; the biomaterial that promotes expression of the LOXL2 gene is a recombinant vector that contains a nucleotide molecule of the LOXL2 gene.
4. Any one of the following methods: Method I: a method for constructing a cell model sensitive to avian leukosis virus, comprising the step of using genetic transformation technology, using biological materials that inhibit the expression of LOXL2 gene, interfering, silencing or knocking out LOXL2 gene in cells, so that the cells are sensitive to avian leukosis virus; Method II: a method for constructing an animal model sensitive to avian leukosis virus, comprising the step of using genetic transformation technology, using biological materials that inhibit the expression of LOXL2 gene, interfering, silencing or knocking out LOXL2 gene in animal zygotes, and making it stably inherited, so as to construct an animal model sensitive to avian leukosis virus; The nucleotide sequence of the LOXL2 gene is shown in SEQ ID NO. 1; The biological material for inhibiting the expression of LOXL2 gene comprises any one of the following: B1. siRNA for interfering with the expression of the LOXL2 gene; B2. sgRNA for knocking out the LOXL2 gene; B3. expression cassette, recombinant vector or recombinant microorganism containing the sgRNA of B2; The siRNA is selected from siRNA-1, siRNA-2 or siRNA-3; The sense strand of the siRNA-1 is shown in SEQ ID NO. 3, and the antisense strand is shown in SEQ ID NO. 4; the sense strand of the siRNA-2 is shown in SEQ ID NO. 5, and the antisense strand is shown in SEQ ID NO. 6; the sense strand of the siRNA-3 is shown in SEQ ID NO. 7, and the antisense strand is shown in SEQ ID NO. 8; The sgRNA is selected from sgRNA-1 or sgRNA-2; The upstream primer of the sgRNA-1 is shown in SEQ ID NO. 15, and the downstream primer is shown in SEQ ID NO. 16; the upstream primer of the sgRNA-2 is shown in SEQ ID NO. 17, and the downstream primer is shown in SEQ ID NO.
18.
5. Use of the cell model or animal model constructed by the method of claim 4 in screening drugs with therapeutic effect on avian leukosis.
Citation Information
Patent Citations
Catalytic domains from lysyl oxidase and LOXL2
CN102712683A
Use of human LOXL2 gene and related drugs
CN105779577A