Taq enzyme, PCR reaction solution for detecting del blood type and application thereof

Abstract

The application discloses a Taq enzyme for detecting Asian DEL blood type, a PCR reaction solution and application thereof. The Taq enzyme for detecting Asian DEL blood type has an amino acid sequence shown in SEQ ID NO: 2. The conventional PCR for detecting point mutation needs to detect the concentration of genomic DNA, and dilute nucleic acid according to the detection result, so as to prevent the generation of false positive results. The reason is that the difference generated by PCR to single base mutation is not sensitive enough, and the difference between the mutant and the wild type cannot be effectively distinguished. The expressed Taq enzyme can effectively distinguish the single base difference on the genome. The concentration of the genome reaches 30 mu g / mL, and the generation of false positive reaction results can still be avoided.

Description

Technical Field

[0001] This invention relates to the field of blood typing technology, and more specifically, to a Taq enzyme, PCR reaction solution, and their applications for detecting DEL blood type. Background Technology

[0002] In the Rh blood group system, the D antigen (RhD) has the strongest immunogenicity. Most RhD-negative individuals can develop anti-D antibodies through blood transfusions or pregnancy due to immunity from D antigen-positive red blood cells. Pregnant women with RhD-negative blood face a risk of hemolytic disease of the newborn, so antibody screening and anti-D immunoglobulin injections are frequently performed. Studies show that approximately 16.3%–32.6% of the RhD-negative population in China have the "Asian type" DEL blood group, with the molecular genetic background of the RHD1227A genotype. Red blood cells of this blood group express the complete RhD antigen. Transfusions of RhD-positive blood or pregnancy with an RhD-positive fetus will not produce anti-D antibodies; therefore, they should be treated as RhD-positive individuals.

[0003] Accurate identification of the "Asian type" DEL blood type can guide patients with this blood type to avoid unnecessary transfusions of the chronically scarce RhD-negative blood. Their transfusion principles can be the same as those for RhD-positive patients. This not only saves patients transfusion costs but also conserves valuable RhD-negative blood, meeting the needs of true-negative patients. Furthermore, for pregnant women with the "Asian type" DEL blood type, their fetuses do not face the risk of RhD hemolytic disease of the newborn. Accurate identification of the "Asian type" DEL blood type can reduce unnecessary and frequent blood type antibody monitoring during pregnancy. Since it does not produce anti-D antibodies, unnecessary medical interventions to prevent anti-D formation can be avoided, reducing the psychological and economic burden on pregnant women.

[0004] Although "Asian type" DEL red blood cells express complete D antigen epitopes on their surface, the number of antigens is very small, about one-thousandth of that of normal RhD-positive red blood cells. Therefore, routine serological tests are generally RhD negative, and further detection of very weak D antigens in the serum is required.

[0005] The known detection methods for the "Asian type" DEL blood type include absorption-emission method, PCR-SSP method, melting curve analysis method, and gene sequencing method. However, these methods may have drawbacks such as complicated operation steps or high requirements for instruments and reagents. For example, the journal article "Comparative Study on Detection Methods for 'Asian Type' DEL Blood Type" (Chinese Journal of Experimental Diagnostics, December 2021, Vol. 25, No. 12) compared the current detection methods. The absorption-emission method is complicated and time-consuming, and attention to detail is required to improve accuracy. The melting curve analysis method requires high levels of expertise from instruments and personnel. The PCR-SSP method has relatively low accuracy. Summary of the Invention

[0006] Therefore, it is necessary to address the aforementioned technical issues by providing a Taq enzyme, PCR reaction solution, and its application for detecting DEL blood type, so as to enable simple and convenient detection of Asian DEL blood type through real-time PCR detection technology.

[0007] The following technical solution was adopted:

[0008] A Taq enzyme for detecting DEL blood type, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0009] A nucleic acid, wherein the nucleic acid is a nucleotide sequence encoding the aforementioned Taq enzyme, the sequence of which is shown in SEQ ID NO: 1.

[0010] An expression vector carrying the aforementioned nucleic acid.

[0011] Furthermore, the expression vector is a pET series expression vector.

[0012] A PCR reaction solution for detecting DEL blood type includes a PCR mix, MgCl2, upstream primer, downstream primer, probe, dNTPs, and Taq enzyme as described above.

[0013] Furthermore, the PCR reaction solution also includes BSA, trehalose, betaine, and poloxamer.

[0014] Furthermore, the Taq enzyme is modified with glutaraldehyde.

[0015] Furthermore, the PCR reaction solution consisted of: 2.5 μL 10×PCR mix, 0.45 μL 25 mM MgCl2, 0.05 μL 100 μM forward and reverse primers, 0.025 μL 50 μM probe, 1 μL dNTPs (10 mM each), 5 μL 25 mg / mL BSA, 5 μL 30% trehalose, 6.25 μL 5 M betaine, 1 μL 2.5% poloxamer 188, 0.4 U Taq enzyme, and water to a final volume of 20 μL.

[0016] Furthermore, the upstream primer sequence is selected from at least one of GATGACCAAGTTTTCTGG ATA, GATGACCAAGTTTTCTGG AGA, and GATGACCAAGT TTTCTGG ACA.

[0017] A method for detecting DEL blood type, comprising the following steps:

[0018] S10. Obtain the sample to be tested, and add the sample to be tested into the PCR reaction solution to obtain the amplification system;

[0019] S20. The amplification system is cyclically amplified, and the probe signal is collected at the end of each cycle.

[0020] S30. After 45-55 cycles, stop the amplification cycle. If no amplification signal can be obtained using real-time fluorescence PCR, the result is negative; otherwise, if an amplification signal is obtained, the result is positive.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] Existing molecular biological methods for detecting Asian-type DEL mainly include high-resolution melting curve analysis and sequencing. Both methods require high-end real-time PCR instruments and advanced sequencing equipment. The real-time PCR detection method for Asian-type DEL based on a specific Taq enzyme disclosed in this invention, compared to existing technologies, does not require sophisticated real-time PCR instruments or complex procedures such as absorption-emission experiments. It is simple and easy to perform, requiring only ordinary real-time PCR instruments, making it highly suitable for use in primary healthcare institutions.

[0023] Conventional PCR for detecting point mutations requires determining the concentration of genomic DNA and diluting the nucleic acid based on the results to prevent false positives. This is because PCR is not sensitive enough to differences arising from single-base mutations and cannot effectively differentiate between mutant and wild-type mutations. The Taq enzyme constructed and expressed in this invention can effectively distinguish between single-base differences in the genome. Even with a genomic DNA concentration of 30 μg / mL, false positives are still avoided. Attached Figure Description

[0024] To more clearly illustrate the solutions in this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0025] Figure 1 This is an SDS-PAGE electrophoresis image of the Taq enzyme prepared in this invention. M is the protein molecular weight standard, and 2 is the recombinant Taq enzyme expressed in this invention.

[0026] Figure 2 The results of PCR testing of the same Asian DEL blood group DNA and the same RhD positive DNA using the Taq enzyme of this invention and commercially available Taq enzyme are shown in the figure. In the figure, 101 and 201 represent Asian DEL blood group DNA (30 μg / mL), 102 and 202 represent RhD positive blood group (30 μg / mL), 101 and 102 represent the Taq enzyme described in this invention, and 201 and 202 represent the commercially available Taq enzyme.

[0027] Figure 3 To illustrate the effect of different upstream primers on the detection results, in the figure, 301 and 311 are the detection of Asian DEL and RhD true negative samples by real-time PCR amplification based on upstream primer F1, respectively; 302 and 312 are the detection of Asian DEL and RhD true negative samples by real-time PCR amplification based on upstream primer F2, respectively; and 303 and 313 are the detection of Asian DEL and RhD true negative samples by real-time PCR amplification based on upstream primer F3, respectively. Detailed Implementation

[0028] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0029] Reagents:

[0030] Whole blood genomic DNA extraction reagent: a product of Tiangen Biotech (Beijing) Co., Ltd.;

[0031] Nutritional agar and nutritional broth: Products of Beijing Luqiao Technology Co., Ltd.

[0032] Nickel column: Product of Hangzhou Newlong Biotechnology Co., Ltd.;

[0033] 50% glutaraldehyde solution: a product of Sangon Biotech (Shanghai) Co., Ltd.

[0034] All chemical reagents were domestically produced analytical grade reagents.

[0035] instrument:

[0036] Real-time PCR instrument: SLAN-96S, Shanghai Hongshi Medical Technology Co., Ltd.

[0037] Example 1: Expression of Taq enzyme

[0038] The PET-32a+ vector sequence carrying the Taq enzyme sequence (as shown in SEQ ID NO.1) was synthesized by Shanghai Sangon Biotech Co., Ltd.

[0039] The lyophilized plasmid was dissolved in ultrapure water to a concentration of 20 μg / mL; transformed into BL21(DE3) competent cells; plated on ampicillin resistance nutrient agar, picked single colonies, and cultured in ampicillin resistance nutrient broth at 36℃ and 220 rpm.

[0040] IPTG was added at OD600 0.6-0.8 to make the IPTG concentration 1mM, and the culture was continued for 4 hours.

[0041] Collect bacterial cells at 4℃ and 12000 rpm;

[0042] The bacterial cells were resuspended in 20 mM Tris-HCl (pH 8.0), frozen at -80°C, and then thawed at room temperature. This freeze-thaw cycle was repeated three times.

[0043] Collect the supernatant at 4℃ and 12000rpm.

[0044] Example 2 Purification of Taq enzyme

[0045] The nickel column was equilibrated with 5 column volumes of equilibration buffer (20 mM Tris-HCl (pH 8.0));

[0046] The supernatant obtained in Example 1 was loaded onto the column;

[0047] Wash impurities with 10 column volumes of equilibration buffer;

[0048] Wash five column volumes with equilibration buffer containing 5 mM imidazole to further remove impurities;

[0049] Elute with equilibration buffer containing 50 mM imidazole;

[0050] Imidazole was removed by dialysis with 20 mM Tris-HCl (pH 8.0);

[0051] Collect the protein obtained from dialysis and store it at -20°C.

[0052] Example 3: Modification of Taq enzyme

[0053] Dilute the Taq enzyme with PBS to 80,000 U / mL;

[0054] Add glutaraldehyde solution (50%, Shanghai Sangon Biotech Co., Ltd.) to make the final concentration of glutaraldehyde 0.02%.

[0055] React at 2-8℃ for 4 hours;

[0056] Dilute the above Taq enzyme to 5000 U / mL with a solution containing 20 mM Tris-HCl and 1 mg / mL BSA (pH 8.0), and store at -20°C.

[0057] Example 4: Lyophilization of the Asian DEL blood typing real-time PCR system

[0058] 4.1 Preparation of lyophilized real-time PCR reaction solution: 2.5 μL 10×PCR mix (premix), 0.45 μL 25 mM MgCl2, 0.05 μL each of 100 μM forward and reverse primers, 0.025 μL 50 μM probe (5' end labeled with FAM, 3' end labeled with MGB), 1 μL dNTPs (10 mM each), 5 μL 25 mg / mL BSA, 5 μL 30% trehalose, 6.25 μL 5 M betaine, 1 μL 2.5% poloxamer 188, 0.4 U Taq enzyme, add water to 20 μL;

[0059] in,

[0060] The upstream primer sequences were selected from GATGACCAAGTTTTCTGG ATA, GATGACCAAGT TTTCTGG AGA, or GATGACCAAGT TTTCTGG ACA;

[0061] The downstream primer sequence is RTCCTGCAATGCTCCTTACTCC;

[0062] The probe sequence is FAM-CAGCAAGTCA ACATATATAC TCAGG-MGB.

[0063] 4.2 Aliquot the prepared PCR reaction solution into PCR reaction tubes, 25 μL / tube, and freeze-dry using a lyophilizer. Lyophilization conditions: –50℃ for 300 min; –30℃ for 720 min; 25℃ for 300 min. After freeze-drying, heat-seal with aluminum foil, place in an aluminum foil bag, add desiccant, and store under vacuum at room temperature.

[0064] Example 5: Real-time PCR detection of Asian DEL blood type

[0065] S10. Obtain the sample to be tested, and add the sample to be tested into the PCR reaction solution to obtain the amplification system;

[0066] Specifically,

[0067] Genomic DNA was extracted from whole blood using a nucleic acid extraction kit and diluted to 6 μg / mL as the sample to be tested.

[0068] Add 25 μL of diluted DNA to the lyophilized real-time PCR system obtained in Example 4 to dissolve the lyophilized powder, and then place it in a real-time PCR instrument for detection.

[0069] S20. The amplification system is cyclically amplified, and the probe signal is collected at the end of each cycle.

[0070] Specifically, the real-time PCR amplification conditions are: 95℃ for 5 min; 95℃ for 5 s, 60℃ for 40 s, with probe signals (fluorescence collection) collected at the end of each cycle to obtain the threshold Ct;

[0071] S30. After 50 cycles, stop the amplification cycle. If no amplification signal can be obtained using real-time fluorescence PCR, the result is negative; otherwise, if an amplification signal is obtained, the result is positive.

[0072] In this invention, the three upstream primers F1, F2, and F3 can all correctly distinguish between Asian-type DEL specimens and RhD-positive and RhD-true-negative specimens, such as... Figure 3 As shown, 301 and 311 are the detection of Asian-type DEL and RhD true negative samples by real-time PCR amplification based on upstream primer F1, respectively; 302 and 312 are the detection of Asian-type DEL and RhD true negative samples by real-time PCR amplification based on upstream primer F2, respectively; and 303 and 313 are the detection of Asian-type DEL and RhD true negative samples by real-time PCR amplification based on upstream primer F3, respectively.

[0073] Performance evaluation of glutaraldehyde-modified Taq enzyme: Taq enzymes modified with different concentrations of glutaraldehyde were maintained at 97.5℃ for 5 min. The same Asian DEL blood group gene was amplified using the heat-treated enzymes. Based on Examples 3-5, the effect of different concentrations of glutaraldehyde-treated Taq enzymes on PCR amplification performance was verified, as shown in Table 1. Table 1 shows that the Taq enzyme treated with 0.02% glutaraldehyde exhibited the best activity.

[0074] Table 1. Effects of glutaraldehyde modification on Taq enzyme activity

[0075] Glutaraldehyde working concentration (%) Average value of Ct 0 No Ct 0.01 32.46 0.02 30.34 0.04 34.67 0.08 38.87 0.16 No Ct 0.32 No Ct

[0076] Based on Examples 4-5, the effects of different concentrations of BSA, trehalose, and poloxamer 188 on amplification performance and lyophilized products were verified, as shown in Tables 2-4.

[0077] Table 2. Effect of bovine serum albumin (BSA) on detection results

[0078] Final BSA concentration (mg / ml) Average value of Ct freeze-dried products 0 30.21 It does not take shape and has poor water solubility. 1 30.57 It does not take shape and has poor water solubility. 3 32.18 Poor molding properties and poor water solubility 5 29.78 Well-formed and smooth in appearance 7 29.67 Well-formed and smooth in appearance 9 30.89 Well-formed and smooth in appearance 11 31.78 Well-formed and smooth in appearance 13 31.45 Well-formed and smooth in appearance 15 31.67 Well-formed and smooth in appearance 17 32.24 It has good molding properties, a smooth appearance, and poor water solubility. 19 32.43 It has good molding properties, a smooth appearance, and poor water solubility. 20 33.17 It has good molding properties, a smooth appearance, and poor water solubility.

[0079] Table 3. Effects of trehalose on detection results

[0080] Final trehalose concentration (%, W / V) Average value of Ct freeze-dried products 0 30.45 Unformed 2 30.26 Unformed 4 30.17 Poor molding 6 29.43 Well-formed and smooth in appearance 8 29.67 Well-formed and smooth in appearance 10 30.58 Well-formed and smooth in appearance 11 31.06 Well-formed and smooth in appearance

[0081] Table 4. Effects of Poloxamer 188 on performance

[0082] Poloxamer 188 final concentration (%, W / V) Average value of Ct freeze-dried products 0 30.48 Slightly poor water solubility 0.05 30.66 Good water solubility 0.1 30.17 Good water solubility 0.15 30.42 Good water solubility 0.2 32.67 Good water solubility, but slightly poor molding properties. 0.25 32.58 Good water solubility, poor molding properties

[0083] Comparative Example 1

[0084] The difference between Comparative Example 1 and Example 5 is that the Taq enzyme was replaced with commercially available Taq.

[0085] The PCR system prepared with Taq enzyme in this invention (i.e., Example 5) and the commercially available PCR system prepared with Taq (Jiangsu Kangwei Century Biotechnology Co., Ltd., 5×SNP Genotyping Lyo qPCR MIX (UNG), catalog number: CW3398S) detected the same Asian DEL blood group DNA and the same RhD positive DNA. Figure 2 As shown, the Taq enzyme constructed and expressed in this invention can effectively distinguish differences in single bases on the genome, and the concentration of the genome at 30 μg / mL can still avoid false positive results.

[0086] Obviously, the embodiments described above are only some embodiments of this application, not all embodiments. The accompanying drawings show preferred embodiments of this application, but do not limit the patent scope of this application. This application can be implemented in many different forms; rather, the purpose of providing these embodiments is to provide a more thorough and comprehensive understanding of the disclosure of this application. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing specific embodiments, or make equivalent substitutions for some of the technical features. Any equivalent structures made using the content of this application's specification and drawings, directly or indirectly applied to other related technical fields, are similarly within the scope of patent protection of this application.

Claims

1. A PCR reaction solution for detecting DEL blood type, characterized in that, The specific contents are as follows: 2.5 μL 10×PCR mix, 0.45 μL 25 mM MgCl2, 0.05 μL 100 μM upstream and downstream primers, 0.025 μL 50 μM probe, 1 μL dNTPs (10 mM each), 5 μL 25 mg / mL BSA, 5 μL 30% trehalose, 6.25 μL 5 M betaine, 1 μL 2.5% poloxamer 188, 0.4 U Taq enzyme, and water to 20 μL; The Taq enzyme was modified with 0.02% glutaraldehyde; The upstream primer sequences were selected from GATGACCAAGTTTTCTGG ATA, GATGACCAAGT TTTCTGG AGA, or GATGACCAAGT TTTCTGG ACA; The downstream primer sequence is R TCCTGCAATGCTCCTTACTCC; The probe sequence is FAM-CAGCAAGTCA ACATATATAC TCAGG-MGB; The amino acid sequence of the Taq enzyme is shown in SEQ ID NO:

2.

2. A method for detecting DEL blood type, characterized in that, Includes the following steps: S10. Obtain the sample to be tested, and add the sample to be tested to the PCR reaction solution as described in any one of claims 1 to obtain the amplification system; S20. The amplification system is cyclically amplified, and the probe signal is collected at the end of each cycle. S30. After 45-55 cycles, stop the amplification cycle. If no amplification signal can be obtained using real-time fluorescence PCR, the result is negative; otherwise, if an amplification signal is obtained, the result is positive.

Images