Ofur03G005220 gene, specific primer pair, kit and detection method for identifying male and female ostrinia furnacalis

Abstract

The invention relates to an Ofur03G005220 gene, a specific primer pair, a kit and a detection method for identifying male and female Asiatic corn borer. Wherein the nucleotide sequence of the Ofur03G005220 gene for identifying male and female Asiatic corn borer is shown as SEQ ID NO: 1. The invention also provides a specific primer pair for detecting the Ofur03G005220 gene used for identifying male and female Asiatic corn borer, and the specific primer pair is used for detecting the Ofur03G005220 gene used for identifying male and female Asiatic corn borer. The PCR detection method for rapidly identifying male and female Asiatic corn borers comprises the following steps: extracting genomic DNA (Deoxyribose Nucleic Acid) of the Asiatic corn borers; the method comprises the following steps: carrying out PCR (Polymerase Chain Reaction) amplification on an Ofur03G005220 gene by utilizing a specific primer pair; carrying out agarose gel electrophoresis on a PCR amplification product; judging the sex of the ostrinia furnacalis according to an electrophoresis result. The method breaks through the limitation of a conventional morphological identification method, can be used for identifying the sex of the ostrinia furnacalis in each growth stage, and is simple and convenient to operate and high in accuracy.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. Ofur03G005220 The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. BACKGROUND

[0002] Ostrinia furnacalis (Guenee) is one of the major pests of corn, and its larvae feed on the heart leaf, stem, ear axis, silk and bract of corn, which brings various diseases and seriously affects the safe cultivation and production of corn. Ostrinia furnacalis The physiological and biochemical basis research of insects usually needs gender identification, and the gender identification of research objects is also needed in the process of modern pest control method research.

[0003] At present, the gender identification of Ostrinia furnacalis mainly includes morphological identification method and molecular identification method. The morphological identification method is mainly used for the identification of mature larvae, pupae and adult insects, but the method is inconvenient to operate, needs the aid of a microscope, and has limitations on the development stages of Ostrinia furnacalis, and cannot be used for the rapid identification of larvae below the fifth instar and eggs. The existing molecular identification is quantitative PCR for Z chromosome and autosomal genes, and the method is relatively complex in operation and high in cost compared with ordinary PCR.

[0004] Ostrinia furnacalis is a ZZ / ZW sex determination system, and the W chromosome is unique to female individuals, but it does not exclude that the W chromosome has homologous genes with other chromosomes in the genome, so screening a reliable W chromosome specific gene (i.e. female specific gene) can realize the gender identification of all instars of Ostrinia furnacalis.

[0005] SUMMARY The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis.

[0006] The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. Ofur03G005220 The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis.

[0007] The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. Ofur03G005220 The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis.

[0008] The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. Ofur03G005220 The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis. The application belongs to the technical field of molecular markers, and particularly relates to a gene, a specific primer pair, a kit and a detection method for identifying the male and female of Ostrinia furnacalis.

[0009] The present invention also provides a kit for identifying the sex of the Asian corn borer, the kit comprising the specific primer pair as described in claim 2.

[0010] This invention also provides a method for identifying the sex of the Asian corn borer. Ofur03G005220 A rapid PCR detection method for sexing Asian corn borers is characterized by the following steps: 1) extracting genomic DNA from Asian corn borers; 2) using specific primer pairs to... Ofur03G005220 3) Gene amplification was performed by PCR; 4) The PCR amplification products were subjected to agarose gel electrophoresis; 5) The sex of the Asian corn borer was determined by the electrophoresis results, and the sex of the female was determined by the PCR amplification results. Ofur03G005220 The cloned gene fragments showed corresponding bands in the agarose gel electrophoresis image, while the male insects did not show corresponding bands.

[0011] Furthermore, in step 2), the nucleotide sequence of the upstream primer of the specific primer pair is shown in SEQ ID NO: 2; and the nucleotide sequence of the downstream primer of the specific primer pair is shown in SEQ ID NO: 3.

[0012] The beneficial effect of this invention is that it screens out a gene specific to female Asian corn borers. Ofur03G005220 It exists only on the W chromosome and can be detected using specific primer pairs. Ofur03G005220 Genes are amplified by PCR, and the PCR products are subjected to agarose gel electrophoresis. The sex of the Asian corn borer is accurately identified by the electrophoresis results. This invention overcomes the limitations of conventional morphological identification methods and can be used for sex identification of Asian corn borers at all growth stages. This invention is simple to operate, the detection results are easily distinguishable, the accuracy is high, the detection time is short, the cost is low, and it can be used for large-scale detection. Attached Figure Description

[0013] Figure 1 For female and male Asian corn borers Ofur03G005220 Electrophoresis diagram of gene PCR products; Figure 1 In the middle, lane M represents the DL2000 DNA Maker, with band sizes from top to bottom being 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp; lanes 1-12 represent female worms. Ofur03G005220 Gene PCR results; lanes 13-24 are male. Ofur03G005220 Gene PCR results. Detailed Implementation

[0014] The present invention will now be described in detail with reference to the accompanying drawings.

[0015] Example 1: Extraction of genomic DNA (gDNA) from the Asian corn borer 1. Select 12 female Asian corn borers (5 adults, 4 larvae and 3 pupae) and 12 male Asian corn borers (5 adults, 4 larvae and 3 pupae). Place each Asian corn borer in 200 μL of cetyltrimethylammonium bromide mixture (CTAB mixture), grind thoroughly, and then add 800 μL of CTAB mixture.

[0016] 2. Heat in a water bath at 65℃ for 30 minutes, inverting the water every 10 minutes during the process. After the water bath, centrifuge at 25℃ and 12000rpm for 10 minutes.

[0017] 3. Transfer the supernatant from the centrifuge to a new centrifuge tube, add an equal volume (1 mL) of chloroform-isoamyl alcohol mixture (chloroform to isoamyl alcohol volume ratio of 24:1) to the CTAB mixture, and shake in a horizontal shaker for 5 min. Centrifuge at 25℃ and 12000 rpm for 10 min.

[0018] 4. Transfer the supernatant to a new centrifuge tube, add 1 mL of chloroform-isoamyl alcohol mixture (chloroform to isoamyl alcohol volume ratio of 24:1), centrifuge at 25℃ and 12000 rpm for 10 min, and collect all the supernatant (600 μL).

[0019] 5. Add 1 mL of isopropanol to the supernatant from step 4, gently invert to mix, and let stand at -80℃ for 10 min.

[0020] 6. After standing, centrifuge at 25℃ and 12000rpm for 10min and discard the supernatant.

[0021] 7. Add 1 mL of 70% ethanol pre-cooled at -20℃ to the precipitate to precipitate DNA. Centrifuge at 25℃ and 12000 rpm for 10 min. Repeat this step once to obtain the precipitate.

[0022] 8. After centrifugation, place the precipitate on filter paper to dry, dissolve it in 20 μL of ddH2O, and store at -20℃.

[0023] Example 2 Ofur03G005220 Gene screening Filtering criteria: ① Homology screening: The whole gene sequence of chromosome W in the genome of Asian corn borer was extracted, and then BLAST was used to compare the W chromosome genes with other non-W chromosome genes to screen out W chromosome genes that do not have homologous genes.

[0024] ② Expression screening: Using the differentially expressed gene sets between male and female individuals, W chromosome genes that are expressed only in female individuals are screened out.

[0025] W chromosome genes that simultaneously satisfy both ① and ② are identified as W chromosome-specific genes. After screening, genes meeting the above conditions were obtained. Ofur03G005220 The gene, whose nucleotide sequence is shown in SEQ ID NO: 1.

[0026] Design specific primers for this gene. Primer design method: Use the NCBI online primer design tool (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), input the nucleotide fragment of the gene sequence, and obtain the primers. Ofur03G005220 Gene-specific primers, with the primer sequences as follows: Ofur03G005220-F:TCTATGCCTGCCACCGTTAC (SEQ ID NO: 2); Ofur03G005220-R:TTGCAACAGAAAGCGTCTGC (SEQ ID NO: 3).

[0027] by Ofur03G005220 Using the gene as a template, and employing the aforementioned specific primers, [the following is a process / procedure]... Ofur03G005220 The gene is amplified by PCR, and the sex of the Asian corn borer is determined based on the PCR amplification results. Theoretically, because... Ofur03G005220 The gene is specific to the W chromosome. If the above-mentioned specific primers can be used to amplify it... Ofur03G005220 If the gene fragment cannot be amplified, it belongs to the female Asian corn borer; Ofur03G005220 The gene fragment is from the male Asian corn borer.

[0028] Example 3 Ofur03G005220 Verification of sex determination in Asian corn borers using genetic methods This embodiment provides an Asian corn borer of known sex. Ofur03G005220 Gene PCR amplification results are used to verify the utilization Ofur03G005220 Feasibility of genetically determining the sex of Asian corn borers.

[0029] According to the amplification system given in Table 1, the amplification system was used for the following... Ofur03G005220 The gene was amplified by PCR, and the PCR amplification procedure is shown in Table 2.

[0030] Table 1 2x lightening Taq PCR MasterMix Gene PCR amplification system 10 μL Ofur03G00056-F (10 μM) 0.4 μL Ofur03G00056-R (10 μM) 0.4 μL gDNA 1 μL 8.2 μL ddH2O Total volume 20 μL Ofur03G005220 Table 2 Figure 1 Gene PCR amplification program The PCR amplification products were subjected to electrophoresis on a 1% agarose gel at 120V for 22 min. The electrophoretic bands were observed using a gel imaging system, and the PCR products were sequenced by Sangon Biotech (Shanghai) Co., Ltd.

[0031] PCR amplification results as follows Ofur03G005220 As shown, gene fragments were detected around 993 bp in lanes 1-12, while no cloned gene fragments were found around 993 bp in lanes 13-24. This indicates that the gene fragments screened by this invention... ​ Genes can be used for accurate sex determination in Asian corn borers.

[0032] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A method for sexing Ostrinia furnacalis (Guenée) comprising detecting the presence or absence of a gene in a sample of Ostrinia furnacalis (Guenée) wherein the gene is characterized by: Ofur03G005220 The nucleotide sequence thereof is shown as SEQ ID NO:

1. ​ 2. A specific primer pair for detecting the gene of claim 1 for identifying the female and male of Ostrinia furnacalis. Ofur03G005220 characterized in that: The nucleotide sequence of the upstream primer of the specific primer pair is shown as SEQ ID NO: 2; and the nucleotide sequence of the downstream primer of the specific primer pair is shown as SEQ ID NO:

3.

3. A kit for sexing Ostrinia furnacalis, characterized in that: The kit comprises the specific primer pair of claim 2.

4. The use of the method for identifying the sex of Ostrinia furnacalis according to claim 1 Ofur03G005220 The PCR detection method for rapidly identifying the sex of Ostrinia furnacalis is characterized by It comprises the following steps: 1) extracting Asian corn borer genomic DNA; 2) performing PCR amplification on the genes by using specific primer pairs; 3) performing agarose gel electrophoresis on the PCR amplification products; 4) cutting and recovering the target bands; 5) purifying the target bands; 6) connecting the target bands; 7) transforming competent cells; 8) screening positive clones; 9) sequencing the positive clones; and 10) constructing the Asian corn borer gene library. Ofur03G005220 The method comprises the following steps 4) Determine the sex of O. furnacalis by electrophoresis result, the female has Ofur03G005220 The cloned fragment of the gene has corresponding bands in the agarose gel electrophoresis map, and the male has no corresponding bands.

5. The PCR detection method according to claim 4, characterized in that: In step 2), the nucleotide sequence of the upstream primer of the specific primer pair is shown as SEQ ID NO: 2; and the nucleotide sequence of the downstream primer of the specific primer pair is shown as SEQ ID NO: 3.

Images