Generation of adeno-associated virus capsid libraries of insect cells

Abstract

The present invention relates to means and methods for producing adeno-associated virus capsid libraries using insect host cells. In particular, the present invention relates to novel DNA constructs and methods of using these constructs to produce libraries of adeno-associated virus capsids in insect host cells, which minimize the occurrence of cross-packaging and chimeric phenomena in these libraries produced. The present invention further relates to methods for identifying AAV capsid variants having one or more desired characteristics such as, for example, a combination of CNS tropism and peripheral organ de-targeting.

Description

Technical Field

[0001] This invention relates to the fields of medicine, molecular biology, gene therapy, and insect cell culture. In particular, this invention relates to means and methods for generating adeno-associated virus capsid libraries for insect cells. Background Technology

[0002] Adeno-associated virus (AAV) has become a preferred platform for gene therapy. However, the success of AAV-based therapeutic strategies is limited by pre-existing immunity, non-specific tropism, and large-scale, inefficient production. To address these challenges, efforts have been made to engineer novel AAV capsids capable of evading neutralizing antibodies (NAbs) and / or possessing improved tissue tropism or altered specificity.

[0003] AAV capsid libraries have been widely and successfully used to select capsids with improved traits, for example, in directed evolution studies. The generation of such AAV libraries utilizes a mammalian generation platform in Hek293 cells. Libraries generated on this platform have sufficient depth and titer for these types of studies. In this method, AAV libraries are generated by transfecting highly diverse libraries encoding capsid mutants expressed in a “natural” AAV genomic background, with two viral genes (Rep and Cap) flanked by inverted terminal repeats. AAV variants with desired traits can then be isolated through successive rounds of phenotypic selection and viral DNA recovery. Therefore, this method critically relies on excellent genome-capsid “identity” correlation. However, generating AAV capsid libraries on the Hek293 platform requires transfection with a large amount of plasmid DNA, making AAV capsid libraries prone to transgene cross-packaging and chimerism, in which particles are composed of genomes and capsid monomers derived from different library members (see, for example, Schmit et al., 2019, Mol Ther Methods ClinDev [Molecular Therapy - Methods and Clinical Development], 17:107-121).

[0004] Furthermore, capsids derived from libraries produced on mammalian platforms may not be suitable for efficient production on insect cell-based platforms.

[0005] Therefore, there remains a need in the art to address the aforementioned shortcomings and to provide means and methods for generating AAV libraries in insect cells that minimize cross-packaging and chimerism in the resulting libraries. The object of this invention is to provide such means and methods. Summary of the Invention

[0006] In a first aspect, a nucleic acid construct is provided comprising: i) a nucleotide sequence encoding an adeno-associated virus (AAV) capsid variant, wherein the nucleotide sequence encodes mRNA, the translation of which in an insect cell produces the AAV capsid variant, and wherein the nucleotide sequence is operatively linked to a promoter for driving expression in an insect cell; ii) an enhancer element operatively linked to the promoter, wherein the enhancer element depends on a transcriptional trans-regulatory protein, and wherein introduction of the transcriptional trans-regulatory protein into an insect cell containing the nucleic acid construct induces transcription from the promoter; iii) at least one AAV inverted terminal repeat (ITR) sequence; iv) optionally, a reporter gene operatively linked to a promoter for driving expression in a mammalian cell; and v) optionally, a barcode.

[0007] In one embodiment of the nucleic acid construct, the transcriptional trans-regulatory protein is the baculovirus immediate early protein (IE1) or its splice variant (IE0), and the transcriptional trans-regulatory protein-dependent enhancer element is a baculovirus homology region (hr) enhancer element, wherein preferably, the baculovirus is an Autographa californica multicapsid nucleopolyhedrovirus. In one embodiment, the hr enhancer element comprises at least one copy of the hr 28-mer sequence CTTTACGAGTAGAATTCTACGCGTAAAA and / or at least one copy of a sequence whose at least 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides are identical to the sequence CTTTACGAGTAGAATTCTACGCGTAAAA and which binds to the baculovirus IE1 protein, and wherein, when the hr enhancer element is operatively linked to an expression cassette containing a reporter gene operatively linked to a polH promoter, a) under non-inducible conditions, the expression cassette having the hr enhancer element produces less reporter transcript compared to an otherwise identical expression cassette containing the hr2-0.9 element, or the amount of reporter transcript produced by the cassette having the hr enhancer element is 1 / 1.1, 1 / 1.2, 1 / 1.5, 1 / 2, 1 / 5, or 1 / 10 of the amount of reporter transcript produced by an otherwise identical expression cassette containing the hr4b element; and b) Under induction conditions, the amount of reporter transcript produced by the expression cassette having the HR enhancer element is at least 50%, 60%, 70%, 80%, 90%, or 100% of the amount of reporter transcript produced by the otherwise identical expression cassette containing the HR4b or HR2-0.9 element, wherein more preferably, the HR enhancer element is selected from the group consisting of HR1, HR2-0.9, HR3, HR4b, and HR5, wherein HR4b and HR5 are preferred, and HR4b is the most preferred.

[0008] In one embodiment of the nucleic acid construct, the promoter used to drive expression in insect cells is a baculovirus promoter, preferably a late or very late baculovirus promoter, and more preferably a promoter selected from the group consisting of the free polH, p10, p6.9 and pSel120 promoters.

[0009] In one embodiment, the nucleic acid construct further includes a recognition sequence for a nuclease, preferably a site-specific nuclease recognition sequence. In one embodiment, the recognition sequence is a prokaryotic telomerase, preferably a recognition sequence for bacteriophage N15TelN prokaryotic telomerase.

[0010] In one embodiment of the nucleic acid construct, the recognition sequence of the endonuclease is not flanked by at least one AAV ITR sequence, and preferably is not present between two AAV ITR sequences, so that the recognition sequence is not incorporated into the genome of the rAAV vector generated in the insect cell.

[0011] In one embodiment, the nucleic acid construct comprises, in a 5' to 3' order: a) a first AAV ITR sequence; b) the enhancer element; c) an expression cassette containing a nucleotide sequence encoding the AAV capsid variant, the nucleotide sequence being operatively linked to the promoter for driving expression in the insect cell; and d) a second AAV ITR, wherein the recognition sequence is present at at least one of i) upstream of the first AAV ITR and ii) downstream of the second AAV ITR, wherein optionally, the reporter gene operatively linked to the promoter for driving expression in mammalian cells is present between a) and b), b) and c), or c) and d), and wherein optionally, a barcode is present between a) and b), b) and c), or c) and d), and wherein, preferably, the recognition sequence is a unique recognition sequence.

[0012] In one embodiment of the nucleic acid construct, at least one of the following: a) The promoter used to drive expression in mammalian cells is a cell type and / or tissue-specific promoter, preferably selected from the group consisting of: human synaptophysin promoter (hSynl), thyroxine transporter promoter (TTR), cytokeratin 18, cytokeratin 19, unc-45 myosin chaperone B (unc45b) promoter, cardiac troponin T (cTnT) promoter, glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter, and methyl-CpG-binding protein 2 (Mecp2) promoter; b) the reporter gene encodes a colorimetric, fluorescent, or bioluminescent reporter protein, preferably selected from the group consisting of: secretory alkaline phosphatase (SEAP), β-galactosidase EGFP, mCherry, mCloverS, mRubyS, mApple, iRFP, tdTomato, mVenus, YFP, RFP, firefly luciferase, kidney luciferase, and nanoluciferase; and c) The barcode is a nucleotide sequence that is 4-18 nucleotides long.

[0013] In a second aspect, a nucleic acid molecule comprising the nucleic acid construct as described herein is provided. In one embodiment, the nucleic acid molecule is a linear nucleic acid molecule.

[0014] In one embodiment, the linear nucleic acid molecule can be obtained by digestion with a site-specific endonuclease that cleaves at a recognition sequence in the nucleic acid construct.

[0015] In one embodiment, the linear nucleic acid molecule is a nucleic acid molecule in which at least one end of the linear nucleic acid molecule is protected from degradation by exonucleases, preferably both ends of the linear nucleic acid molecule are protected from degradation by exonucleases.

[0016] In one embodiment of the linear nucleic acid molecule, the endonuclease is a prokaryotic telomerase, preferably bacteriophage N15TelN prokaryotic telomerase, and wherein at least one end of the linear nucleic acid molecule is covalently closed, or wherein preferably both ends of the linear nucleic acid molecule are covalently closed.

[0017] In one embodiment of the linear nucleic acid molecule, the positions of elements i) to v) and the recognition sequence in the construct cause expression of the AAV Rep protein in insect cells containing the nucleic acid construct to induce the replication and packaging of the DNA fragment containing elements i) to v) into the AAV capsid.

[0018] In a third aspect, a library is provided that contains multiple nucleic acid molecules containing nucleic acid constructs as described herein.

[0019] In one embodiment, the library is a library in which the nucleotide sequence encoding the AAV capsid variant in each member of the library differs from the nucleotide sequences encoding AAV capsid variants in other members of the library by at least one nucleotide, and preferably, in each member of the library, the nucleotide sequence encoding the AAV capsid variant encodes a capsid variant that differs from the AAV capsid variants encoded by other members of the library by at least one amino acid.

[0020] In a fourth aspect, an insect cell is provided that comprises nucleic acid molecules containing nucleic acid constructs as described herein, or a library comprising (a plurality of) such nucleic acid molecules containing nucleic acid constructs as described herein.

[0021] In one embodiment, the insect cell further comprises a baculovirus vector containing at least one expression cassette for expressing the AAV Rep protein in the insect cell.

[0022] In a fifth aspect, a library comprising multiple AAV capsid variants is provided, wherein members of the library comprise nucleic acids replicated and packaged from members of a library containing nucleic acid molecules having nucleic acid constructs as described herein (e.g., as described in the third aspect).

[0023] In a sixth aspect, a method for preparing libraries of AAV capsid variants is provided. In one embodiment, a method for preparing a library of AAV capsid variants includes the following steps: a) providing a library containing a plurality of nucleic acid constructs as defined above, wherein the amino acid sequence of the AAV capsid variant encoded in the construct of each member in the library differs from the amino acid sequence of the AAV capsid variant encoded in the construct of other members in the library by at least one amino acid; b) preferably amplifying the library of these nucleic acid constructs obtained in a) by rolling circle amplification; c) digesting the amplified library of the nucleic acid constructs obtained in b) by a site-specific endonuclease, the site-specific endonuclease cleaving at a recognition sequence in the nucleic acid construct to produce a library containing linearized amplified nucleic acid constructs of unit length; d) transfecting the library containing the linearized amplified nucleic acid constructs obtained in c) into insect cells; e) infecting the insect cells with a baculovirus vector containing at least one expression cassette for expressing the AAV Rep protein in the insect cells, and culturing the cells; and f) recovering the contents obtained in e) A library of AAV capsid variants produced by these insect cells.

[0024] In one embodiment, a method for preparing a library of AAV capsid variants is as follows, wherein the library in a) is provided by: i) providing a nucleic acid construct as defined in the first aspect; and ii) replacing a fragment containing at least a portion of the nucleotide sequence encoding the AAV capsid variant in the construct with a library of fragments, wherein the amino acid sequence of the AAV capsid variant of each member in the library encoded in the fragment of each member in the library differs from the amino acid sequence of the AAV capsid variant encoded in the construct of other members in the library by at least one amino acid.

[0025] In one embodiment, the method for preparing a library of AAV capsid variants is as follows, wherein: - in step ii), the substitution is performed by Gibson assembly; - in step b), the rolling circle amplification is performed using Φ29 DNA polymerase, preferably in combination with random primers; and / or - in c), the ends of the linearized amplified libraries of these unit-length nucleic acid constructs are protected from exonuclease degradation. In one embodiment, - in step c), the exonuclease is bacteriophage N15 TelN prokaryotic telomerase, which provides covalently closed ends to the linearized amplified libraries of these unit-length nucleic acid constructs.

[0026] In a seventh aspect, a method is provided for identifying AAV capsid variants having a desired characteristic. In one embodiment, the method includes: a) providing a library of AAV capsid variants as defined above or a library of AAV capsid variants obtained as defined above in the method for preparing a library of AAV capsid variants; b) contacting the library with a culture of cells, organoids, or tissues, or administering the library to a nonhuman animal; c) allowing the AAV capsid variants in the library to transduce these cells, organoids, tissues, or cells in the animal; and d) identifying at least one AAV capsid variant in the cells, organoids, tissues, or animals that has been transduced with at least one desired cell type as an AAV capsid variant having the desired characteristic, and optionally recovering the AAV capsid variant having the desired characteristic from the desired cells.

[0027] In one embodiment of the method for identifying AAV capsid variants having the desired characteristics, step d) includes detecting transduction of at least the desired cell by detecting the expression of the reporter gene in the desired cell. In one embodiment of the method, variants having the desired characteristics are identified by sequencing at least one of: i) the barcode and ii) a region of the DNA construct encoding the at least one amino acid difference. Detailed Implementation

[0028] definition

[0029] Unless otherwise defined, the technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Those skilled in the art will recognize that many methods and materials similar to or equivalent to those described and used herein can be employed in the practice of this invention. In fact, this invention is by no means limited to these methods.

[0030] In this document and its claims, the verb "comprising" and its inflections are used in their non-limiting sense to mean including the items that follow the word, but not excluding items not specifically mentioned. Furthermore, unless the context explicitly requires the presence of one / a and only one / a type of element, mentioning an element by the indefinite article "a / a (a or an)" does not preclude the possibility of more than one / a type of element. Therefore, the indefinite article "a / a (a or an)" generally means "at least one / a type".

[0031] As used herein, the term “and / or” indicates that one or more of the stated circumstances may occur individually or in combination with at least one of the stated circumstances, up to and including all of the stated circumstances.

[0032] As used in this article, “at least” a specific value means that specific value or more. For example, “at least 2” is understood as the same as “2 or more” (i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, etc.).

[0033] The word “about” or “approximately” when used in conjunction with a numerical value (e.g., about 10) preferably means that the value can be a given value (10) plus or minus 0.1% of that value.

[0034] As used herein, "effective amount" means the amount of a drug agent required to improve the symptoms of a disease relative to an untreated patient. The effective amount of one or more active agents used in the practice of this invention for therapeutic treatment of, for example, cancer or neurological disorders, varies depending on the manner of administration, the subject's age, weight, and general health condition. Ultimately, the attending physician or veterinarian will determine the appropriate amount and dosage regimen. This amount is referred to as the "effective" amount and can be determined, for example, as genome copies / kilogram (GC / kg) or GC / dose. Therefore, in the context of this disclosure, when referring to the administration of a drug that is "effective" against a disease or condition, this indicates that administration in a clinically appropriate manner would produce a beneficial effect on at least a statistically significant proportion of patients, such as improvement of symptoms, cure, reduction of at least one sign or symptom of the disease, increased lifespan, improved quality of life, or other positive effects generally recognized by physicians familiar with treating that particular type of disease or condition.

[0035] As described in this document, the use of a substance as a pharmaceutical agent can also be interpreted as its use in the manufacture of a pharmaceutical agent. Similarly, whenever a substance is used for treatment or as a pharmaceutical agent, it can also be used to manufacture a pharmaceutical agent for treatment. Products used as pharmaceutical agents as described herein can be used in treatment methods, wherein such treatment methods include the application of the product for use.

[0036] The terms “homology,” “sequence identity,” etc., are used interchangeably herein. Sequence identity is defined herein as the relationship between two or more amino acid (peptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by sequence comparison. In the art, “identity” and “similarity” also mean the degree of sequence correlation between amino acid or nucleic acid sequences, as determined, as in the case of matching strings of such sequences. “Identity” and “similarity” can be readily calculated using known methods.

[0037] "Sequence identity" and "sequence similarity" can be determined by aligning two peptide or nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Global alignment algorithms (e.g., Needleman-Wunsch) are preferred for aligning sequences of similar length, as these algorithms optimally align sequences across their entire length; while local alignment algorithms (e.g., Smith-Waterman) are preferred for aligning sequences of significantly different lengths. Sequences (when optimally aligned using default parameters via, for example, programs GAP or BESTFIT) can be described as "substantially identical" or "commonly similar" when they have at least a minimum percentage of sequence identity (as defined below). GAP uses Needleman and Wunsch global alignment algorithms to align two sequences across their entire length (full length), maximizing the number of matches and minimizing the number of gaps. Global alignment is suitable for determining sequence identity when two sequences have similar lengths. Typically, the default GAP parameters are used, where the vacancy creation penalty = 50 (nucleotides) / 8 (proteins) and the vacancy extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS [Proceedings of the National Academy of Sciences] 89, 915-919). Sequence alignment and sequence identity percentage scores can be determined as follows: using a computer program, such as GCG Wisconsin software package version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, 92121-3752, USA; or using open-source software, such as the programs "needle" (using the global Needman-Onsch algorithm) or "water" (using the local Smith-Waltman algorithm) in EmbossWIN version 2.10.0, using the same parameters as GAP above, or using the default settings (both for "needle" and "water," and both for protein and DNA alignments, the default gap opening penalty is 10.0, and the default gap extension penalty is 0.5; for protein, the default score matrix is ​​Blossum62; and for DNA, the default score matrix is ​​DNAFull). When sequences have significantly different total lengths, local alignment, such as local alignment using the Smith-Waltman algorithm, is preferred.

[0038] Alternatively, the similarity or identity percentage can be determined by searching public databases using algorithms such as FASTA, BLAST, etc. Therefore, the nucleic acid and protein sequences of this invention can be further used as "query sequences" to search public databases, for example, to identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. [Journal of Molecular Biology] 215:403-10. BLAST nucleotide searches can be performed using the NBLAST program (score = 100, word length = 12) to obtain nucleotide sequences homologous to the oxidoreductase nucleic acid molecules of this invention. BLAST protein searches can be performed using the BLASTx program (score = 50, word length = 3) to obtain amino acid sequences homologous to the protein molecules of this invention. To obtain gap-filled alignments for comparison targets, Gapped BLAST can be used, as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402. When using BLAST and Gapped BLAST procedures, the default parameters of the respective procedures (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information (NCBI). http: / / www.ncbi.nlm.nih.gov / .

[0039] As used herein, the terms "selectively hybridizing," "hybridizes selectively," and similar terms are intended to describe hybridization and washing conditions under which nucleotide sequences that are at least 66%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, or more preferably at least 99% homologous to each other typically maintain hybridization. That is, such hybridized sequences may have at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, or more preferably at least 99% sequence identity.

[0040] Preferred, non-limiting examples of such hybridization conditions are hybridization in 6X sodium chloride / sodium citrate (SSC) at about 45°C, followed by washing once or more in 1X SSC, 0.1% SDS at about 50°C, preferably about 55°C, preferably about 60°C, and even more preferably about 65°C.

[0041] Highly stringent conditions include, for example, hybridization at approximately 68°C in 5x SSC / 5x Denhardt solution / 1.0% SDS, followed by washing at room temperature in 0.2x SSC / 0.1% SDS. Alternatively, washing can be performed at 42°C.

[0042] Skilled technicians will know which conditions are suitable for stringent and highly stringent hybridization conditions. Further guidance on such conditions is readily available in the field, for example in the following literature: Sambrook et al., 1989, *Molecular Cloning, A Laboratory Manual*, Cold Spring Harbor Press, New York; and Ausubel et al. (eds.), Sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual" (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York; and 1995, *Current Protocols in Molecular Biology*, (John Wiley & Sons, New York).

[0043] Of course, polynucleotides that hybridize only with a multi-A sequence (such as the 3' end multi(A) bundle of mRNA) or a complementary segment of T (or U) residues will not be included in the polynucleotides of the present invention for specific hybridization with a portion of the nucleic acid of the present invention, because such polynucleotides will hybridize with any nucleic acid molecule containing a multi(A) segment or its complement (e.g., virtually any double-stranded cDNA clone).

[0044] The terms "nucleic acid construct" or "nucleic acid vector" should be understood herein to refer to artificial nucleic acid molecules produced using recombinant DNA technology. Therefore, the term "nucleic acid construct" does not include naturally occurring nucleic acid molecules, although a nucleic acid construct may contain (a portion of) a naturally occurring nucleic acid molecule. A "vector" is a nucleic acid construct (typically DNA or RNA) used to transfer a foreign nucleic acid sequence (i.e., DNA or RNA) into a host cell. The vector is preferably maintained in the host by at least one method of autonomous replication and integration into the genome of the host cell. The terms "expression vector" or "expression construct" refer to a nucleotide sequence capable of influencing the expression of a gene in a host cell or host organism compatible with such a sequence. These expression vectors typically contain at least one "expression cassette," a functional unit capable of influencing the expression of a sequence encoding a product to be expressed, wherein the coding sequence is operatively linked to an appropriate expression control sequence, which at least contains a suitable transcriptional regulatory sequence and optionally a 3' transcription termination signal. Additional factors necessary or helpful in influencing expression, such as expression enhancer elements, may also be present. The expression vector will be introduced into a suitable host cell and is capable of influencing the expression of the coding sequence in an in vitro cell culture of the host cell. Preferred expression vectors will be suitable for expressing viral proteins and / or nucleic acids, particularly recombinant parvovirus proteins and / or nucleic acids, such as baculovirus vectors for expressing parvovirus proteins and / or nucleic acids in insect cells.

[0045] A “parvovirus vector” is defined as a recombinant parvovirus or parvovirus particle containing a polynucleotide delivered in vivo, in vitro, or extracellularly to a host cell. Adeno-associated virus (AAV) vectors are examples of parvovirus vectors. In this document, parvovirus or AAV vector refers to a polynucleotide containing a portion of the parvovirus genome (typically at least one ITR) and a transgenic polynucleotide, preferably packaged within a parvovirus or AAV capsid.

[0046] As used herein, the term "promoter" or "transcriptional regulatory sequence" refers to a nucleic acid fragment that controls the transcription of one or more coding sequences, is upstream of the transcription start site relative to the coding sequence, and is structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcription start site, and any other DNA sequence, including but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequence known to those skilled in the art to directly or indirectly regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated (e.g., by the application of a chemical inducer or biological entity).

[0047] The term “reporter” can be used interchangeably with “marker”, although it is primarily used to refer to visible markers such as green fluorescent protein (GFP) or luciferase.

[0048] The terms “protein” or “polypeptide” are used interchangeably and refer to molecules composed of chains of amino acids without specifying a particular mode of action, size, three-dimensional structure, or origin.

[0049] The term "gene" refers to a segment of DNA contained in a cell that is operatively linked to a suitable regulatory region (e.g., a promoter) and transcribed into an RNA molecule (e.g., mRNA). A gene typically contains several operatively linked segments, such as a promoter, a 5' leader sequence, a coding region, and a 3' untranslated sequence (3' end) containing a polyadenylation site. "Gene expression" refers to the process in which a DNA region operatively linked to a suitable regulatory region (particularly a promoter) is transcribed into RNA that is biologically active, i.e., capable of being translated into a biologically active protein or peptide.

[0050] The term "homologous," when used to indicate the relationship between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, should be understood to mean that in nature, the nucleic acid or polypeptide molecule is produced by a host cell or organism of the same species (preferably the same strain or lineage). If homologous to a host cell, the nucleic acid sequence encoding the polypeptide will typically (but not necessarily) be operatively linked to another (heterologous) promoter sequence and (if applicable) another (heterologous) secretory signal sequence and / or terminator sequence, distinct from its natural environment. It should be understood that regulatory sequences, signal sequences, terminator sequences, etc., can also be homologous to a host cell. In this context, the use of only "homologous" sequence elements allows for the construction of "self-cloning" genetically modified organisms (GMOs) (self-cloning is defined herein as in Annex II of European Directive 98 / 81 / EC). When used to indicate the relevance of two nucleic acid sequences, the term "homologous" means that a single-stranded nucleic acid sequence can hybridize with a complementary single-stranded nucleic acid sequence. The degree of hybridization can depend on a variety of factors, including the amount of identity between the sequences and hybridization conditions (such as temperature and salt concentration, discussed later).

[0051] The terms “heterologous” and “exogenous” when used with respect to nucleic acids (DNA or RNA) or proteins refer to nucleic acids or proteins that are not naturally present as part of the organism, cell, genome, or DNA or RNA sequence in which they are found, or in one or more locations in a cell or genome or DNA or RNA sequence that are not found in nature. Heterologous and exogenous nucleic acids or proteins are not endogenous to the cell in which they are introduced, but have been acquired from another cell or synthesized or recombined. Typically, but not necessarily, such nucleic acids encode proteins that are not typically produced by a cell that transcribes or expresses DNA, i.e., exogenous proteins. Similarly, exogenous RNA encodes proteins that are typically not expressed in cells in which the exogenous RNA is present. Heterologous / exogenous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that is foreign to the cell in which it is expressed, as will be recognized by those skilled in the art, is covered herein by the terms heterologous or exogenous nucleic acids or proteins. The terms heterologous and exogenous also apply to non-natural combinations of nucleic acid or amino acid sequences, i.e., combinations in which at least two of the sequences are foreign relative to each other.

[0052] As used herein, the term "non-naturally occurring" when referring to an organism means that the organism possesses at least one genetic alteration that is not typically found in naturally occurring strains of the reference species (including wild-type strains of the reference species). Genetic alterations include, for example, modifications to expressible nucleic acids encoding proteins or enzymes, additions of other nucleic acids, deletions of nucleic acids, substitutions of nucleic acids, or other functional disruptions of the organism's genetic material. Such modifications include, for example, coding regions and functional segments of heterologous or homologous polypeptides of the reference species. Additional modifications include, for example, non-coding regulatory regions, where modifications alter the expression of genes or operons. Genetic modifications to nucleic acid molecules encoding enzymes or functional segments thereof can confer on non-naturally occurring organisms biochemical reactivity or metabolic pathway capabilities altered from their naturally occurring state.

[0053] As used herein, the term "operably ligated" refers to the ligation of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is "operably ligated" when it is positioned to have a functional relationship with another nucleic acid sequence. For example, if a transcriptional regulatory sequence affects the transcription of a coding sequence, then the transcriptional regulatory sequence is operably ligated to the coding sequence. Operable ligation means that the ligated DNA sequences are typically contiguous, and in cases where the binding of two protein-coding regions is required, contiguous and within the reading frame.

[0054] When expression control sequences control and regulate the transcription and / or translation of nucleotide sequences, they are "operably linked" to the nucleotide sequence. Therefore, expression control sequences can include promoters, enhancers, internal ribosome entry sites (IRES), transcription terminators, start codons preceding protein-coding genes, intron splicing signals, and stop codons.

[0055] The term "expression control sequence" is intended to include at least a sequence whose presence is designed to influence expression, and may also include additional advantageous components. For example, leader sequences and fusion mating sequences are expression control sequences. The term may also include nucleic acid sequence designs that remove unwanted potential start codons, both inside and outside the frame. It may also include nucleic acid sequence designs that remove unwanted potential splicing sites. It includes sequences that guide the addition of multi-A tails or multi-adenosylated sequences (pA), i.e., a string of adenine residues at the 3' end of mRNA, referred to as multi-A sequences. It may also be designed to enhance mRNA stability. Expression control sequences (e.g., promoters) that influence transcriptional and translational stability, and sequences that influence translation (e.g., Kozak sequences), are known in insect cells. Expression control sequences may have properties that allow regulation of nucleotide sequences operatively linked to them, resulting in either lower or higher expression levels.

[0056] As used herein, the term "library" refers to a collection of elements or members that differ from each other in at least one respect. For example, a library of nucleic acid molecules or a library of nucleic acid constructs is a collection of at least two nucleic acid molecules or at least two nucleic acid constructs that differ from each other by at least one nucleotide. Similarly, a library of AAV capsid variants is a collection of at least two AAV capsid variants (viral particles) that differ from each other by at least one nucleotide and / or at least one amino acid in their capsid proteins.

[0057] As used herein, the term "tropism" refers to a virus (e.g., AAV) preferentially targeting cells of a particular host species or specific cell types within that host species. For example, a virus that can infect cells of the heart, lungs, liver, and muscle has a broader (i.e., increased) tropism than a virus that can only infect lung and muscle cells. Trophism can also include a virus's dependence on a specific type of cell surface molecule of the host. For example, some viruses can only infect cells with surface glycosaminoglycans, while others can only infect cells with sialic acid (such dependence can be tested using a variety of cell lines lacking a specific molecule class as potential host cells for viral infection). In some cases, viral tropism describes a relative preference of the virus. For example, a first virus may be able to infect all cell types but is more successful in infecting those with surface glycosaminoglycans. Even if the absolute transduction efficiencies are not similar, a second virus can be considered to have similar (or the same) tropism as the first virus if it also prefers the same characteristics (e.g., the second virus is also more successful in infecting those with surface glycosaminoglycans). For example, a second virus may infect each given cell type tested more effectively than a first virus, but if the relative preferences are similar (or identical), the second virus can still be considered to have similar (or the same) tropism as the first virus. In some embodiments, the tropism of viral particles containing the theme variant AAV capsid protein is unchanged relative to naturally occurring viral particles. In some embodiments, the tropism of viral particles containing the theme variant AAV capsid protein is expanded (i.e., broadened) relative to naturally occurring viral particles. In some embodiments, the tropism of viral particles containing the theme variant AAV capsid protein is reduced relative to naturally occurring viral particles.

[0058] Any references in this document to nucleotide or amino acid sequences accessible in public sequence databases refer to the version of the sequence entry available as of the date of this document's submission. Invention Details

[0059] The inventors have set out to develop means and methods for generating libraries of AAV capsid variants to be produced in insect cells. They have successfully developed such methods that minimize cross-packaging and chimerism in the generated libraries while maintaining sufficient depth and complexity for generating AAV libraries in insect cells.

[0060] In a first aspect, a nucleic acid construct is provided. In one embodiment, the nucleic acid construct comprises: i) a nucleotide sequence encoding an adeno-associated virus (AAV) capsid variant, wherein the nucleotide sequence is operatively linked to a promoter for driving expression in insect cells; ii) an enhancer element operatively linked to the promoter, wherein the enhancer element depends on a transcriptional trans-regulatory protein, and wherein introduction of the transcriptional trans-regulatory protein into an insect cell containing the nucleic acid construct induces transcription from the promoter; and iii) at least one AAV inverted terminal repeat (ITR) sequence.

[0061] In one embodiment, the nucleic acid construct as described herein therefore comprises an expression cassette for expressing an AAV capsid variant in insect cells. An “AAV capsid variant” is understood herein to be an AAV capsid in which at least one capsid protein differs from the corresponding wild-type AAV capsid protein by at least one amino acid.

[0062] In one embodiment, the nucleic acid construct as described herein comprises an expression cassette containing an active promoter in insect cells operatively linked to a nucleotide sequence encoding an mRNA whose translation in the insect cell produces an AAV capsid variant. The nucleotide sequence in the expression cassette thus encodes an mRNA containing an open reading frame, the translation of which in the insect cell produces AAV capsid proteins essential for assembling the AAV capsid variant. The nucleotide sequence in the expression cassette thus encodes an mRNA containing an open reading frame, the translation of which in the insect cell produces at least AAV VP1 and VP3 proteins, since AAV VP2 is not strictly required for complete viral particle formation and effective infectivity (Warrington et al., 2004, J Virol. [Journal of Virology] 78: 6595-609). In a preferred embodiment, the nucleotide sequence in the expression cassette encodes an mRNA containing an open reading frame, the translation of which in the insect cell produces all three of the AAV VP1, VP2, and VP3 proteins. In one embodiment, the expression cassette thus encodes an mRNA containing a single open reading frame (OPF), which is capable of being translated into at least the AAV VP1 and VP3 capsid proteins via a leak scan of the VP1 translation start codon and inactivation of the VP2 translation start codon. In a preferred embodiment, the expression cassette encodes an mRNA containing a single OPF, which is capable of being translated into all three AAV VP1, VP2, and VP3 capsid proteins via a leak scan of the VP1 and VP2 translation start codons.

[0063] Therefore, in one embodiment, the expression cassette of the AAV capsid variant comprises a nucleotide sequence containing a single open reading frame encoding all three of the parvovirus (AAV) VP1, VP2, and VP3 capsid proteins, wherein the start codon for translating the VP1 capsid protein is a suboptimal start codon that is not ATG, as described, for example, by Urabe et al., (2002, ibid.) and in WO 2007 / 046703. The suboptimal start codon for the VP1 capsid protein can be as defined above for the Rep78 protein. More preferred suboptimal start codons for the VP1 capsid protein can be selected from ACG, TTG, CTG, and GTG, with CTG and GTG being the most preferred. In alternative embodiments, the expression cassette comprises a nucleotide sequence containing a single open reading frame encoding all three of the parvovirus (AAV) VP1, VP2, and VP3 capsid proteins, wherein the start codon for translating the VP1 capsid protein is ATG, and wherein the mRNA encoding the VP1 capsid protein as encoded in the nucleotide sequence contains an alternative start codon (as described in WO2019 / 016349) that is different from the VP1 capsid protein open reading frame. Preferably, the alternative start codon is selected from the group consisting of CTG, ATG, ACG, TTG, GTG, CTC, and CTT, with ATG being preferred. Preferably, the AAV capsid protein is the AAV5 serotype capsid protein. Preferably, in this embodiment, the nucleotide sequence contains an alternative open reading frame beginning with an alternative start codon that covers the ATG translation start codon of VP1, thereby preferably, the alternative open reading frame following the alternative start codon encodes a peptide of up to 20 amino acids.

[0064] In one embodiment of the AAV capsid variant expression cassette as described herein, the promoter used to drive expression in insect cells is a baculovirus promoter. In one embodiment, the baculovirus promoter is a late or very late baculovirus promoter, such as a promoter selected from the group consisting of polH, p10, p6.9, and pSel120 promoters. In a preferred embodiment, the late or very late baculovirus promoter is the baculovirus p10 promoter.

[0065] In one embodiment of the expression cassette for the AAV capsid variant as described herein, the expression cassette contains a polyadenylation signal, preferably a polyadenylation signal that induces polyadenylation of the mRNA expressed from the expression cassette in insect cells.

[0066] In one embodiment, the nucleic acid construct as described herein further comprises an enhancer element operatively linked to a promoter for driving the expression of the AAV cap variant in insect cells. "Enhancer element" or "enhancer" means a sequence that defines the enhancement of promoter activity (i.e., increases the transcription rate of sequences downstream of the promoter), which, in contrast to the promoter, does not have promoter activity and is generally unaffected by its position relative to the promoter (i.e., upstream or downstream of the promoter). Enhancer elements are well known in the art. Non-limiting examples of enhancer elements (or portions thereof) that can be used in this invention include baculovirus enhancers and enhancer elements found in insect cells. Preferably, the enhancer element increases the mRNA expression of a gene operatively linked to a promoter in cells by at least 25%, more preferably at least 50%, even more preferably at least 100%, and most preferably at least 200%, compared to the mRNA expression of the gene in the absence of the enhancer element. mRNA expression can be determined, for example, by quantitative RT-PCR.

[0067] In this document, enhancer elements are preferably used to enhance the expression of AAV capsid variants. In one embodiment, in an AAV capsid variant expression cassette as defined herein, at least one enhancer element operatively linked to a promoter is a trans-regulated transcriptional enhancer element. A trans-regulated transcriptional enhancer element is understood herein as an enhancer element that activates transcription of a promoter operatively linked to the enhancer element when bound by a trans-provided trans-regulated transcriptional protein. Thus, in the absence of a trans-regulated transcriptional protein, a promoter operatively linked to an enhancer will result in little or no transcription.

[0068] Therefore, in one embodiment, the transcriptional trans-regulatory protein-dependent enhancer element comprises at least one baculovirus enhancer element and / or at least one ecdysone response element. Preferably, the transcriptional trans-regulatory protein is a baculovirus immediate early protein (IE1) or its splice variant (IE0), and the transcriptional trans-regulatory protein-dependent enhancer element is a baculovirus homology region (hr) enhancer element, wherein preferably, the baculovirus is an Autographacalifornica multicapsid nucleopolyhedrovirus. IE1 is a highly conserved 67-kDa DNA-binding protein that trans-activates baculovirus early gene promoters and supports late gene expression in plasmid transfection assays (see, for example, Olson et al., 2002, J Virol. [Journal of Virology], 76:9505-9515). AcMNPV IE1 has separable domains that facilitate promoter trans-activation and DNA binding. The N-terminal half of this 582-residue phosphoprotein contains transcriptional stimulatory domains of residues 8 to 118 and 168 to 222. IE1 binds to an approximately 28 bp incomplete palindromic sequence (28-mer), which constitutes a repetitive sequence found scattered throughout multiple homologous regions (hr) of the AcMNPV genome. The hr 28-mer is the minimal sequence motif required for IE1-mediated enhancer and origin-specific replication functions.

[0069] In one embodiment, the hr enhancer element is selected from the group consisting of hr1, hr2-0.9, hr3, hr4b, and hr5, wherein hr4b and hr5 are preferred, and hr4b is the most preferred. In alternative embodiments, the hr enhancer element is a variant hr enhancer element, such as, for example, a non-naturally occurring designed element. The variant hr enhancer element preferably comprises at least one copy of the hr28-mer sequence CTTTACGAGTAGAATTCTACGCGTAAAA (SEQ ID NO. 1) and / or at least one copy of the sequence CTTTACGAGTAGAATTCTACGCGTAAAA (SEQ ID NO. 1), wherein at least 18, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides are identical to the sequence CTTTACGAGTAGAATTCTACGCGTAAAA (SEQ ID NO. 1), and this sequence preferably binds to the baculovirus IE1 protein, more preferably to the AcMNPV IE1 protein. The variant hr enhancer element is further preferably functionally defined as follows: when the variant element is operatively linked to an expression cassette containing a reporter gene operatively linked to a polH promoter, a) under non-inducible conditions, the cassette with the variant element produces fewer reporter transcripts compared to an otherwise identical expression cassette containing the hr2-0.9 element but not the variant element, or the amount of reporter transcript produced by the cassette with the variant element is 1 / 1.1, 1 / 1.2, 1 / 1.5, 1 / 2, 1 / 5, or 1 / 10 of the amount of reporter transcript produced by an otherwise identical expression cassette containing the hr4b element but not the variant element; and b) under inducible conditions, the amount of reporter transcript produced by the cassette with the variant element is at least 50%, 60%, 70%, 80%, 90%, or 100% of the amount of reporter transcript produced by an otherwise identical expression cassette containing the hr4b or hr2-0.9 element but not the variant element. Non-inducible conditions should be understood as conditions in which the IE1 protein is absent in the cells in which the cassette is being tested, and inducible conditions should be understood as conditions in which sufficient IE1 protein is present to obtain maximum reporter expression with a reference cassette containing either hr4b or hr2-0.9 elements. The binding of variant hr enhancer elements to baculovirus IE1 protein can be determined by using migration variation assays, as described, for example, by Rodens and Friesen (J Virol. [Journal of Virology] 1995; 69(9):5368-75).

[0070] In one embodiment, the reinforcing element is a non-leaking but relatively weak HR (such as HR4b). In a preferred embodiment, the HR4b reinforcing element is combined with a p10 promoter.

[0071] In one embodiment, the nucleic acid construct as described herein further comprises at least one AAV inverted terminal repeat (ITR) sequence.

[0072] In this text, "at least one AAV inverted terminal repeat nucleotide sequence" should be understood as referring to a palindromic sequence, which mainly consists of complementary, symmetrically arranged sequences, also known as "A," "B," and "C" regions. The ITR acts as the origin of replication, a site that has a "cis" function in replication, acting as a recognition sequence for trans-acting replication proteins such as Rep 78 (or Rep 68), which recognize palindromic sequences and specific sequences within them. An exception to the symmetry of ITR sequences is the "D" region of the ITR. It is unique (there is no complement within an ITR). Chapping of single-stranded DNA occurs at the junction between the A and D regions. This is the region where new DNA synthesis begins. The D region is typically located on one side of the palindromic sequence and provides directionality for the nucleic acid replication step. Parvoviruses replicating in mammalian cells (such as AAV) typically have two ITR sequences. However, ITRs can be engineered so that the binding sites on both strands of the A and D regions are symmetrically positioned, one on each side of the palindromic sequence. On a double-stranded circular DNA template (e.g., a plasmid), Rep78 or Rep68-assisted nucleic acid replication then proceeds in both directions, and a single ITR is sufficient for parvovirus replication in a circular vector. Therefore, a single ITR nucleotide sequence can be used in the context of this invention. However, preferably, two or another even number of conventional ITRs are used. Most preferably, two ITR sequences are used. The preferred ITR is the AAV2 ITR. For safety reasons, it may be desirable to construct recombinant parvovirus (rAAV) vectors that cannot proliferate further after initial introduction into cells in the presence of a second AAV. This safety mechanism for limiting undesirable vector proliferation in the recipient can be provided by using rAAVs with chimeric ITRs, as described in US 2003148506.

[0073] In one embodiment of the nucleic acid construct, the flanking nucleotide sequence comprising an expression cassette containing an AAV capsid variant and an enhancer element operatively linked to the expression cassette (both as defined above) is at least one AAV ITR sequence. Regarding flanking sequences that are one or more other elements herein, the term "flanking" indicates the presence of one or more flanking elements upstream and / or downstream (i.e., 5' and / or 3') relative to the sequence. The term "flanking" is not intended to indicate that the sequence must necessarily be continuous. For example, intercalation sequences may exist between the nucleic acid encoding the transgene and the flanking element. "Flanking" for sequences of two other elements (e.g., ITRs) indicates that one element is located at the 5' of the sequence and the other at the 3' of the sequence; however, intercalation sequences may exist between them. In a preferred embodiment, the nucleotide sequence of (i) is flanked by a parvovirus inverted terminal repeat nucleotide sequence on either side.

[0074] In one embodiment of the nucleic acid construct, the expression cassette of the AAV capsid variant and the flanking elements of the enhancer element operatively connected to the expression cassette (both as defined above) are at least one AAV ITR sequence.

[0075] In one embodiment of the nucleic acid construct, the nucleotide sequence flanking the expression cassette containing the AAV capsid variant and the enhancer element operatively linked to the expression cassette (both as defined above) is at least one parvovirus ITR sequence, which is preferably incorporated into the genome of a recombinant parvovirus (rAAV) vector generated in insect cells. In one embodiment, the nucleotide sequence flanking the expression cassette containing the AAV capsid variant and the enhancer element operatively linked to the expression cassette is two AAV ITR nucleotide sequences, whereby the nucleotide sequence containing the expression cassette containing the AAV capsid variant and the enhancer element is located between the two AAV ITR nucleotide sequences. In one embodiment, if the nucleotide sequence containing the expression cassette containing the AAV capsid variant and the enhancer element is located between two conventional ITRs, or on either side of an ITR engineered with two D regions, the nucleotide sequence can be incorporated into an rAAV vector generated in insect cells. Therefore, in a preferred embodiment, a nucleic acid construct comprising two AAV ITR nucleotide sequences is provided, wherein an expression cassette comprising an AAV capsid variant and an enhancer element operatively linked to the expression cassette are located between the two AAV ITR nucleotide sequences.

[0076] Typically, the nucleic acid construct (containing an ITR and an expression cassette containing an AAV capsid variant and an enhancer element operatively linked to the expression cassette) is 5,000 nucleotides (nt) or less in length to avoid exceeding the maximum AAV packaging limit of 5.5 kbp. However, other embodiments in which ultra-large nucleic acid constructs (e.g., exceeding 5,000 nt in length, or even exceeding the maximum AAV packaging limit of 5.5 kbp) are used still allow for the generation of rAAV vectors and are therefore not excluded.

[0077] The AAV sequences that can be used to generate recombinant AAV viral particles (i.e., AAV vectors) in insect cells, as described herein, can be derived from the genome of any AAV serotype. Typically, AAV serotypes have genome sequences that are significantly homologous at the amino acid and nucleic acid levels, provide the same set of genetic functions, and produce essentially physically and functionally equivalent viral particles, and replicate and assemble through virtually the same mechanisms. For an overview of the genomic sequences and genomic similarities of various AAV serotypes, see, for example, GenBank accession number U89790; GenBank accession number J01901; GenBank accession number AF043303; GenBank accession number AF085716; Chlorini et al. (1997, J. Vir. 71:6823-33); Srivastava et al. (1983, J. Vir. 45:555-64); Chlorini et al. (1999, J. Vir. 73:1309-1319); Rutledge et al. (1998, J. Vir. 72:309-319); and Wu et al. (2000, J. Vir. 74:8635-47). Any AAV serotype can be used as a source of AAV nucleotide sequences for use in the context of this invention. Preferably, the AAV ITR sequence used in the context of this invention is derived from AAV1, AAV2, AAV4, and / or AAV7. Similarly, the Rep (Rep78 / 68 and Rep52 / 40) coding sequences are preferably derived from AAV1, AAV2, AAV4, and / or AAV7. The sequences encoding the AAV capsid proteins used herein are described in more detail below.

[0078] AAV Rep and ITR sequences are particularly conserved across most serotypes. The Rep78 protein of various AAV serotypes, for example, exhibits over 89% identity, and the total nucleotide sequence identity at the genomic level is approximately 82% among AAV2, AAV3A, AAV3B, and AAV6 (Bantel-Schaal et al., 1999, J. Virol. [Journal of Virology], 73(2):939-947). Furthermore, it is known that the Rep sequences and ITRs of many AAV serotypes are effectively cross-complementary (i.e., functionally substituted) with corresponding sequences from other serotypes when generating AAV particles in mammalian cells. US 2003148506 reported that AAV Rep and ITR sequences are also effectively cross-complementary with other AAV Rep and ITR sequences in insect cells. Modified “AAV” sequences can also be used in this context, for example, for generating rAAV vectors in insect cells. Such modified sequences (e.g., sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or higher nucleotide and / or amino acid sequence identity with AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 or AAV13 ITR or Rep (e.g., sequences having about 75%-99% nucleotide sequence identity)) can be used in place of wild-type AAV ITR or Rep sequences.

[0079] Although similar to other AAV serotypes in many respects, AAV5 differs more from other human and simian AAV serotypes than from other known human and simian serotypes. Therefore, in insect cells, the production of rAAV5 can differ from that of other serotypes. In the case of producing rAAV5 using the method of the present invention, it is preferred that one or more constructs (in the case of more than one construct) collectively comprise a nucleotide sequence containing an AAV5 ITR and a nucleotide sequence containing an AAV5 Rep coding sequence (i.e., a nucleotide sequence containing AAV5 Rep78). Such ITR and Rep sequences can be modified as needed to obtain efficient production of rAAV5 or pseudotyped rAAV5 vectors in insect cells. For example, the start codon of the Rep sequence can be modified, the VP splice site can be modified or eliminated, and / or the VP1 start codon and nearby nucleotides can be modified to improve the production of rAAV5 vectors in insect cells.

[0080] In a further embodiment, the nucleic acid construct as described herein optionally includes a reporter gene operatively linked to a promoter for driving expression in mammalian cells. As understood herein, the reporter gene preferably encodes a protein that, when expressed in mammalian cells, produces a colorimetric, fluorescent, or luminescent signal that will allow identification of cells containing and expressing the reporter gene from surrounding cells that do not contain the reporter gene.

[0081] In one embodiment, the reporter gene encodes a protein that produces a colorimetric signal, such as a gene encoding secretory alkaline phosphatase (SEAP) or β-galactosidase.

[0082] In one embodiment, the reporter gene encodes a protein that produces a fluorescent signal, with preferred examples including EGFP, mCherry, mCloverS, mRubyS, mApple, iRFP, tdTomato, mVenus, YFP, and RFP.

[0083] In one embodiment, the reporter gene encodes a protein that produces a luminescent signal, with preferred examples including genes encoding firefly (Photinus pyralis) luciferase and sea kidney (Renilla reniformis, sea pansy) luciferase and nanoluciferase.

[0084] In one embodiment of the nucleic acid construct as described herein, the promoter operatively linked to the reporter gene to drive its expression in mammalian cells is a constitutive promoter. In other embodiments, the promoter operatively linked to the reporter gene is a cell-type and / or tissue-specific promoter. As those skilled in the art will understand, the cell-type and / or tissue specificity of the promoter will depend on the desired cell-type tropism and / or tissue tropism of the AAV capsid variant to be obtained. In some embodiments, the cell-type and / or tissue-specific promoter for driving the expression of the reporter gene in mammalian cells is a promoter selected from the group consisting of: human synaptophysin promoter (hSynl), thyroxine transporter promoter (TTR), cytokeratin 18, cytokeratin 19, unc-45 myosin chaperone B (unc45b) promoter, cardiac troponin T (cTnT) promoter, glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter, and methyl-CpG-binding protein 2 (Mecp2) promoter. In a preferred embodiment, the cell type and / or tissue-specific promoter is the human synaptophysin promoter (hSynl).

[0085] In an embodiment, the nucleic acid construct as described herein optionally includes a reporter gene operatively linked to a promoter for driving expression in mammalian cells, the reporter gene linked to its promoter being flanked by at least one AAV ITR sequence, preferably present between two AAV ITR sequences, such that the reporter gene linked to its promoter, together with an expression cassette containing an AAV capsid variant and an enhancer element operatively linked to the expression cassette, and optionally a barcode, is incorporated into the genome of an rAAV vector generated in insect cells.

[0086] In a further embodiment, the nucleic acid construct as described herein optionally includes a barcode. The barcode is preferably at least one of a sample identifier and a unique molecular identifier (UMI).

[0087] A UMI is a substantially unique sequence or barcode, preferably fully unique, that is, specific to a nucleic acid molecule, i.e., unique for each nucleic acid molecule or construct used herein. A UMI can have a random, pseudo-random, or partially random or non-random nucleotide sequence. A UMI can be used to uniquely identify the original molecule from which a sequencing read is derived. For example, reads from an amplified nucleic acid molecule can be merged from each original nucleic acid molecule into a single common sequence. As indicated above, a UMI can be fully or substantially unique. Fully unique should be understood herein as each nucleic acid molecule or construct provided herein contains a unique tag that differs from all other tags contained in other nucleic acid molecules / constructs used herein. Substantially unique should be understood herein as each nucleic acid molecule or construct provided herein contains a random UMI, but a low percentage of these nucleic acid molecules / constructs may contain the same UMI. Preferably, a substantially unique molecular identifier is used where the chance of labeling identical molecules containing the same sequence with the same UMI is negligible. Preferably, the UMI is fully unique relative to a specific sequence of the nucleic acid molecule or construct, for example, fully unique relative to a specific capsid variant encoded by a specific sequence of the nucleic acid molecule or construct. The UMI preferably has sufficient length to ensure this uniqueness. The identifier sequence can range in length from about 2 to 100 nucleotide bases or more, and preferably has a length between about 4 and 18 nucleotide bases, typically between about 8 and 12 nucleotide bases. Preferably, the identifier sequence does not contain two or more consecutive identical bases. Furthermore, preferably, there are differences between individual identifier sequences of at least two, preferably at least three bases.

[0088] In embodiments where the nucleic acid construct as described herein optionally includes a barcode, the barcode is flanked by at least one AAV ITR sequence, preferably present between two AAV ITR sequences, such that the barcode, along with the nucleotide sequence of an expression cassette containing an AAV capsid variant and an enhancer element operatively linked to the expression cassette, and optionally a reporter gene, is incorporated into the genome of an rAAV vector generated in insect cells.

[0089] In one embodiment, the nucleic acid construct as described herein further comprises a recognition sequence for a nuclease, preferably a site-specific recognition sequence for a nuclease. Therefore, the recognition sequence can be a recognition sequence for a restriction nuclease or a programmable nuclease (such as an RNA-directed CRISPR nuclease, zinc finger nuclease, TAL-effect nuclease, or meganuclease). In a preferred embodiment, the recognition sequence is a recognition sequence for a prokaryotic telomerase.

[0090] Prokaryotic telomerases are site-specific endonucleases that cleave (restrict or digest) double-stranded nucleic acid molecules at their recognition sequences, and simultaneously covalently close the double-stranded ends created by the cleavage. Suitable prokaryotic telomerases for use in the methods described herein are bacteriophage prokaryotic telomerases, such as those selected from the group consisting of: phiHAP-1 from *Halomonas aquamarina*, PY54 from *Yersinia enterolytica*, phiKO2 from *Klebsiella oxytoca*, VP882 from *Vibrio* species, and N15 (TelN) from *Escherichia coli*, or any variant thereof. Prokaryotic telomerases may have the amino acid sequences and recognition sequences disclosed in WO 2010 / 086626, which is incorporated herein by reference. Therefore, in one embodiment, the nucleic acid construct as described herein includes a recognition sequence for phage prokaryotic telomerase as described above. Preferably, the nucleic acid construct includes a recognition sequence for TelN prokaryotic telomerase. In one embodiment, the TelN prokaryotic telomerase recognition sequence comprises or consists of a sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the following sequences:

[0091] 5'-TATCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTATTGTGTGCTGATA-3' (SEQID NO: 2)

[0092] In one embodiment, the recognition sequence of the endonuclease is unique in the nucleic acid construct as described herein, i.e., the recognition sequence appears only once in the nucleic acid construct.

[0093] In one embodiment, in the nucleic acid construct as described herein, the recognition sequence of the endonuclease is not flanked by at least one AAV ITR sequence, preferably not between two AAV ITR sequences, such that the recognition sequence is not incorporated into the genome of the rAAV vector generated in insect cells.

[0094] In one embodiment, the nucleic acid construct as described herein comprises, in a 5' to 3' order: a) a first AAVITR sequence; b) the enhancer element; c) an expression cassette containing a nucleotide sequence encoding the AAV capsid variant, the nucleotide sequence being operatively linked to the promoter for driving expression in the insect cell; and d) a second AAVITR, wherein the (unique) recognition sequence is present at at least one of: i) upstream of the first AAV ITR and ii) downstream of the second AAV ITR, wherein optionally, the reporter gene operatively linked to the promoter for driving expression in mammalian cells is present between a) and b), b) and c), or c) and d), and wherein optionally, a barcode is present between a) and b), b) and c), or c) and d).

[0095] In one embodiment, the nucleic acid construct as described herein is a DNA construct, preferably a double-stranded DNA construct.

[0096] In a second aspect, a nucleic acid molecule comprising the nucleic acid construct as described herein is provided. In one embodiment, the nucleic acid molecule is a DNA molecule, preferably a double-stranded or duplex DNA molecule. In one embodiment, the nucleic acid molecule is a circular nucleic acid molecule.

[0097] In one embodiment, the nucleic acid molecule as described herein is a linear nucleic acid molecule, preferably a linear double-stranded or double-stranded DNA molecule. In one embodiment, the linear nucleic acid molecule is obtained or can be obtained by digestion with a nuclease that cleaves at a recognition sequence in the nucleic acid construct. In one embodiment, the nuclease is a site-specific nuclease, whereby the site-specific nuclease and its recognition sequence are preferably as defined above. Therefore, it should be understood that the linear nucleic acid molecule is obtained or can be obtained by digestion with a nuclease containing a “precursor” molecule of the nucleic acid construct that cleaves at a recognition sequence in the construct. The precursor molecule may be, for example, a circular molecule, or the precursor molecule may be a long multiply molecule containing many copies of the DNA construct, tandemly linked, and is the product of rolling circle amplification (see the methods described below).

[0098] In one embodiment, the nucleic acid molecule as described herein is a linear nucleic acid molecule in which at least one end of the linear nucleic acid molecule is protected from exonuclease degradation, preferably both ends of the linear nucleic acid molecule are protected from exonuclease degradation. The ends of the linear nucleic acid molecule can be protected from exonuclease degradation by means and methods known in the art. For example, the ends of the linear nucleic acid molecule can be chemically protected or protected by attaching an adaptor containing chemical modifications for exonuclease protection (such as a backbone containing phosphate thioesters).

[0099] In one embodiment, the nucleic acid molecule as described herein is a linear nucleic acid molecule, wherein at least one end, preferably both ends, of the linear nucleic acid molecule is protected from exonuclease degradation by covalent closure.

[0100] The ends of double-stranded nucleic acids in which the 3' terminal nucleotide of the corresponding upper strand is covalently linked to the 5' terminal nucleotide of the corresponding lower strand are labeled "closed ends" in this document. Similarly, the ends of double-stranded nucleic acids in which the 5' terminal nucleotide of the corresponding upper strand is covalently linked to the 3' terminal nucleotide of the corresponding lower strand are also labeled "closed ends" in this document. Therefore, "closed ends" are understood in this document as the ends of double-stranded nucleic acids in which the terminal nucleic acids from the opposing strands are covalently linked to each other; while "open ends," conversely, are understood in this document as the ends of double-stranded nucleic acids in which the terminal nucleic acids from the opposing strands are not covalently linked to each other.

[0101] In one embodiment, the nucleic acid molecule as described herein is a linear nucleic acid molecule, wherein at least one end, preferably both ends, of the linear nucleic acid molecule is protected from degradation by exonuclease by covalent closure, and wherein one or more covalently closed ends are obtained by digestion with a prokaryotic telomerase as defined above, preferably by digestion with TelN prokaryotic telomerase or can be obtained therefrom.

[0102] In one embodiment, the nucleic acid molecule as described herein comprises a nucleic acid construct as described herein, wherein the following positions are present: i) a nucleotide sequence encoding an adeno-associated virus (AAV) capsid variant, wherein the nucleotide sequence is operatively linked to a promoter for driving expression in insect cells; ii) an enhancer element operatively linked to the promoter, wherein the enhancer element depends on a transcriptional trans-regulatory protein, and wherein introduction of the transcriptional trans-regulatory protein into an insect cell containing the nucleic acid construct induces transcription from the promoter; iii) at least one AAV inverted terminal repeat (ITR) sequence; iv) optionally, a reporter gene operatively linked to a promoter for driving expression in mammalian cells; v) optionally, a barcode; and the position of a recognition sequence for a nuclease in the construct such that expression of the AAV Rep protein in an insect cell containing the nucleic acid construct causes the DNA fragment containing elements i) to v) to be replicated and packaged into the AAV capsid.

[0103] In a third aspect, a library is provided comprising a plurality of nucleic acid molecules containing nucleic acid constructs as described herein. In one embodiment, the library comprises a plurality of nucleic acid molecules containing nucleic acid constructs as described herein, wherein in each member of the library, the nucleotide sequence encoding an AAV capsid variant differs from the nucleotide sequences encoding AAV capsid variants in other members of the library by at least one nucleotide. In another embodiment, the library comprises a plurality of nucleic acid molecules containing nucleic acid constructs as described herein, wherein in each member of the library, the nucleotide sequence encoding an AAV capsid variant encodes a capsid variant that differs from the AAV capsid variant encoded by other members of the library by at least one amino acid.

[0104] In one embodiment, the nucleotide sequence in the library encoding an AAV capsid variant encodes an AAV capsid variant containing one or more amino acid mutations (e.g., insertions, deletions, and / or substitutions).

[0105] In one embodiment, the nucleotide sequence encoding an AAV capsid variant in the library encodes an AAV capsid variant that contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein. The wild-type AAV capsid protein is understood herein as an AAV capsid protein having the amino acid sequence of a naturally occurring AAV isolate (e.g., a clinical isolate).

[0106] In one embodiment, the nucleotide sequence encoding an AAV capsid variant in the library encodes an AAV capsid variant that contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein in a hypervariable and / or surface-exposed loop of the capsid protein variant.

[0107] In one embodiment, the nucleotide sequence encoding an AAV capsid variant in the library encodes an AAV capsid variant that contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein in the VR region of the surface loop of the capsid protein variant (including at least one of VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, and VR-IX, wherein VR-IV and VR-VIII are preferred, and VR-VIII is more preferred).

[0108] In one embodiment, the difference (mutation) of at least one amino acid compared to the wild-type AAV capsid protein includes the insertion of a peptide. The inserted peptide may contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acids.

[0109] In one embodiment, at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein is introduced into AAV capsid proteins VP1, VP2, or VP3, or into two capsid proteins in any combination, or into all three. In some embodiments, the mutation is introduced into VP1. In some embodiments, the mutation is introduced into VP2. In some embodiments, the mutation is introduced into VP3. In some embodiments, the mutation is introduced into VP1 and VP2. In some embodiments, the mutation is introduced into VP1 and VP3. In some embodiments, the mutation is introduced into VP2 and VP3. In some embodiments, the mutation is introduced into VP1, VP2, and VP3.

[0110] In one embodiment, the aforementioned at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein is a single mutation (e.g., insertion, deletion, and / or substitution of an amino acid) introduced at a single site in the amino acid sequence of the capsid protein, while in other embodiments, more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100 or more (including any number between 1 and 100 or more) of mutations (e.g., insertion, deletion, and / or substitution) are introduced in the amino acid sequence of the capsid protein.

[0111] In one embodiment, the nucleotide sequence encoding an AAV capsid variant in the library encodes an AAV capsid variant that contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein, whereby the wild-type AAV capsid protein can be a serotype capsid protein selected from the group consisting of: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and AAVrh10. In a further embodiment, the wild-type AAV capsid protein may be the capsid protein of clade A, clade B, clade C, clade D, clade E, or clade FAAV isolates, as defined by Gao et al. (2004, J. Virol. [Journal of Virology] 78: 6381-6388), whose exemplary sequences are disclosed in WO 2005 / 033321 and are available from the GenBank® database with accessions AY530553 to AY530629.

[0112] In a fourth aspect, an insect cell is provided that comprises nucleic acid molecules containing nucleic acid constructs as described herein, or a library comprising (a plurality of) such nucleic acid molecules containing nucleic acid constructs as described herein.

[0113] In one embodiment, the insect cells can be any cells suitable for producing heterologous proteins. Preferably, the insect cells allow for the replication of baculovirus vectors and can be maintained in a culture, more preferably in a suspension culture. In a preferred embodiment, the insect cells allow for the replication of recombinant parvovirus vectors, including (r)AAV vectors. For example, the cell lines used can be derived from fall armyworm (Spodoptera frugiperda), fruit fly (Drosophila), or mosquitoes, such as Aedes albopictus-derived cell lines. Preferred insect cells or cell lines are cells from insect species susceptible to baculovirus infection, including, for example, S2 (CRL-1963, ATCC), Se301, SeIZD2109, SeUCR1, Sf9, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, Ha2302, Hz2E5, High Five (Invitrogen, California, USA), and expresSF+. ® (US 6,103,526; Protein Sciences Corp., Connecticut, USA). Preferred insect cells according to the invention are insect cells used to produce recombinant parvovirus vectors (more particularly, recombinant AAV vectors).

[0114] The growth conditions of insect cells in cultures and the production of heterologous products in insect cells in cultures are well known in the art and are described, for example, in the above-cited references on the molecular engineering of insect cells (see also WO 2007 / 046703).

[0115] In one embodiment, an insect cell comprising a nucleic acid molecule as described herein or a library as described herein further comprises a nucleic acid construct containing at least one expression cassette for expressing the AAV Rep protein in the insect cell and a nucleic acid construct containing at least one expression cassette for expressing a transcriptional trans-regulatory protein (e.g., baculovirus immediate early protein (IE1) or its splice variant (IE0)). In a preferred embodiment, a single nucleic acid construct comprises both an expression cassette for expressing the AAV Rep protein and an expression cassette for expressing the transcriptional trans-regulatory protein. More preferably, the single nucleic acid construct is a baculovirus vector containing at least one expression cassette for expressing the AAV Rep protein in the insect cell, since the baculovirus vector already contains at least one expression cassette for expressing the baculovirus immediate early protein (IE1) and / or its splice variant (IE0).

[0116] AAV replicase is a non-structural protein encoded by the rep gene. In wild-type parvoviruses, the rep gene produces two overlapping messenger RNAs (mRNAs) of different lengths due to the internal P19 promoter. Each of these mRNAs can be spliced ​​or not spliced ​​to ultimately produce four Rep proteins: Rep78, Rep68, Rep52, and Rep40. Rep78 / 68 and Rep52 / 40 are important for ITR-dependent AAV genome or transgene replication and viral particle assembly. Rep78 / 68 act as viral replication initiation proteins and as replicases of the viral genome (Chejanovsky and Carter, J Virol. [Journal of Virology], 1990, 64:1764-1770; Hong et al., Proc Natl Acad Sci USA [Proceedings of the National Academy of Sciences of the United States of America], 1992, 89:4673-4677; Ni. et al., J Virol. [Journal of Virology], 1994, 68:1128-1138). The Rep52 / 40 proteins are DNA helicases with 3' to 5' polarity and play a crucial role in packaging viral DNA into empty capsids. The Rep52 / 40 proteins are considered part of the packaging motor complex (Smith and Kotin, J. Virol. [Journal of Virology], 1998, 4874-4881; King et al., EMBO J. [Journal of the European Society for Molecular Biology], 2001, 20:3282-3291). The presence of both Rep68 and Rep40 is not a prerequisite for the production of AAV from baculovirus vectors in insect cell platforms (Urabe et al., 2002).

[0117] A nucleotide sequence encoding one or more AAV Rep proteins is understood herein to encode at least one of two non-structural Rep proteins (Rep 78 and Rep 52), which together are necessary and sufficient for the production of parvovirus vectors in insect cells. The AAV nucleotide sequence is preferably derived from human or primate AAV, and most preferably from AAV that typically infects humans (e.g., serotypes 1, 2, 3A, 3B, 4, 5, 6, 8, and 9) or primates (e.g., serotypes 1 and 4). Examples of nucleotide sequences encoding parvovirus Rep proteins are given in SEQ ID NO: 3-9.

[0118] It should be understood that the exact molecular weights of the Rep78 and Rep52 proteins, as well as the exact positions of the translation start codons, can vary among different parvoviruses. However, those skilled in the art will know how to identify the corresponding positions in the nucleotide sequences of parvoviruses other than AAV-2. Preferably, the nucleotide sequences encode parvovirus Rep proteins that are functionally active in the sense that they possess the activities required for viral replication initiation proteins, viral genome replicases, DNA helicases, and, as described above, for packaging viral DNA into an empty capsid, sufficient to generate parvovirus vectors in insect cells. In one embodiment, possible pseudo-translation initiation sites in the Rep protein coding sequence, other than the Rep78 and Rep52 translation initiation sites, are eliminated. In one embodiment, putative splicing sites that can be identified in insect cells are eliminated from the Rep protein coding sequence. Those skilled in the art will readily understand the elimination of these sites.

[0119] In one embodiment, the nucleic acid construct for expressing parvovirus Rep proteins comprises a single expression cassette for expressing at least both parvovirus Rep78 and Rep52 proteins. In another embodiment, the single expression cassette for expressing at least both parvovirus Rep78 and Rep52 proteins comprises a single open reading frame encoding at least both parvovirus Rep78 and Rep52 proteins and having a suboptimal translation start codon that causes partial exon skipping, such that at least both parvovirus Rep78 and Rep52 proteins are translated in insect cells, as described, for example, in US 8,512,981, which is incorporated herein by reference. Suitable suboptimal translation start codons include, for example, ACG, CTG, TTG, and GTG. In another embodiment, a single expression cassette for expressing at least both the parvovirus Rep78 and Rep52 proteins comprises, in a 5' to 3' order: (i) a first promoter operatively linked to the 5' portion of a first open reading frame (OPF) of the parvovirus Rep78 protein, the first ORF containing a translation start codon; and (ii) an intron containing a second insect cell promoter operatively linked to the 5' portion of at least one additional ORF of the parvovirus Rep52 gene, wherein the at least one additional ORF contains at least one additional translation start codon and overlaps with the 3' portion of the first ORF, as described, for example, in US 8,945,918, which is incorporated herein by reference.

[0120] In another embodiment, the nucleic acid construct for expressing the parvovirus Rep protein comprises at least two separate expression cassettes, one for expressing at least the parvovirus Rep78 protein and the other for expressing at least the parvovirus Rep52 protein. Preferably, in this embodiment, the parvovirus Rep78 protein and the parvovirus Rep52 protein contain a common amino acid sequence, which comprises an amino acid sequence from the second amino acid of the parvovirus Rep52 protein to the C-terminal amino acid, wherein the common amino acid sequence of the parvovirus Rep78 protein and the parvovirus Rep52 protein has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity, and wherein the nucleotide sequence encoding the common amino acid sequence of the parvovirus Rep78 protein and the nucleotide sequence encoding the common amino acid sequence of the parvovirus Rep52 protein have less than 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, or 60% identity, as in the US. As described in 8,697,417, which is incorporated herein by reference. In a further embodiment, the nucleotide sequence encoding the common amino acid sequence of the parvovirus Rep78 protein has an improved codon use bias for the cell compared to the nucleotide sequence encoding the common amino acid sequence of the parvovirus Rep52 protein. However, preferably, the nucleotide sequence encoding the common amino acid sequence of the parvovirus Rep52 protein has an improved codon use bias for the cell compared to the nucleotide sequence encoding the common amino acid sequence of the parvovirus Rep78 protein. Preferably, the difference in codon fitness index (as defined above) between the nucleotide sequences encoding the common amino acid sequence in the parvovirus Rep78 protein and the parvovirus Rep52 protein is at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0, and more preferably, the CAI of the nucleotide sequence encoding the common amino acid sequence in the parvovirus Rep52 protein is at least 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0.

[0121] In one embodiment, the nucleotide sequence encoding the parvovirus Rep78 protein is SEQ ID NO: 9, which encodes the wt AAV Rep78 protein; and the nucleotide sequence encoding the parvovirus Rep52 is selected from one of SEQ ID NO: 4-7, each of which has been modified to have codon usage different from that of the wild-type Rep78 coding sequence of SEQ ID NO: 9. In a preferred embodiment, the nucleotide sequence encoding the parvovirus Rep78 protein is SEQ ID NO: 9, and is used in combination with SEQ ID NO: 7, which is the nucleotide sequence encoding the parvovirus Rep52, and SEQ ID NO: 7 has been modified to be as different from SEQ ID NO: 9 as possible in terms of codon usage.

[0122] In one embodiment, two separate expression cassettes for Rep78 and Rep52 proteins, respectively, in insect cells are optimized to obtain a desired molar ratio of Rep78 to Rep52 proteins in the cells. Preferably, the combination of the Rep78 and Rep52 expression cassettes in the cells produces a Rep78 to Rep52 molar ratio in the range of 1:10 to 10:1, 1:5 to 5:1, or 1:3 to 3:1. More preferably, the combination of the Rep78 and Rep52 expression cassettes produces a Rep78 to Rep52 molar ratio of at least 1:2, 1:3, 1:5, or 1:10. The molar ratio of Rep78 to Rep52 can be determined by Western blotting, preferably using a monoclonal antibody that recognizes a common epitope of both Rep78 and Rep52, or, for example, a mouse anti-Rep antibody (303.9, Progen, Germany; 1:50 dilution). The desired molar ratio of Rep78 to Rep52 can be obtained by selecting promoters in the Rep78 and Rep52 expression cassettes, respectively, as further described below. Alternatively or in combination, the desired molar ratio of Rep78 to Rep52 can be obtained by using methods that reduce the steady-state level of at least one of the parvovirus Rep 78 and 52 proteins. Thus, in one embodiment, the nucleotide sequence of the mRNA encoding the parvovirus Rep protein contains modifications that affect the reduction of the steady-state level of the parvovirus Rep protein. Reduced steady-state conditions can be achieved, for example, by truncating regulatory elements or upstream promoters (Urabe et al., ibid., Dong et al., ibid.), adding protein degradation signal peptides (such as PEST or ubiquitinated peptide sequences), replacing the start codon with a less preferred codon, or by introducing artificial introns as described in WO 2008 / 024998. When using two separate expression cassettes for Rep78 and Rep52 proteins, respectively, in insect cells, the promoter in the Rep52 cassette is preferably stronger than the promoter in the Rep78 cassette. In one embodiment, the corresponding promoters in the Rep78 and Rep52 cassettes are baculovirus promoters. In one embodiment, the corresponding promoters in the Rep78 and Rep52 cassettes are different. In one embodiment, the Rep78 promoter is a delayed early baculovirus promoter, such as the 39k promoter. In one embodiment, the Rep52 promoter is a late or very late baculovirus promoter, such as the polH, p10, p6.9, and pSel120 promoters. In one embodiment, the late or very late baculovirus promoter used in the Rep52 cassette is a different promoter from the promoter used in the nucleic acid constructs defined above, which contain expression cassettes for expressing capsid proteins.

[0123] In a preferred embodiment, the nucleotide sequence encoding at least one of the parvovirus Rep proteins comprises an open reading frame beginning with a suboptimal translation start codon. The suboptimal start codon is preferably a start codon that influences partial exon skipping. Partial exon skipping should be understood herein to mean that at least a portion of the ribosome does not initiate translation at the suboptimal start codon of the Rep78 protein, but can initiate at a more downstream start codon, thereby preferably, the more downstream (first) start codon is the start codon of the Rep52 protein. Alternatively, the nucleotide sequence encoding the parvovirus Rep protein comprises an open reading frame beginning with a suboptimal translation start codon and having no more downstream start codons. The suboptimal start codon preferably influences partial exon skipping when the nucleotide sequence is expressed in insect cells. Preferably, the suboptimal start codon influences partial exon skipping in insect cells to produce a Rep78 to Rep52 molar ratio in the range of 1:10 to 10:1, 1:5 to 5:1, or 1:3 to 3:1 in insect cells. The molar ratio of Rep78 to Rep52 can be determined by Western blotting, preferably using a monoclonal antibody that recognizes the common epitope of both Rep78 and Rep52, or, for example, a mouse anti-Rep antibody (303.9, Progen, Germany; 1:50 dilution).

[0124] The term "suboptimal start codon" in this document refers not only to the trinucleotide start codon itself but also to its sequence background. Therefore, a suboptimal start codon can consist of the "best" ATG codon within a suboptimal sequence background (e.g., a non-Kozak sequence background). However, a more preferred option is a suboptimal start codon where the trinucleotide start codon itself is suboptimal, i.e., not an ATG. Suboptimal should be understood herein to mean that the codon is less efficient in translation initiation in a sequence background that is otherwise identical to a normal ATG codon. Preferably, in a sequence background that is otherwise identical, the efficiency of the suboptimal codon is less than 90%, 80%, 60%, 40%, or 20% of the efficiency of the normal ATG codon. Methods for comparing the relative efficiency of translation initiation are known to those skilled in the art. Preferred suboptimal start codons may be selected from ACG, TTG, CTG, and GTG. ACG is more preferred. The nucleotide sequences encoding parvovirus Rep proteins are understood in this paper to encode nucleotide sequences encoding non-structural Rep proteins, which are required and sufficient for the production of parvovirus vectors in insect cells, such as Rep78 and Rep52 proteins.

[0125] In a fifth aspect, a library comprising multiple AAV capsid variants is provided, wherein members of the library comprise nucleic acids replicated and packaged from members of a library containing nucleic acid molecules having nucleic acid constructs as described herein (e.g., as described in the third aspect). Thus, the library comprises or is composed of multiple AAV vector viral particles, which contain multiple AAV capsid variants and nucleic acid constructs. Therefore, each member of the library comprises an AAV capsid variant containing a mutation (e.g., insertion, deletion, and / or substitution) of one or more amino acids. Preferably, each member of the library comprises an AAV capsid variant containing a mutation compared to a wild-type AAV capsid protein. The mutation in the capsid variant is as defined above. In one embodiment, the library contains at least 10 4 10 5 10 6 10 7 10 8 One or more different AAV capsid variant genes.

[0126] In a sixth aspect, a method for preparing libraries of AAV capsid variants is provided. In one embodiment, a method for preparing a library of AAV capsid variants includes the following steps: a) providing a library containing a plurality of nucleic acid constructs as defined above, wherein the amino acid sequence of the AAV capsid variant encoded in the construct of each member in the library differs from the amino acid sequence of the AAV capsid variant encoded in the construct of other members in the library by at least one amino acid; b) preferably amplifying the library of these nucleic acid constructs obtained in a) by rolling circle amplification; c) digesting the amplified library of the nucleic acid constructs obtained in b) by a site-specific endonuclease, the site-specific endonuclease cleaving at a recognition sequence in the nucleic acid construct to produce a library containing linearized amplified nucleic acid constructs of unit length; d) transfecting the library containing the linearized amplified nucleic acid constructs obtained in c) into insect cells; e) infecting the insect cells with a baculovirus vector containing at least one expression cassette for expressing the AAV Rep protein in the insect cells, and culturing the cells; and f) recovering the contents obtained in e) A library of AAV capsid variants produced by these insect cells.

[0127] In one embodiment, a method for preparing an AAV capsid variant library includes providing a library comprising a plurality of nucleic acid constructs as described herein, wherein in each member of the library, a nucleotide sequence encoding an AAV capsid variant encodes a capsid variant that differs from an AAV capsid variant encoded by other members of the library by at least one amino acid, thereby allowing the AAV capsid variant and its differences to be as described above.

[0128] In one embodiment of the method for preparing an AAV capsid variant library, the library in step a) is provided by: i) providing a nucleic acid construct (as a template or original) as defined above; and ii) replacing a fragment containing at least a portion of the nucleotide sequence encoding the AAV capsid variant in the construct with a fragment of the library, wherein the amino acid sequence of the AAV capsid variant encoded in the fragment of each member in the library differs from the amino acid sequence of the AAV capsid variant encoded in the construct of other members in the library by at least one amino acid. In one embodiment of the method, the replacement of the fragment containing at least a portion of the nucleotide sequence encoding the AAV capsid variant in the construct of step ii) is performed by Gibson assembly (Gibson et al., 2009, Nat Methods. [Natural Methods] 6(5):343-5). In vitro recombinant DNA cloning methods (such as Gibson assembly) are preferably used to avoid bias relative to other members when cloning certain library members, which can occur in in vivo biological host systems.

[0129] In one embodiment, a method for preparing an AAV capsid variant library includes amplifying the library of nucleic acid constructs. The term “amplification” as used herein is to be understood as an in vitro method for preparing copies of a specific nucleic acid or set of nucleic acids, such as nucleic acid construct members in a library. Many methods for amplifying nucleic acids are known in the art, and amplification reactions include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification, rolling circle amplification, transcription-mediated amplification methods (such as NASBA (e.g., U.S. Patent No. 5,409,818)), loop-mediated amplification methods (e.g., “LAMP” amplification using loop-forming sequences, e.g., as described in U.S. Patent No. 6,410,278), and isothermal amplification. In the method, nucleic acid construct members in the library are amplified to obtain sufficient quantities of nucleic acid construct members for transfection of insect cells. In vitro amplification methods are preferred to avoid bias relative to other members when amplifying certain library members, which can occur in in vivo biological host systems. In one embodiment, the library is amplified by rolling circle amplification using a Φ29 DNA polymerase. Phy29 DNA polymerase is a replicative polymerase derived from Bacillus subtilis phage phi29 (Φ29), possessing superior strand substitution and continuous synthesis properties, and inherent 3'→5' proofreading exonuclease activity. In one embodiment, a random primer (e.g., a random hexamer primer) is used to initiate the DNA polymerase (e.g., Φ29 DNA polymerase).

[0130] In one embodiment, a method for preparing an AAV capsid variant library includes digesting the amplified library of the nucleic acid construct obtained in step b) with a site-specific endonuclease, which cleaves at a recognition sequence in the nucleic acid construct to produce a library of linearized amplified nucleic acid constructs of unit length. The site-specific endonuclease cleaves at its recognition sequence in the nucleic acid construct, which is preferably unique within the nucleic acid construct. The site-specific endonuclease, its recognition sequence, and its location within the construct can be as described above.

[0131] In one embodiment, the method for preparing an AAV capsid variant library is as follows, wherein in step c), the ends of the linearized amplified library of unit length nucleic acid constructs are protected against exonuclease degradation. Protection against exonuclease degradation can be provided using the methods and means described above.

[0132] In one embodiment, the site-specific endonuclease is a prokaryotic telomerase that provides covalently closed ends to a linearized amplified library of a unit length of nucleic acid construct. The prokaryotic telomerase is preferably phage N15TelN prokaryotic telomerase. In this embodiment, the nucleic acid construct will therefore contain the recognition sequence of the prokaryotic telomerase discussed, located at the position in the construct as described above.

[0133] In a seventh aspect, a method is provided for identifying AAV capsid variants having a desired characteristic. In one embodiment, the method includes: a) providing a library of AAV capsid variants as defined above or a library of AAV capsid variants obtained as defined above in the method for preparing a library of AAV capsid variants; b) contacting the library with a culture of cells, organoids, or tissues, or administering the library to a nonhuman animal; c) allowing the AAV capsid variants in the library to transduce these cells, organoids, tissues, or cells in the animal; and d) identifying at least one AAV capsid variant in the cells, organoids, tissues, or animals that has been transduced with at least one desired cell type as an AAV capsid variant having the desired characteristic, and optionally recovering the AAV capsid variant having the desired characteristic from the desired cells.

[0134] The method for identifying AAV capsid variants with desired characteristics as described herein further includes step (b), wherein the library is contacted with a culture of cells, organoids, or tissues, or wherein the library is administered to a nonhuman animal. In one embodiment, the culture of cells, organoids, or tissues, or the nonhuman animal, contains at least one desired cell type, such as the cell type for which an AAV capsid variant with improved tropism is to be identified. In one embodiment, the culture of cells, organoids, or tissues, or the nonhuman animal, may further contain at least one undesired cell type, such as the cell type for which the AAV capsid variant to be identified has reduced transduction efficiency. In one embodiment, the library is administered systemically to the nonhuman animal, for example, using an intravenous administration route.

[0135] In the next step (c) of the method for identifying AAV capsid variants having the desired characteristics as described herein, the AAV capsid variants in the library are allowed to transduce cells, organoids, tissues, or cells in an animal. Thus, in one embodiment of step (c), sufficient time is allowed to permit the AAV capsid variants in the library to transduce the (desired) cells, organoids, tissues, or cells in an animal and to express the reporter gene.

[0136] In the next step (d) of the method for identifying an AAV capsid variant having the desired characteristics as described herein, at least one AAV capsid variant is identified, which has been transduced into at least one cell of the desired cell type in cells, organoids, tissues, or animals. In one embodiment, the at least one AAV capsid variant is identified by sequencing its UMI. In one embodiment, the at least one AAV capsid variant is identified as an AAV capsid variant having the desired characteristics. In one embodiment, step (d) further includes recovering the AAV capsid variant having the desired characteristics from cells of the desired cell type.

[0137] In one embodiment, step (d) includes detecting cell transduction of the desired cell type by detecting the expression of a reporter gene in at least one cell of the desired cell type.

[0138] In one embodiment of the method for identifying AAV capsid variants with the desired characteristics as described herein, the desired cell type (e.g., the cell type for which an AAV capsid variant with improved tropism is to be identified) is a cell selected from organs or tissues such as the liver, skeletal muscle, heart, diaphragm, kidney, brain, stomach, intestine, skin, endothelial cells, and lung. In one embodiment of the method for identifying AAV capsid variants with the desired characteristics as described herein, the AAV capsid variant having the desired characteristics to be identified has reduced transduction efficiency in a non-desired cell type, which may be a cell selected from organs or tissues such as the liver, skeletal muscle, heart, diaphragm, kidney, brain, stomach, intestine, skin, endothelial cells, and lung.

[0139] In one embodiment, a method for identifying AAV capsid variants with desired characteristics as described herein is a method in which, in step d), for at least two members in a library, in at least one cell of a desired cell type, at least one of the mRNA expressed by at least two members and the genomic copy number of at least two members is quantified and identified by sequencing their barcodes / UMIs, and wherein the member having the highest mRNA expression level and at least one of the genomic copy number is identified as an AAV capsid variant with the desired characteristics. In one embodiment of the method, in step d), in cells comprising more than one cell type including at least the desired cell type, for at least two members in a library, at least one of the mRNA expressed by at least two members and the genomic copy number of at least two members is quantified and identified by sequencing their barcodes / UMIs, and wherein the member having the most desired distribution on more than one cell type is identified as an AAV capsid variant with the desired characteristics. In one embodiment, the cells of more than one cell type also include at least one non-desired cell type.

[0140] In one embodiment, a method for identifying an AAV capsid variant having the desired characteristic as described herein is a method wherein the variant having the desired characteristic is identified by sequencing i) at least one region of the barcode / UMI and ii) a DNA construct encoding the at least one amino acid difference.

[0141] The invention has been described above with reference to several exemplary embodiments as shown in the accompanying drawings. Modifications to some parts or elements and alternative implementations are possible and are included within the scope of protection as defined in the appended claims. Attached Figure Description

[0142] Figure 1 A DNA scaffold and AAV production method was developed via transfection / baculovirus infection. Rep baculovirus infection with the AAV2 ITR and hr4b enhancer promoted the replication of the transfected DNA scaffold. Furthermore, baculovirus co-infection transactivated the p10 promoter, which drives the expression of the capsid VP protein. The capsid was then assembled into the cell, and subsequently replicated transgenes were packaged into the capsid via the Rep protein, generating an AAV library.

[0143] Figure 2 Transfection / baculovirus infection methods result in low total / total AAV batches because only cells that receive both components can produce AAV capsids and package the transgenes within these capsids.

[0144] Figure 3 The Grit process (Gibson assembly-rolling circle amplification-TelN digestion) involves introducing mutations, amplifying the library, and generating a suitable template for producing an AAV library using transfection / baculovirus infection methods.

[0145] Figure 4 .

[0146] A) AAV2 / 5 was generated using a TelN digestion and transfection / infection method with a rolling circle / AAV2 / 5 scaffold. The AAV2 / 5 scaffold was amplified from plasmid pIMRAku04 via rolling circle amplification. Next, linear covalently closed scaffolds were generated by TelN prokaryotic telomerase digestion. After transfection and baculovirus infection, AAV was harvested and analyzed by Q-PCR and SDS-Page.

[0147] B) AAV2 / 5 scaffold pIMRaku04. The components present on the scaffold are: 1. AAV2 ITR, 2. hr4b enhancer, 3. Nanoluc reporter cassette, 4. AAV2 / 5 capsid expression cassette under the control of the p10 promoter, and 5. TelN prokaryotic telomerase digestion site.

[0148] Figure 5 SDSPage gels were run using purified AAV batches produced with the pIMRaku-04 scaffold or pIMRaku-04 plasmid. The VP123 ratio of the AAV2 / 5 material produced with the pIMRaku-04 scaffold shows the native stoichiometry of AAV at approximately 1:1:10 VP123.

[0149] Figure 6 The library DNA scaffolds pIMRAku-04 AAV2 / 5 and pIMRAku-011 have random 21 bp library insertions at VR-VIII. The insertions should result in the generation of an AAV2 / 5 or AAV9 capsid library with a 7-mer peptide insertion at the exposed loop on the VR-VIII surface. Elements present on the scaffolds are as previously described. Figure 4 As described in b.

[0150] Figure 7 Viral titers in gc / ml of AAV2 / 5 (CLB = crude lysate) and AAV9 (purified) libraries, as measured by qPCR specific for hr4b enhancer elements.

[0151] Figure 8 SDS-PAGE gels were run using purified AAV2 / 5 and AAV9 libraries. For AAV, the capsid stoichiometry of the two libraries showed a native VP123 ratio of 1:1:10.

[0152] Figure 9 Sanger sequencing of the insertion sites in VR-VIII libraries of AAV2 / 5 (A) and AAV9 (B). Sequencing of intermediate samples collected during AAV library generation revealed mixed reads at the insertion sites throughout the generation process.

[0153] Figure 10 The maintenance of complexity during the AAV2 / 5 library generation process using NGS. An initial 1.22 x 10⁻⁶ was detected in the initial G module. 7 Of the variants, 8.1 x 10⁻⁶ was obtained by amplification via the GRiT process. 6 One variant was detected in the preparation of purified AAV2 / 5 library. 3.2 x 10⁻⁶ variants were also detected. 6 One variant. Approximately 25% of the original complexity of the G module was maintained in the purified AAV2 / 5 library.

[0154] Figure 11 . AAV cross-packaging occurs when the genome and capsid mismatch during generation. For example, an AAV5 capsid with an AAV9 genome or an AAV9 capsid with an AAV5 genome.

[0155] Figure 12 .A: A simplified method for determining the cross-packing rate in two capsid libraries generated in expresSF+ or HEK293t cells. AAV2 / 5 and AAV9f were co-generated in SF+ and Hek293t cells. Genomic identity was established by serotype-specific qPCR after sequential purification with serotype-specific affinity resin. The cross-packing percentage was calculated by determining the fraction of mismatched genomes in the obtained pool. B: Percentage of cross-packing after purification with serotype-specific resin (qPCR). Example

[0156] introduction

[0157] In directed evolution studies, AAV capsid libraries have been widely and successfully used to select capsids with improved traits. These AAV libraries are generated using a mammalian generation platform in Hek293 cells. Libraries generated on this platform have sufficient depth and titer for these types of studies. However, their generation requires transfection with large amounts of plasmid DNA, making them susceptible to transgenic cross-packing. Cross-packing occurs when the AAV genome is packaged into a mismatched capsid. AAV libraries with high levels of cross-packing introduce significant noise into downstream analyses in directed evolution studies. This is because there is no guarantee that the detected AAV genome originates from cross-packed or correctly packaged AAV genomes. Therefore, multiple cycles using in vitro or in vivo models are required to increase the confidence that the detected genome (with potentially beneficial capsid traits) originates from correctly packaged AAV rather than cross-packed AAV. These cycles can significantly increase the length of such studies, thereby increasing their cost and reducing the feasibility of selecting directed evolution methods for new capsid development. Therefore, the degree of cross-packing in AAV libraries must be minimized.

[0158] The method we developed in this invention relates to the production of AAV capsid libraries in insect cells. Internal experiments showed that insect cells are highly sensitive to transfection with high levels of exogenous DNA, thereby inducing a self-limiting mechanism when large amounts of DNA are delivered to the cells. The maximum amount of DNA that can be successfully delivered to insect cells falls within the range of 1–2 pg DNA / cell, well below the lower limit of DNA for normal transfection to prepare AAV libraries in Hek293 (> 5 pg DNA / cell). Our developed AAV capsid library production method utilizes this observation and combines it with the transactivation and transgenic replication capabilities introduced into insect cells through co-infection with a replicase (Rep) baculovirus.

[0159] We designed a DNA scaffold that promotes the production of high-titer AAV in insect cells, with a small amount of DNA delivered to the cells via transfection (< 1 pg / cell). After transfection with the DNA scaffold, the cells were co-infected with a baculovirus containing Rep. In the cells, the Rep baculovirus promoted the replication of the DNA scaffold (via the AAV2 ITR and hr4b enhancer) and the transactivation of the promoter (P10) that drives AAV capsid protein expression. Figure 1 Another advantage of this production method is that the produced AAV has a low degree of empty capsid. This is because only cells that have been transfected with a DNA scaffold and infected with Rep baculovirus will produce AAV. Figure 2 ).

[0160] Regardless of the production platform (mammalian or insect cells), AAV libraries require a method for introducing variants into the AAV capsid gene. To develop deep and complex libraries, this introduced variant needs to be maintained throughout the various AAV generation process steps (e.g., variant introduction scaffold, library DNA scaffold amplification, AAV production, and purification). In these instances, the resulting libraries introduce complexity into the capsid gene by inserting a randomized 21 bp DNA sequence into the VR-VIII loop exposed on the surface of the capsid gene. We have developed a three-step approach called GRiT (Gibson assembly-rolling circle amplification-TelN prokaryotic telomerase digestion) that can introduce variants as well as amplify the DNA library scaffold. The GRiT process is capable of maintaining the introduced complexity from the insertion into the DNA library scaffold to amplification.

[0161] In short, a library of 21 bp randomized DNA sequences (encoding a 7-mer peptide) is inserted into a linearized DNA scaffold via Gibson assembly. Gibson assembly recycles the DNA library scaffold, allowing it to be amplified via rolling circle amplification using the phi29 enzyme. Covalently closed individual library DNA scaffolds are generated from the amplified template via TelN prokaryotic telomerase digestion, producing linear cassettes. The main advantage of covalently closed scaffolds is that they enhance transfection efficiency compared to covalently open linear DNA. Finally, the library DNA scaffolds can be transfected into insect cells to produce AAV capsid libraries (AAV). Figure 3 ).

[0162] In the first example, we investigated the feasibility of generating AAV2 / 5 batches in insect cells using a rolling circle amplified / Teln-digested AAV2 / 5 DNA scaffold in the absence of a library. In the second example, we evaluated the GRiT process for generating an AAV2 / 5 library in insect cells with a randomized 7-mer peptide insertion at VR-VIII of the AAV2 / 5 gene. AAV2 / 5 is an AAV5 chimera, where VP1 is derived from AAV2 and VP2 / VP3 is derived from AAV5. Furthermore, we evaluated the applicability of the GRiT process / transfection method to the AAV9 serotype, where we also introduced a randomized 21 bp DNA sequence insertion at VR-VIII of the AAV9 gene and generated a library in insect cells.

[0163] 1. Example 1: AAV generation using AAV2 / 5 DNA scaffolds amplified by rolling circle amplification and digested with TelN prokaryotic telomerase.

[0164] 1.1 Method

[0165] 1.1.1 AAV5 DNA scaffolds were generated by rolling circle amplification and TelN digestion.

[0166] Plasmid pIMRaku-04 (AAV2 / 5, no library; SEQ ID NO. 10) was amplified by rolling circle amplification (RCA) using the EquiPhi29 enzyme (Thermo Fisher Scientific). 10 ng of the plasmid was amplified for 3 h at 43°C in the presence of 100 µM exonuclease-resistant random hexamer (Thermo Fisher Scientific) and 1 mM dNTP (NEB). Following amplification, the DNA was precipitated at 21000 x g for 15 min in the presence of 0.1 x final volume 3 M potassium acetate (pH = 5.2) and 0.7 x final volume 100% isopropanol, followed by washing with 70% ethanol at 21000 x g for 5 min. Finally, the DNA precipitate was dissolved in 5 mM Tris HCl (pH = 8.5). Next, the long linear strand of RCA-amplified DNA was digested into a covalently closed DNA scaffold with ITR flanking structures using TelN prokaryotic telomerase (NEB). Digestion was performed at 30°C using 1 µg of amplified DNA / µl of enzyme. Following digestion, the short linear DNA was purified by column purification using a PCR purification kit (Marshall-Nagel). The DNA concentration of the purified DNA scaffold was determined on a Nanodrop 100 system (Thermo Fisher Scientific).

[0167] 1.1.2 Production of AAV2 / 5 in expresSF+ insect cells using transfection / baculovirus infection method (pIMRaku-04)

[0168] Using Cellfectin II transfection reagent (Thermo Fisher Scientific), multiple concentrations ranging from 0.01 µg to 5 µg of RCA-amplified / TelN-digested pIMRaku-04 scaffolds were transfected into 1.5 x 10⁻⁶ cells. 7 ExpresSF+ cells were used. A circular plasmid control was also used in the experiment. Cells were transfected with an equal volume of DNA, with each condition normalized to 15 µg of DNA using ultrapure herring sperm carrier DNA (Thermo Fisher Scientific). 72 hours post-transfection, fresh baculovirus expressing AAV2 replicase (SEQ ID NO. 14) was seeded into cells at a final volume (40 ml) of 1%. 72 hours post-baculovirus infection, AAV batches were harvested by adding 10x lysis buffer (1.5 M NaCl, 0.5 M Tris-HCl, 1 mM MgCl2, 10% Triton X-100, pH = 8.5) and lysed at 28°C for 1 hour. Genomic DNA was digested at 37°C for 1 hour by benzonase treatment. Cell debris was removed by centrifugation at 1900 xg for 15 minutes, and the supernatant containing AAV2 / 5 was then stored at 4°C. AAV2 / 5 particles were purified from crude lysates using a batch binding protocol with AVB agarose affinity resin (GE Healthcare). Crude AAV cell lysates were added to washed resin (using 0.2 M HPO4, pH = 7.5 buffer). The sample was then incubated at room temperature with gentle mixing for 2 hours. After binding, the resin was washed in 0.2 M HPO4 (pH = 7.5) buffer, and the bound vector was eluted by adding 0.2 M glycine (pH = 2.5). The pH of the eluted vector was immediately neutralized by adding 0.5 M Tris-HCl (pH = 8.5). The purified AAV batches were stored at -20°C.

[0169] 1.1.3 Analysis of AAV batches by qPCR and SDS-PAGE gel electrophoresis

[0170] Titers of lysed AAV2 / 5 batches were determined using Q-PCR specific to the hr4b enhancer region on the scaffold. AAV was treated with DNase at 37°C to degrade exogenous DNA. AAV DNA was then released from the particles by a brief (30 min) heat treatment (37°C) in the presence of 1 M NaOH. The alkaline environment was then neutralized by adding an equal volume of 1 M HCl. The neutralized DNA was diluted 10-fold in WFI 16 ng / µl DOVA, and the samples were then used for QPCR using primers specific to the hr4b element on the transgene: forward CGAGGGATGATGTCATTTGTAGA (SEQ ID NO. 17), reverse ATCCACCGATCTTGCGTTAC (SEQ ID NO. 18), and the probe Fam-ACCGAACTCGCTTTACGAGTAGAATTCT-mgb (SEQ ID NO. 19). The VP protein composition of the purified AAV2 / 5 vector was determined by SDS-PAGE gel electrophoresis. In short, 15 µl of purified AAV2 / 5 was mixed with 5 µl of 4x Leammli loading buffer (Biorad) supplemented with β-mercaptoethanol (Biorad). After a brief heat treatment to denature the protein (95°C for 5 min), the material was loaded onto a clean polyacrylamide gel (Biorad). The sample was then separated by electrophoresis at 200 volts for 35 min. Following electrophoresis, staining (tryptophan-based) was performed under UV light for 5 min, followed by visualization of the VP protein under UV light on a Chemidoc imaging system (Biorad).

[0171] 1.2 Results

[0172] In this example, we investigated whether our DNA scaffold, designed for generating AAV libraries in insect cells, could produce high titers of AAV at the correct capsid virus protein stoichiometry of 1:1:10. An approximately 1:1:10 VP123 stoichiometry reflects the infectious capsid. To generate AAV, the construct pIMRAku04 (AAV2 / 5; SEQ ID NO. 10) was amplified via rolling circle amplification using EquiPhi29 and linearized with TelN prokaryotic telomerase. The linearized pIMRAku04 scaffold was transfected into expresSF+ insect cells at concentrations ranging from 0.01 µg to 5 µg / reaction. Three days post-transfection, cells were infected with baculovirus expressing AAV2 Rep (SEQ ID NO. 14) at 1% v / v. After harvest, AAV2 / 5 particles were purified using a batch binding protocol with AVB agarose gels. Figure 4 a).

[0173] For our experiments, we used the DNA scaffold pIMRAku04, which contains the elements required to produce the AAV2 / 5 capsid. These elements are: 1. A “packaging” AAV transgenic cassette with two AAV2 ITRs flanking it. The ITRs facilitate the replication of the scaffold by Rep in insect cells and the packaging of the scaffold into AAV2 / 5 particles. 2. A barcode-flanked Nanoluc reporter gene controlled by a CNS-specific promoter. The promoter driving reporter expression can vary depending on the tissue type of the library being developed (e.g., liver, CNS, or heart-specific). 3. An AAV2 / 5 capsid expression cassette (SEQ ID NO. 11) controlled by the P10 promoter. Baculovirus infection enhances the activity of the P10 promoter. 4. An hr4b enhancer element that, once intracellular, participates in enhancing scaffold replication in the cell and also transactivates the P10 promoter driving capsid protein expression. 5. TelN prokaryotic telomerase cleavage site, used for linearization and covalent closure of DNA scaffolds with ITR flanks outside the cassette. Figure 4 b).

[0174] After generation, the AAV titer in the crude lysed bulk (CLB) was determined using Q-PCR specific for the hr4b element (Table 1). We used our pIMRAku04 scaffold to find measurable AAV titers under all conditions. Furthermore, we observed that the increase in AAV titer depended on the amount of DNA scaffold transfected. The linearized / covalently closed pIMRAku04 scaffold was approximately 1-log less efficient than plasmid transfection (3.29e+11 for 5 µg plasmid versus 3.70e+10 for 5 µg linearized scaffold). To investigate whether the AAV2 / 5 capsids generated using the pIMRAku04 scaffold contained the correct VP stoichiometry, we performed SDS-PAGE gel electrophoresis on the bulk-bound purified material (…). Figure 6 The VP1 / 2 / 3 ratio of the AAV2 / 5 material produced by this method has a natural ratio of approximately 1:1:10, reflecting the infectious AAV capsid.

[0175] In summary, our designed DNA scaffold produced relatively high titers of AAV batches with a native VP123 protein ratio of approximately 1:1:10, reflecting an infectious capsid. Although the AAV titers produced using the pIMRaku04 scaffold were approximately 1 log lower than those produced using the pIMRaku04 plasmid, the viral load generated per ml of CLB was sufficient for further library development using this scaffold design. This is because AAV libraries used for directed evolution studies in vivo typically have a titer < 5 x 10⁻⁶. 12Injection at relatively low concentrations of gc / kg. These levels are within the productivity range of this AAV production method (when transfecting in the range of 0.5–2 µg scaffold DNA).

[0176] Table 1 Transfection conditions of AAV2 / 5 scaffold pIMRaku-04 in insect cells and AAV titers obtained in crude lysates, as measured by Q-PCR specific to the hr4b promoter.

[0177]

[0178] 2. Example 2: Generation of AAV2 / 5 and AAV9 libraries with randomized 7mer peptide insertions at the variable ring VR-VIII

[0179] 2.1 Methods

[0180] 2.1.1 AAV2 / 5 and AAV9 VR-VIII were generated via Gibson assembly, rolling circle amplification, and TelN digestion (GRiT). Random 21 bp library support

[0181] Plasmid pIMRAku-11 (AAV9; SEQ ID NO. 12, containing the AAV9 expression cassette SEQ ID NO. 13) was digested with XagI (NEB) and BamHI (NEB) restriction enzymes. 50 ng of the linearized plasmid was combined with 6 ng of the G module fragment EcoNI-Cap9-VR8-7mer-BamHI (IDT), with a scaffold to G module ratio of 1:2. The amount of DNA used in the reaction depends on the fragment size. Next, Gibson assembly was performed at 50°C for 2 hours using the NEBuilder HIFI DNA Assembly Kit (NEB). Plasmid pIMRAku-04 (AAV2 / 5) was digested with NcoI restriction enzyme (NEB). 50 ng of the linearized pIMRAku-04 was combined with 6 ng of the G module-7mer AAV5 VIII (IDT), with a scaffold to G module ratio of 1:2. Gibson assembly was performed at 50°C for 2 hours using the NEBuilder HIFI DNA Assembly Kit (NEB). The resulting circularized plasmid containing an AAV9 or AAV2 / 5 capsid library with a randomized 21 bp insertion at the variable loop VR-VIII of the capsid gene was used as a template for rolling circle amplification.

[0182] 10 ng of recirculated AAV2 / 5 or AAV9 library plasmids were amplified at 43°C for 3 h in the presence of 100 µM exonuclease-resistant random hexamer (Thermo Fisher Scientific) and 1 mM dNTP (NEB). Following amplification, the DNA was precipitated at 21000 x g for 15 min in the presence of 0.1 x final volume 3 M potassium acetate (pH = 5.2) and 0.7 x final volume 100% isopropanol, followed by washing with 70% ethanol at 21000 g for 5 min. Finally, the DNA precipitate was dissolved in 5 mM Tris HCl (pH = 8.5). Next, the long linear strand of the RCA-amplified DNA was digested into a covalently closed DNA scaffold flanked by ITRs using TelN prokaryotic telomerase (NEB). Digestion was performed at 30°C using 1 µg of amplified DNA per μL of enzyme. After digestion, the short linear DNA was purified by column purification using a PCR purification kit (Marshall-Nagel). The DNA concentration of the purified DNA scaffold was determined on a nanodrop 100 system (Thermo Fisher Scientific).

[0183] 2.1.2 AAV2 / 5 and AAV9 were generated in expressSF+ insect cells using a transfection / baculovirus infection method. Organized 7mer peptide library

[0184] 1 µg of AAV2 / 5 (pIMRAku-04) or AAV9 (pIMRAku-11) DNA scaffold library was transfected into 1.5e7 expresSF+ cells using Cellfectin II transfection reagent (Thermo Fisher Scientific). 15 µg of total DNA was transfected into the cells, meaning the transfection reaction was supplemented with 14 µg of ultrapure herring sperm vector DNA (Thermo Fisher Scientific). 72 hours post-transfection, fresh baculovirus expressing AAV2 replicase (Bac.VD183) was seeded into the cells at 1% of the final volume (40 ml). 72 hours post-baculovirus infection, AAV batches were harvested by adding 10x lysis buffer (1.5 M NaCl, 0.5 M Tris-HCl, 1 mM MgCl2, 10% Triton X-100, pH = 8.5) and lysed at 28°C for 1 hour. Genomic DNA was digested at 37°C for 1 hour by treatment with a totipotent nuclease. Cell debris was removed by centrifugation at 1900 xg for 15 min, and the supernatant containing the AAV2 / 5 or AAV9 library was stored at 4°C. AAV2 / 5 or AAV9 library particles were purified from the crude lysate using a batch binding protocol with AVB agarose (AAV2 / 5 library) affinity resin (GE Healthcare) or AAVx affinity resin (AAV9, Thermo Fisher Scientific). In short, the crude AAV cell lysate was added to washed resin (with 0.2 M HPO4, pH = 7.5 buffer). The sample was then incubated at room temperature with gentle mixing for 2 h. After binding, the resin was washed with 0.2 M HPO4 (pH = 7.5) buffer, and the bound vector was eluted by adding 0.2 M glycine (pH = 2.5). The pH of the eluted vector was immediately neutralized by adding 0.5 M Tris-HCl (pH = 8.5). Store the purified AAV batch at -20°C.

[0185] 2.1.3 Analysis of AAV2 / 5 and AAV9 library batches by qPCR and SDS-PAGE gel electrophoresis

[0186] The titers of lysed or purified AAV2 / 5 or AAV9 batches were determined using Q-PCR specific to the hr4b enhancer. AAV was treated with DNase at 37°C to degrade exogenous DNA. AAV DNA was then released from the particles by a brief (30 min) heat treatment (37°C) in the presence of 1 M NaOH. Next, the alkaline environment was neutralized by adding an equal volume of 1 M HCl. The neutralized DNA was diluted 10-fold in WFI 16 ng / µl DOVA, and the samples were then used for QPCR using primers specific to the hr4b element on the transgene: forward CGAGGGATGATGTCATTTGTAGA (SEQ ID NO. 17), reverse ATCCACCGATCTTGCGTTAC (SEQ ID NO. 18), and probe Fam-ACCGAACTCGCTTTACGAGTAGAATTCT-mgb (SEQ ID NO. 19). The VP protein composition of purified AAV2 / 5 or AAV9 libraries was determined by SDS-PAGE gel electrophoresis. Briefly, 15 µl of purified AAV2 / 5 was mixed with 5 µl of 4x Leammli loading buffer (Bio-Rad Laboratories) supplemented with β-mercaptoethanol (Bio-Rad Laboratories). After a brief heat treatment to denature the protein (95°C for 5 min), the material was loaded onto a clean polyacrylamide gel (Bio-Rad Laboratories). The sample was then electrophoretically separated at 200 volts for 35 min. Following electrophoresis, staining (tryptophan-based) was performed under UV light for 5 min, followed by visualization of the VP protein under UV light on a Chemidoc imaging system (Bio-Rad Laboratories).

[0187] 2.1.4 Sanger and whole-genome sequencing of AAV2 / 5 and AAV9 libraries

[0188] Following the kit protocol, viral transgenic DNA was isolated from AAV2 / 5 and AAV9 libraries using the Purelink Viral DNA / RNA Mini Kit (Thermo Fisher Scientific). Fragments containing the library inserts were amplified by PCR using primers specific to the VR-VIII insertion site (AAV2 / 5 VR-VIII forward ACCAGCGAGAGCGAGAC and reverse CTGCCGGGCACGATTTC, AAV9 VR-VIII forward AAAGCCTGGACCGACTAATG and reverse TCTGTCCTGCCAAACCATAC; SEQ ID Nos. 20-23, respectively). After column purification of the PCR products (Marshall-Nagel), the presence of random insertions was verified by Sanger sequencing (using the same primers as the PCR amplifications, Macrogen) and next-generation sequencing (Genomscan). Whole-genome sequencing was performed using the following settings: Paired-end 150 bp sequencing runs were performed on a NovaSeq 6000 (Illumina), acquiring 3 Gb of data per library. A barcode detection algorithm was used. https: / / github.com / JonasWeinmann / AAV-barcode-detection-and- Normalization involves comparing DNA samples. .

[0189] 2.1 Results

[0190] This example investigates whether AAV2 / 5 (pIMRaku-04) and AAV9 (pIMRaku-11) scaffolds can be used to generate AAV libraries, where a randomized 7-mer peptide is inserted at the variable loop VR-VIII. Furthermore, we investigate the maintenance of the complexity introduced into the AAV5 and AAV9 capsid genes using Gibson assembly throughout various procedural steps of AAV library generation.

[0191] Use previously Figure 3 The GRiT process described in [Example 1] inserts a randomized 21 bp DNA library at the variable loop VR-VIII of the AAV2 / 5 and AAV9 capsid genes. AAV2 / 5 and AAV9 libraries were generated using the transfection infection method described in Example 1. The DNA scaffolds used in this example are summarized in [Example 2]. Figure 7 In, and contains the same as previously in Figure 4The same elements are described in b, the only difference being that the capsid expression cassette is AAV2 / 5 (pIMRAku04) or AAV9 (pIMRaku11). To investigate the library's producibility, AAV2 / 5 and AAV9 DNA library scaffolds were transfected into insect cells at various concentrations. After transfection with the library DNA scaffolds and infection with AAV2 Rep baculovirus (SEQ ID NO. 14), crude cell lysates were harvested. The AAV library was purified from the lysates using AVB agarose (AAV2 / 5 library) or AAVx POROS (AAV9 library) affinity resin.

[0192] The viral titer (in gc / ml) of the crude lysate (CLB, AAV2 / 5 library) or purified (BBNE, AAV9 library) library was determined using qPCR specific for the hr4b enhancer. Figure 8 For both AAV2 / 5 and AAV9 libraries, we observed reduced productivity compared to the plasmid control without library inserts. Productivity for the AAV2 / 5 library decreased by approximately 2 log relative to the plasmid control and by 1 log relative to the net scaffold production in Example 1 (Table 1). For the AAV9 library, the decrease in productivity appeared to be approximately 1.5 log relative to the plasmid control. Since not all inserts introducing AAV2 / 5 or AAV9 capsid DNA libraries are capable of generating capsids (due to capsid misfolding), a decrease in AAV library titers is expected. Furthermore, we observed reduced AAV library production when less library DNA was transfected into insect cells. In summary, introducing complexity into the scaffold reduces productivity for both serotypes. However, library titers remain high enough for use in in vivo directed evolution studies. Library production conditions for directed evolution studies must be balanced between the need for AAV library titers in in vivo experiments and the need to reduce cross-packaging.

[0193] The purified AAV2 / 5 and AAV9 libraries were also analyzed by SDS-PAGE to determine the capsid stoichiometry and VP size. Figure 8 For both AAV2 / 5 and AAV9 libraries, the capsid stoichiometry fell within the native VP123 ratio of approximately 1:1:10. Interestingly, the VP proteins of both AAV2 / 5 and AAV9 appeared slightly heavier than the plasmid control (as observed by a slight increase in fragment size of the libraries on the gel, due to...). Figure 8 (As indicated by the arrow in the image). This can be explained by the 7aa insertion in the VP protein of the library. This should result in a heavier capsid, and thus cause the VP protein of the library to shift on the gel.

[0194] Next, we investigated whether the randomized 21 bp fragment was successfully inserted into our DNA scaffold during AAV library generation, and whether this was achieved. Using a primer set specific to the VR-VIII region of the AAV2 / 5 and AAV9 capsid genes, the region surrounding the library insertion site was amplified by PCR. This PCR was performed on intermediate samples taken during the generation of AAV2 / 5 and AAV9 libraries. The intermediates included 1. the original library G module (AA2 / 5), 2. Gibson assembly (AA2 / 5), 3. the RCA library amplification reaction (AAV2 / 5), 4. unpurified lysates from AAV library generation (CLB, AAV2 / 5, and AAV9), and 5. the purified library (BBNE, AAV2 / 5, and AAV9). The presence of the library insertion was analyzed via Sanger sequencing of the amplified PCR products. This analysis provides a qualitative assessment of the presence of the intermediate library, as the randomized DNA insertion should produce mixed reads at the insertion site in the sequence chromatogram. Sequence analysis confirmed the presence of mixed reads at the insertion site throughout the production of both AAV2 / 5 and AAV9 libraries (Figure 9). This result confirms that our library amplification (GRiT) and AAV generation (transfection / infection) methods allow us to introduce and maintain the insertion throughout the AAV library production process.

[0195] In the final evaluation of the AAV2 / 5 library, we monitored the complexity of the 21 bp insertion and quantitatively tracked its maintenance throughout the AAV library generation process. Based on the PCR products previously generated for Sanger sequencing, we performed next-generation sequencing analysis. We obtained 3 GB of 150 bp paired end reads from the following intermediate samples on the NovaSeq 6000 system: 1) the original library G module; 2) the RCA library amplification reaction; and 3) the purified library. We then aligned the obtained sequence reads with the AAV2 / 5 capsid and used a barcode detection algorithm. https: / / github.com / JonasWeinmann / AAV-barcode-detection-and-normalization The number of insertions found in the quantitative data pool. We found 1.22 x 10^6 insertions detected in the initiator G module. 7 Of the 21 bp insertion variants, 8.1 x 10 6 3.2 x 10^10 DNA libraries were transformed into the amplified DNA library. 6 The variants were eventually transferred to the AAV2 / 5 capsid library ( Figure 10Throughout the process, 25% of the original complexity present in the G module was transferred to the AAV capsid library, with most of the diversity lost during AAV generation. This loss is likely due to the high percentage of misfolded AAV capsids resulting from infeasible insertions. However, the complexity was well maintained during library DNA amplification, likely due to the rolling circle amplification method used to generate the scaffold.

[0196] In summary, we have developed a DNA scaffold suitable for generating AAVs in insect cells via a transfection / baculovirus infection-based process. The GRiT process enables the insertion of random 21 bp DNA inserts into this scaffold and their amplification without significant loss of complexity. AAV generation using these DNA libraries results in AAV libraries of sufficient concentration and complexity for use in directed evolution studies.

[0197] 3. Example 3: Comparative analysis of genome cross-packaging in AAV libraries produced in Hek293t and expresSF+ insect cells

[0198] 3.1 Method

[0199] 3.1.1 HEK293t and AAV9f and AAV2 / 5 DNA scaffold production and AAV production in insect cells

[0200] Linear DNA suitable for generating AAV9F and AAV2 / 5 capsids in Hek293t or expresSF+ was generated from plasmids containing capsid expression cassettes containing AAV9F or AAV2 / 5 (HEK293t AAV2 / 5 (SEQ ID NO. 63) and HEK293t AAV9F (SEQ ID NO. 64) and SF+ AAV2 / 5 (SEQ ID NO. 65) and SF+ AAV9f (SEQ ID NO. 66)). AAV9F and AAV2 / 5 DNA scaffolds were generated via RCA and subsequently TELn digested using the method described in Example 1. AAV was generated in expresSF+ insect cells by transfecting 1.5e7 cells with 1 μg of plasmid using Cellfectin II transfection reagent (Thermo Fisher Scientific). Transfect SF+ cells with a 1:1 mixture of 1 μg scaffold pVD1943 (AAV2 / 5) and pVD1950 (AAV9F). Transfection was performed according to the method described in Example 1. AAVs were generated in HEK293t cells by transfecting 1e7 adherent HEK293t cells with 1 μg of plasmid using PEI (Polysciences). HEK293t cells were transfected with a 1:1 mixture of 1 μg scaffold pVD2004 (AAV2 / 5) and pVD2006 (AAV9F). 15 μg of total DNA was transfected into the cells, meaning the transfection reaction was supplemented with 14 μg of ultrapure herring sperm vector DNA (Thermo Fisher Scientific). Transfection of both cell lines was performed in triplicate. Harvesting was performed 144 hours after expresSF+ AAV transfection and 72 hours after Hek293t AAV transfection, using the protocol described in Example 1.

[0201] 3.1.2 Sequential purification of AAV2 / 5 and AAV9f particles via affinity batch binding with serum-type specific resins.

[0202] Sequential batch purification of AAV2 / 5 and AAV9f mixtures generated using expresSF+ or HEK293t was performed. This sequential purification was carried out using affinity resins specific to AAV5 (AVB agarose, Topvan) or AAV9 particles (Poros9, Thermo Fisher Scientific). First, crude lysates from both capsid libraries were purified with AVB agarose resin (for AAV2 / 5 capsid binding), followed by flow-through from this purification (containing unbound AAV9 capsid) for purification with Poros9 resin (for AAV9 capsid binding). In short, the purification protocol was as follows: crude AAV cell lysates were added to washed resin (AVB agarose or Poros9) (using 0.2 M HPO4, pH 7.5 buffer). The sample was then incubated at room temperature with gentle mixing for 2 hours. After binding, the resin was washed in 0.2 M HPO4 (pH = 7.5) buffer, and the bound carrier was eluted by adding 0.2 M glycine (pH = 2.5). The pH of the eluted carrier was immediately neutralized by adding 0.5 M Tris-HCl (pH = 8.5). The purified AAV batches were stored at -20°C.

[0203] 3.1.3 Genomic identification using serotype-specific primers via qPCR

[0204] The identity of the genome packaged in sequentially purified particles produced using expresSF+ or HEK293t cells was analyzed using a qPCR specific to AAV serotypes. DNA was isolated from the AAV particles using the method described in Example 1. Primers used for this qPCR are summarized in Table 3 (SEQ ID NO. 55 to 60).

[0205]

[0206] Table 3: Q-PCR primer set for serotype-specific genomic identification

[0207] 3.1.4 Genome identification via next-generation sequencing

[0208] Next-generation sequencing was used to analyze the identity of the genome packaged in sequentially purified particles generated using expresSF+. Viral genomic DNA was isolated from the sequentially purified particles using the Purelink Viral RNA / DNA Mini Kit. Next, the genomic region encoding the capsid was amplified by PCR using the following primers: forward CCTGCTGTTCCGAGTAACCATC and reverse GTCGGCGTGGTTGTACTTGAGG (SEQ ID NO. 61 and 62). The AAV2 / 5 and AAV9F genomes were amplified using the same primer set. PCR samples were sent to Inmena for sequencing at a depth of 10 million reads. Genome identity was analyzed using a barcode counting script obtained from GitHub: https: / / github.com / JonasWeinmann / AAV-barcode-detection-and-normalization.

[0209] 3.1 Results

[0210] Cross-packing occurs during AAV library generation when the genome encoding capsid X is packaged into a mismatched capsid Y. Figure 11 In this example, we investigated the cross-packing rate of our novel library generation method in insect cells and compared it with the standard library generation method in HEK293t. We generated libraries containing a mixture of two serotypes (AAV2 / 5 and AAV9F) using either insect cells or the HEK293t method. After sequential purification with affinity resins that selectively purified AAV2 / 5 or AAV9F capsids, we used serotype-specific qPCR to identify the origin of the genomes packaged within these AAV capsids. By determining the fraction of mismatched genomes (e.g., AAV9F genomes in AAV2 / 5 capsids) in pools sampled after serotype-selective purification, we can establish the cross-packing % of the library generation method. Figure 12 A). This simplified experiment evaluating cross-packaging in our library is based on a previously described method developed by Nonnenmacher et al. in 2015 for evaluating cross-packaging in HEK293t cells.

[0211] Figure 12B shows the percentage of cross-packing in the AAV particle pool obtained from the dual-capsid library after sequential serotype-specific purification, as measured by qPCR. A significantly lower percentage of cross-packing was observed in the two capsid libraries generated in expresSF+ cells compared to the two capsid libraries generated in HEK293t cells. This was true for both the AAV9F genome found in the AAV2 / 5 capsid and the AAV2 / 5 genome found in the AAV9F capsid. NGS analysis of the percentage of cross-packing in the samples generated in expresSF+ cells revealed levels similar to those measured by serotype-specific qPCR (Table 4).

[0212] In summary, compared to industry standards in HEK293t cells, we measured a significantly reduced cross-packing rate in two capsid libraries produced in insect cells using our method. While this method provides only a simplified view of the cross-packing process, similar methods have been used to establish cross-packing in AAV libraries produced in HEK293t cells. Low levels of cross-packing are associated with an increased pace of directed evolution studies aimed at selecting capsids with novel properties. By reducing cross-packing in insect cells using our capsid library production method, we anticipate faster selection of novel capsids in upcoming studies.

[0213]

[0214] Table 4: NGS analysis of cross-packaging in two capsid libraries generated from expresSF+ insect cells. Similar levels of cross-packaging were measured in the insect cell-generated libraries using NGS and qPCR.

Claims

1. A linear nucleic acid molecule comprising a nucleic acid construct comprising: i) a nucleotide sequence encoding an adeno-associated virus (AAV) capsid variant, wherein the nucleotide sequence encodes an mRNA whose translation in an insect cell results in the AAV capsid variant, and wherein the nucleotide sequence is operably linked to a promoter for driving expression in an insect cell; ii) an enhancer element operably linked to the promoter, wherein the enhancer element is dependent on a transcriptional transregulator protein, and wherein introduction of the transcriptional transregulator protein into an insect cell comprising the nucleic acid construct induces transcription from the promoter; iii) at least one AAV inverted terminal repeat (ITR) sequence; iv) optionally, a reporter gene operably linked to a promoter for driving expression in a mammalian cell; and v) optionally, a barcode.

2. The nucleic acid molecule of claim 1, the transcriptional transregulator protein is a baculovirus immediate early protein (IE1) or a spliced variant thereof (IE0), and the transcriptional transregulator protein-dependent enhancer element is a baculovirus homologous region (hr) enhancer element, wherein preferably the baculovirus is Autographa californica multiple capsid nucleotype polyhedrosis virus.

3. The nucleic acid molecule of claim 2, wherein the hr enhancer element comprises at least one copy of the hr 28-mer sequence CTTTACGAGTAGAATTCTACGCGTAAAA and / or at least one copy of a sequence that is identical to the sequence CTTTACGAGTAGAATTCTACGCGTAAAA in at least 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides and that binds to a baculovirus IE1 protein, and wherein the hr enhancer element, when operably linked to an expression cassette comprising a reporter gene operably linked to a polH promoter, a) under non-inducing conditions, the expression cassette with the hr enhancer element produces less reporter transcript than an otherwise identical expression cassette comprising a hr2-0.9 element, or the amount of reporter transcript produced by the cassette with the hr enhancer element is 1 / 1.1, 1 / 1.2, 1 / 1.5, 1 / 2, 1 / 5, or 1 / 10 of the amount of reporter transcript produced by an otherwise identical expression cassette comprising a hr4b element; and b) under inducing conditions, the amount of reporter transcript produced by the expression cassette with the hr enhancer element is at least 50%, 60%, 70%, 80%, 90%, or 100% of the amount of reporter transcript produced by an otherwise identical expression cassette comprising a hr4b or hr2-0.9 element, wherein more preferably the hr enhancer element is selected from the group consisting of hr1, hr2-0.9, hr3, hr4b, and hr5, wherein hr4b and hr5 are preferred, wherein hr4b is most preferred.

4. The nucleic acid molecule according to any one of the preceding claims, wherein the promoter for driving expression in insect cells is a baculovirus promoter, preferably a late or very late baculovirus promoter, more preferably a promoter selected from the group consisting of polH, plO, p6.9 and pSel120 promoters.

5. The nucleic acid molecule according to any one of the preceding claims, wherein the linear nucleic acid molecule is obtainable by digestion with a site-specific endonuclease cleaving at a recognition sequence in the nucleic acid construct.

6. The nucleic acid molecule according to any one of the preceding claims, wherein at least one end of the linear nucleic acid molecule is protected from exonuclease degradation, preferably both ends of the linear nucleic acid molecule are protected from exonuclease degradation.

7. The nucleic acid molecule according to claim 5 or 6, wherein the endonuclease is a protelomerase, preferably a bacteriophage N15 TelN protelomerase, and wherein at least one end of the linear nucleic acid molecule is covalently closed, or wherein preferably both ends of the linear nucleic acid molecule are covalently closed.

8. The nucleic acid molecule according to any one of claims 5 to 7, wherein the position of elements i) to v) and the recognition sequence in the construct is such that expression of the AAV Rep protein in an insect cell comprising the nucleic acid construct results in replication and packaging of the DNA fragment comprising elements i) to v) into an AAV capsid.

9. The nucleic acid molecule according to any one of the preceding claims, wherein the nucleic acid construct comprises in the order of 5’ to 3’: a) a first AAV ITR sequence; b) the enhancer element; c) an expression cassette comprising a nucleotide sequence encoding the AAV capsid variant operably linked to the promoter for driving expression in the insect cell; and d) a second AAV ITR, wherein the recognition sequence is present at least one of i) upstream of the first AAV ITR and ii) downstream of the second AAV ITR, wherein optionally a reporter gene operably linked to the promoter for driving expression in a mammalian cell is present between a) and b), b) and c), or c) and d), and wherein optionally a barcode is present between a) and b), b) and c), or c) and d), And wherein, preferably the recognition sequence is a unique recognition sequence.

10. The nucleic acid molecule according to any one of the preceding claims, wherein at least one of: a) the promoter for driving expression in mammalian cells is a cell type and / or tissue specific promoter, preferably a promoter selected from the group consisting of human synapsin promoter (hSynl), transthyretin promoter (TTR), cytokeratin 18, cytokeratin 19, unc-45 myosin chaperone B (unc45b) promoter, cardiac troponin T (cTnT) promoter, glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter and methyl-CpG-binding protein 2 (Mecp2) promoter; b) the reporter gene encodes a colorimetric, fluorescent or bioluminescent reporter protein, preferably a reporter protein selected from the group consisting of secreted alkaline phosphatase (SEAP), beta-galactosidase EGFP, mCherry, mCloverS, mRubyS, mApple, iRFP, tdTomato, mVenus, YFP, RFP, firefly luciferase, Renilla luciferase and NanoLuc luciferase; and c) the barcode is a nucleotide sequence of 4-18 nucleotides in length.

11. A library comprising a plurality of nucleic acid molecules comprising a construct as defined in any one of claims 1-10, wherein, In each member of the library, the nucleotide sequence encoding the AAV capsid variant differs from the nucleotide sequence encoding an AAV capsid variant in other members of the library by at least one nucleotide, and wherein preferably, in each member of the library, the nucleotide sequence encoding the AAV capsid variant encodes a capsid variant that differs from the AAV capsid variant encoded by other members of the library by at least one amino acid.

12. An insect cell comprising a nucleic acid molecule or a library as defined in claim 11, the nucleic acid molecule comprising a construct as defined in any one of claims 1-10.

13. The insect cell according to claim 12, further comprising a baculovirus vector comprising at least one expression cassette for expressing an AAV Rep protein in the insect cell.

14. A library comprising a plurality of AAV capsid variants, wherein the members of the library comprise nucleic acids replicated and packaged from members of a library of nucleic acid constructs as defined in claim 11.

15. A method for preparing a library of AAV capsid variants, the method comprising the steps of: a) providing a library comprising a plurality of nucleic acid constructs as defined in any one of claims 1-10, wherein the amino acid sequence of the AAV capsid variant of each member of the library as encoded in the construct of each member of the library differs from the amino acid sequence of an AAV capsid variant encoded in the construct of other members of the library by at least one amino acid; b) amplifying the library of nucleic acid constructs obtained in a), preferably by rolling circle amplification; c) digesting the amplified library of nucleic acid constructs obtained in b) by an endonuclease to generate a library comprising linearized amplified nucleic acid constructs of unit length; d) transfecting the library comprising linearized amplified nucleic acid constructs obtained in c) into insect cells; e) infecting the insect cells with a baculovirus vector comprising at least one expression cassette for expressing an AAV Rep protein in these insect cells, and cultivating the cells; and f) recovering the library of AAV capsid variants produced by the insect cells in e).

16. The method of claim 15, wherein the library in a) is provided by: i) providing a nucleic acid construct as defined in any one of claims 1-10; and ii) replacing the fragment comprising at least part of the nucleotide sequence encoding the AAV capsid variant in the construct with a library of fragments, wherein the amino acid sequence of the AAV capsid variant of each member of the library as encoded in the fragment of each member of the library differs from the amino acid sequence of the AAV capsid variant encoded in the construct of other members of the library by at least one amino acid.

17. The method of claim 16, wherein: - in step ii) of claim 16, the replacement is performed by Gibson assembly; - in step b) of claim 15, the rolling circle amplification is performed by using a Φ29 DNA polymerase, preferably in combination with random primers; and / or, - in c) of claim 15, the ends of the linearized amplified library of unit length nucleic acid constructs are provided with protection from exonuclease degradation.

18. The method of any one of claims 15-17, wherein: - in step c) of claim 15, the endonuclease is bacteriophage N15 TelN protelomerase, which provides the linearized amplified library of unit length nucleic acid constructs with covalently closed ends.

19. A method for identifying an AAV capsid variant having a desired characteristic, the method comprising: a) providing a library of AAV capsid variants according to claim 14 or as obtained in the method according to any one of claims 15-18; b) contacting the library with a culture of cells, organoids or tissues, or administering the library to a non-human animal; c) allowing the AAV capsid variants in the library to transduce the cells, the organoids, the tissues or cells in the animal; and d) identifying at least one AAV capsid variant that has transduced at least one desired cell type in the cells, the organoids, the tissues or the animal in b) as an AAV capsid variant having the desired characteristic, and optionally recovering the AAV capsid variant having the desired characteristic from the desired cell.

20. The method of claim 19, wherein step d) comprises detecting transduction of at least the desired cell by detecting expression of the reporter gene in the desired cell.

21. The method of claim 19 or 20, wherein the variant having the desired characteristic is identified by sequencing at least one of i) the barcode and ii) the region of the DNA construct encoding the at least one amino acid difference.

Images