Nano antibody for resisting feline panleucopenia virus VP2 protein and application of nano antibody

Abstract

The invention discloses a nano antibody for resisting feline panleucopenia virus VP2 protein and application of the nano antibody, and belongs to the technical field of antiviral drugs. The nucleotide sequence of the nano antibody is SEQ ID NO: 1, the amino acid sequence of the corresponding code is SEQ ID NO: 2, the yield of the nano antibody reaches 2.05 mg / mL, and the purity of the nano antibody reaches 90%. The nano antibody can react with feline panleucopenia virus and recombinant VP2 protein thereof, can inhibit virus replication on FK81 cells, and can be applied to preparation of drugs for preventing and / or treating feline panleucopenia. By combining the advantages of the nano-antibody and an efficient yeast expression system, the efficient and specific nano-antibody for resisting the feline panleucopenia virus VP2 protein, which can be produced in a large scale, is successfully developed, and the nano-antibody has important scientific research value and clinical application prospect; particularly, a new solution is provided for prevention and treatment of feline panleucopenia.

Description

Technical Field

[0001] This invention belongs to the field of antiviral drug technology, specifically relating to a nanobody against feline panleukopenia virus VP2 protein and its application. Background Technology

[0002] Feline panleukopenia, also known as feline distemper, is a serious infectious disease caused by feline parvovirus (FPV), primarily transmitted through contact with the feces, vomit, and saliva of infected cats. Symptoms mainly include high fever, vomiting, diarrhea, bloody stools, and dehydration, with a mortality rate as high as 90% in kittens. After infection, the symptoms in cats typically progress through three stages: the incubation period (3-7 days), the middle stage (10-14 days), and the late stage. Early symptoms may be overlooked, but the condition deteriorates rapidly without timely treatment. Feline panleukopenia has a wide range of transmission routes, and the virus can survive in the environment for months, making prevention crucial. Currently, feline panleukopenia control primarily relies on vaccination, but there are no approved drugs for its treatment.

[0003] Feline parvovirus (FPV) has a non-enveloped icosahedral structure and a single-stranded linear DNA genome (approximately 5 kb). It primarily encodes two structural proteins and two non-structural proteins. The VP2 protein, as the major capsid protein, has a molecular weight of approximately 83-85 kDa and accounts for over 90% of the total capsid protein. It is the main antigenic epitope region of FPV, determining the virus's antigenicity and host tropism. Therefore, developing antiviral drugs targeting the VP2 protein is of significant practical importance for the precise control of feline panleukopenia.

[0004] Nanobodies are antibody fragments derived from the variable domain (VHH) of heavy-chain antibodies in camel-like animals. They have a molecular weight of 12-15 kDa and possess a minimal functional antigen-binding active region. Nanobodies, with their high specificity, strong affinity, and good stability, show promising applications in blocking and inhibiting viruses. Currently, research reports on nanobodies against feline panleukopenia virus are limited.

[0005] Pichia pastoris expression system is the simplest and most reliable exogenous gene expression system, and it has replaced traditional E. coli and Saccharomyces cerevisiae expression systems in the industrial production of many exogenous proteins. Numerous studies have shown that the preparation of recombinant nanobodies using the Pichia pastoris expression system has advantages such as high expression levels, good safety, soluble expression, and suitability for large-scale production. The Pichia pastoris expression system is now widely used in the industrial production of various recombinant proteins. However, no research has been reported on the preparation of anti-feline panleukopenia virus VP2 protein nanobodies using the Pichia pastoris expression system. Summary of the Invention

[0006] To fill the gap in the field of nanobodies against feline panleukopenia virus VP2 protein, this invention provides a nanobody against feline panleukopenia virus VP2 protein and its application.

[0007] The technical solution adopted by this invention to solve the technical problem is as follows:

[0008] In a first aspect, the present invention provides a nanobody against the VP2 protein of feline panleukopenia virus. The nucleotide sequence of the nanobody is SEQ ID NO:1, and the corresponding encoded amino acid sequence is SEQ ID NO:2.

[0009] Secondly, the present invention provides a method for preparing a nanobody against feline panleukopenia virus VP2 protein. The preparation method includes the following steps:

[0010] First, a VHH phage library for immunizing alpacas was constructed. Second, recombinant feline panleukopenia virus (FPV) VP2 protein was prepared. The purified FPV VP2 protein was coated onto an ELISA plate. Antibody library solid-phase screening technology was used to screen for VHH sequences that could bind to the recombinant FPV VP2 protein, which is the nanobody sequence VP2-Nb13 against FPV VP2 protein.

[0011] Thirdly, the present invention provides the use of a nanobody against the VP2 protein of feline panleukopenia virus in the preparation of drugs for the prevention and / or treatment of feline panleukopenia virus.

[0012] Fourthly, the present invention provides a recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 for expressing a nanobody against the feline panleukopenia virus VP2 protein.

[0013] Fifthly, the present invention provides a method for constructing the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13. The construction method includes the following steps:

[0014] Based on the codon preferences of Pichia pastoris, codon optimization was performed without altering the amino acid sequence. An EcoRI restriction site was introduced at the 5' end of the nanobody sequence, and a 6 × His tag, a Not I restriction site, and a stop codon were introduced at the 3' end of the nanobody sequence. The constructed gene sequence was then artificially synthesized, and the synthesized gene was ligated into the Pichia pastoris expression vector pPIC9K using a homologous recombination kit to obtain the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13.

[0015] In a sixth aspect, the present invention provides a recombinant yeast strain prepared using the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13.

[0016] In a preferred embodiment, the nucleotide sequence of the recombinant yeast strain is SEQ ID NO:3.

[0017] In a seventh aspect, the present invention provides a method for preparing a recombinant yeast engineered strain. The preparation method includes the following steps:

[0018] The recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 was linearized using the restriction endonuclease Sal I, added to Pichia pastoris GS115 competent cells, mixed well, and transferred to a pre-chilled electroporation cuvette. After being placed on ice, the cuvette was transferred to an electroporator for electroporation. After electroporation, pre-chilled sorbitol was added, and the mixture was pipetted and transferred to centrifuge tubes. The cells were incubated statically at 30°C for 1.5-2.5 h, centrifuged at 3500-4500 r / min for 3-5 min at room temperature, and the cells were collected and resuspended in YPG medium. The cells were then spread onto YPG solid medium containing bleomycin and incubated at 36-38°C for 2-3 days. Single colonies were picked for PCR identification. If the identification was correct, the recombinant yeast engineered strain for expressing recombinant nanobodies was obtained.

[0019] Eighthly, the present invention provides an anti-feline panleukopenia virus drug. The drug uses a nanobody of the anti-feline panleukopenia virus VP2 protein provided in the first aspect as its active ingredient.

[0020] The beneficial effects of this invention are:

[0021] I. Technological advancement:

[0022] 1. Target Specific: This invention targets the major capsid protein VP2 of feline parvovirus (FPV), which is the major antigenic epitope region of the virus, determining the antigenicity and host tropism of the virus, and has high specificity.

[0023] 2. Using nanobody technology: The nanobodies prepared in this invention have small molecular weight (12-15 kDa), simple structure, and are easy to express and purify; they also have high affinity, high stability and good tissue penetration ability; the nanobodies prepared in this invention can inhibit viral replication in FK81 cells and have good potential in blocking and inhibiting viruses.

[0024] II. Advantages of the production process:

[0025] 1. High-efficiency expression system: The present invention uses the Pichia pastoris expression system, which has a high expression level (2.05 mg / mL), soluble expression, and is suitable for large-scale industrial production; compared with the traditional Escherichia coli system, it has better safety and is more suitable for producing antibody proteins for treatment.

[0026] 2. High purity and good activity: The purified recombinant nanobody has a purity of 90%, significant activity, IC50 of 36.6±0.14μg / mL, and good ability to neutralize viruses.

[0027] III. Wide range of applications:

[0028] 1. Can be used for prevention and treatment: The nanobody prepared by this invention can be directly used to prepare anti-feline panleukopenia drugs, filling the gap in the current field of feline panleukopenia treatment where there is no specific drug.

[0029] 2. Can be developed into biological agents: The nanobodies prepared by this invention can be used to prepare neutralizing antibody drugs, diagnostic reagents or vaccine adjuvants, and have multiple application potentials.

[0030] IV. The preparation method is simple and efficient:

[0031] 1. Mature screening strategy: This invention uses the immune alpaca VHH phage library screening technology to successfully obtain high-affinity nanobody sequences; combined with prokaryotic and eukaryotic expression systems, it achieves full-process coverage from screening to large-scale production.

[0032] 2. Controllable process and low cost: The expression and purification process of this invention is simple, suitable for industrial-scale production, and has good economic benefits.

[0033] V. Innovation and Filling Gaps:

[0034] First report: The first expression of anti-FPV-VP2 nanobodies using the Pichia pastoris system provides a new pathway for the industrial production of this type of antibody; the first acquisition of anti-FPV nanobodies with significant neutralizing activity provides a new candidate drug for the treatment of feline panleukopenia.

[0035] VI. Sufficient experimental data support:

[0036] This invention verifies the specificity, purity, activity, and ability to inhibit viral replication of the antibody using multiple methods such as ELISA, Western blot, SDS-PAGE, and neutralization assays, and the data are reliable.

[0037] This invention combines the advantages of nanobodies with a highly efficient yeast expression system, and successfully developed a highly efficient, specific, and scalable anti-feline panleukopenia virus nanobody, which has significant scientific research value and clinical application prospects, especially providing a new solution for the prevention and treatment of feline panleukopenia. Attached Figure Description

[0038] Figure 1 This is the insertion rate identification result of the VHH phage library of immune alpacas constructed in Example 1.

[0039] Figure 2 The results are ELISA detection results of solid-phase screening of the VHH phage library of immunized alpacas in Example 2.

[0040] Figure 3 This is a map of the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 constructed in Example 3.

[0041] Figure 4 This is the SDS-PAGE identification result of the recombinant nanobody VP2-Nb13 in Example 4.

[0042] Figure 5 This is the Western blot identification result of the recombinant nanobody VP2-Nb13 in Example 4. Detailed Implementation

[0043] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0044] Example 1: Construction of a VHH phage library immunized with alpacas

[0045] (1) The feline triple vaccine (purchased from Zoetis (Suzhou) Animal Health Products Co., Ltd., the antigen of which contains inactivated feline panleukopenia virus, feline herpesvirus and feline calicivirus) was injected subcutaneously into the neck of an adult healthy alpaca (purchased from Jiangsu Dengyuanhe Biotechnology Co., Ltd.), with an injection volume of 2 mL / alpaca. Booster immunizations were given on days 14, 28, 42, 56 and 70 after immunization, and serum antibody titers were measured.

[0046] When the ELISA titer of serum antibodies reached 1:30000, peripheral blood of alpacas was collected. Lymphocytes were separated using camel peripheral blood lymphocyte separation fluid. RNA was extracted using an RNA extraction kit and a reverse transcription kit, and then reverse transcribed into cDNA. Finally, the nanobody (VHH) sequence of alpaca antibody was amplified using a two-round nested PCR method.

[0047] The primer sequences for the first round of nested PCR amplification are P1-F and P1-R:

[0048] P1-F: GTCCTGGCTGCTCTTCTACAAGG;

[0049] P1-R:GGTACGTGCTGTTGAACTGTTCC.

[0050] The primer sequences for the second round of nested PCR amplification are P2-F and P2-R:

[0051] P2-F: GAGCTC ATGGATGTGCAGCTGGTGGA, the underlined part is the Sac I restriction site;

[0052] P2-R: ACTAGT TGAGGAGACGGTGACCT, the underlined part is the Spe I restriction site.

[0053] The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0054] (2) The amplified alpaca antibody nanobody sequence and pComb3Xss plasmid were digested with restriction endonucleases Sac I and Spe I, ligated with T4 ligase, and transformed into E. coli TG1 competent cells. Twenty-four single colonies were picked the following day and subjected to bacterial culture PCR identification. The results of the bacterial culture PCR identification are as follows: Figure 1 As shown, 23 single colonies were positive, and sequencing confirmed that all of these sequences were distinct, indicating a 95.8% (23 / 24) positive rate (and rich diversity, 23 / 23) for the VHH phage library immunized with alpacas, demonstrating successful construction. Based on the amounts of RNA extraction, reverse transcription, ligation system, plate counting, and dilution ratios, the estimated library size of the VHH phage library immunized with alpacas constructed in this invention is 6 × 10⁻⁶. 6 indivual.

[0055] Example 2: Screening of nanobodies against feline panleukopenia virus VP2 protein

[0056] (1) Based on the VP2 gene sequence information in the feline panleukopenia virus VP2 protein (NCBI database accession number OP796709.1), a codon-optimized VP2 gene sequence of *E. coli* was artificially synthesized (synthesized by General Biosystems (Anhui) Co., Ltd.). The artificially synthesized VP2 gene sequence and the prokaryotic expression plasmid pET28a(+) (purchased from Beijing Solarbio Science & Technology Co., Ltd.) were digested with Nhe I and EcoRI (purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.). After identification by agarose gel electrophoresis, the fragments were recovered using a gel recovery kit (purchased from Thermo Fisher Scientific (China) Co., Ltd.). The fragments were incubated at 16°C for 1 h with T4 ligase (purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.) and transformed into *E. coli* Rosetta (DE3) competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.) to obtain a strain capable of expressing feline panleukopenia virus VP2 protein. The strain was cultured to OD 600 nm When the value was approximately 0.5, IPTG (purchased from Baori Biotechnology (Beijing) Co., Ltd.) was added to a final concentration of 1 mmol / L, and expression was induced at 30℃ for 6 h. The bacterial cells were collected and purified using a Ni-NTA affinity chromatography column (purchased from Tiandi Renhe Co., Ltd.). The purified recombinant feline panleukopenia virus VP2 protein was collected, and its concentration was determined to be 1.0 mg / mL using a BCA protein quantification kit (purchased from Thermo Fisher Scientific Co., Ltd.). The protein was stored at -70℃ for later use.

[0057] (2) The purified recombinant feline panleukopenia virus VP2 protein was coated with an enzyme-labeled plate at 3 μg / well. The VHH sequence that can bind to the recombinant feline panleukopenia virus VP2 protein was screened using antibody library solid-phase screening technology. This VHH sequence is the nanobody sequence against feline panleukopenia virus VP2 protein.

[0058] The specific operating steps are as follows: The VHH phage library of immunized alpacas constructed in Example 1 was plated on 2×YT medium (100 μg / mL Amp, 1.5% agarose). The next day, single colonies were picked and transferred to 96-well plates, each well containing 400 μL of 2×YT medium (0.4% glucose, 100 μg / mL Amp). After incubation at 37°C for 3 h, the culture was transferred to 96-well deep-well plates and incubated at 37°C with shaking for 6 h until D... 600nmAt an infection rate of 0.5, helper phage M13KO7 (purchased from Thermo Fisher Scientific) was inoculated at an MOI of 10. After incubation at 37°C for 30 min with shaking for 30 min, the supernatant was discarded by centrifugation at 4000 rpm. The pellet was resuspended in 600 μL of 2×YT medium (100 μg / mL Amp, 75 μg / mL Kan, 100 mmol / L IPTG) and incubated at 37°C with shaking for 24 h. After centrifugation at 4000 rpm, 200 μL of the supernatant was added to an ELISA plate (3 μg / well) coated with VP2 protein antigen for detection. OD was collected. 450 nm Calculate the P / N value for each well (test well D). 450 nm / Negative control well D 450 nm A P / N value > 2.1 is considered positive. Phage-ELISA test results are as follows: Figure 2 As shown, 13 VHH sequences were screened, among which the VHH sequence numbered VP2-Nb13 had the highest P / N value (15.8), its nucleotide sequence is SEQ ID NO:1, and the corresponding encoded amino acid sequence is SEQ ID NO:2.

[0059] Example 3 Construction of recombinant yeast engineered strains

[0060] (1) Construction of recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13;

[0061] Based on the codon preferences of Pichia pastoris, codon optimization was performed without altering the amino acid sequence. An EcoRI restriction site was introduced at the 5' end of the nanobody sequence, and a 6 × His tag, a Not I restriction site, and a stop codon (TGA) were introduced at the 3' end of the nanobody sequence. The constructed gene sequence was sent to GenScript Biotech Ltd. for synthesis. Using a homologous recombination kit (purchased from TransGen Biotech Ltd.), the synthesized gene was ligated into the Pichia pastoris expression vector pPIC9K to obtain the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13.

[0062] The map of the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 is as follows: Figure 3 As shown.

[0063] (2) Construction of recombinant yeast engineered strains;

[0064] The recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 was linearized using the restriction endonuclease Sal I (purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.). This plasmid was then added to Pichia pastoris GS115 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), gently mixed, and transferred to a pre-chilled electroporation cuvette. After incubation on ice for 5 minutes, the cells were transferred to an electroporator (purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd.). The electroporation parameters were set as follows: voltage 1.8 kV, resistance 250 Ω, and capacitance 15 µF. Immediately after electroporation, 1 mL of pre-chilled 1 M sorbitol (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) was added. After two pipette spins, the cells were transferred to a 15 mL centrifuge tube and incubated statically at 30°C for 2 h. The cells were then centrifuged at 4000 rpm for 4 minutes at room temperature. The cells were collected and resuspended in 100 µL of YPG medium (purchased from Beijing Solarbio Science & Technology Co., Ltd.), and spread onto a plate containing 100 μL of YPG. The culture was carried out on YPG solid medium containing µg / mL bleomycin (Zeocin, purchased from Shanghai Beyotime Biotechnology Co., Ltd.) at 37°C for 3 days. Single colonies were picked for PCR identification, with a length of 366 bp. After successful identification, a recombinant yeast strain for expressing recombinant nanobodies was obtained, and its nucleotide sequence is SEQ ID NO:3.

[0065] Example 4 Preparation of recombinant nanobody VP2-Nb13

[0066] The recombinant yeast strain obtained in Example 3 was first inoculated into 50 mL of YPG culture medium for rejuvenation. The next day, 5 mL of the culture was inoculated into a 1 L shake flask (containing 400 mL of YPG culture medium) and cultured overnight at 28°C and 200 r / min. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium (purchased from Beijing Solarbio Science & Technology Co., Ltd.). The cells were induced at 28°C and 200 r / min for 100 hours (with methanol added every 24 hours to a final concentration of 0.6%). The supernatant was collected and purified according to the affinity chromatography column (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) instructions to obtain the recombinant protein. The molecular weight and purity of the recombinant protein were analyzed by SDS-PAGE and Western blot. The identification results are as follows: Figure 4 and Figure 5 As shown, the relative molecular mass of the obtained recombinant protein is 13.3 kDa, which is consistent with the expected value, indicating that the recombinant protein is the recombinant nanobody VP2-Nb13, with a concentration of 2.05 mg / mL and a purity of 90%.

[0067] Example 5: Detection of the neutralizing activity of recombinant nanobody VP2-Nb13

[0068] Take 50 μL of recombinant nanobodies of different concentrations (50 μg / mL, 25 μg / mL, 12.5 μg / mL, 5 μg / mL, 0.5 μg / mL) and mix them with an equal volume of 2000 EID. 50 The FPV strain was co-incubated at 37°C for 2 h, then inoculated into FK81 cells, with 5 replicates. A positive control group was included (inoculated with 50 μL of 2000 EID). 50 Cell status was observed every 24 h for both the virus and a negative control group (100 μL PBS). The supernatant was harvested on day 5 post-inoculation, and the viral HA titer was measured. The lowest concentration of recombinant nanobody with no HA titer was used as the neutralization endpoint. The neutralization percentage was calculated as [1 - (average HA titer of the positive group - average HA titer of the experimental group) / (average HA titer of the positive group - average HA titer of the negative group)] × 100%. Data processing and analysis were performed using GraphPad Prism (Ver. 10.1.2). Results showed that the recombinant nanobody at concentrations of 50 μg / mL, 25 μg / mL, 12.5 μg / mL, 5 μg / mL, and 0.5 μg / mL inhibited viral replication, with an IC50 of 36.6 ± 0.14 μg / mL. This recombinant nanobody VP2-Nb13 exhibits significant biological activity and can be used to prepare drugs against feline panleukopenia virus.

[0069] The recombinant nanobody VP2-Nb13 prepared in this invention has good neutralizing activity and can be used to prepare nanobody formulations for the prevention and / or treatment of feline panleukopenia.

[0070] The preparation method of the present invention is simple to operate and low in cost, and can ensure the yield, activity, safety and production applicability of recombinant nanobodies, making it suitable for large-scale production.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. However, these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nanobody against feline panleukopenia virus VP2 protein, characterized in that, Its nucleotide sequence is SEQ ID NO:1, and the corresponding encoded amino acid sequence is SEQ ID NO:

2.

2. The method for preparing a nanobody against feline panleukopenia virus VP2 protein as described in claim 1, characterized in that, Includes the following steps: First, a VHH phage library for immunizing alpacas was constructed. Second, recombinant feline panleukopenia virus (FPV) VP2 protein was prepared. The purified FPV VP2 protein was coated onto an ELISA plate. Antibody library solid-phase screening technology was used to screen for VHH sequences that could bind to the recombinant FPV VP2 protein, which is the nanobody sequence VP2-Nb13 against FPV VP2 protein.

3. The use of the nanobody against feline panleukopenia virus VP2 protein as described in claim 1 in the preparation of drugs for the prevention and / or treatment of feline panleukopenia.

4. The recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 required for expressing the nanobody against the feline panleukopenia virus VP2 protein as described in claim 1.

5. The method for constructing the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 as described in claim 4, characterized in that, Includes the following steps: Based on the codon preferences of Pichia pastoris, codon optimization was performed without altering the amino acid sequence. An EcoRI restriction site was introduced at the 5' end of the nanobody sequence, and a 6 × His tag, a Not I restriction site, and a stop codon were introduced at the 3' end of the nanobody sequence. The constructed gene sequence was then artificially synthesized, and the synthesized gene was ligated into the Pichia pastoris expression vector pPIC9K using a homologous recombination kit to obtain the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13.

6. A recombinant yeast strain prepared using the recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 as described in claim 4.

7. The recombinant yeast strain according to claim 6, characterized in that, Its nucleotide sequence is SEQ ID NO:

3.

8. The method for preparing the recombinant yeast engineered strain as described in claim 6, characterized in that, Includes the following steps: The recombinant eukaryotic expression plasmid pPIC9K-VP2-Nb13 was linearized using the restriction endonuclease Sal I, added to Pichia pastoris GS115 competent cells, mixed well, and transferred to a pre-chilled electroporation cuvette. After being placed on ice, the cuvette was transferred to an electroporator for electroporation. After electroporation, pre-chilled sorbitol was added, and the mixture was pipetted and transferred to centrifuge tubes. The cells were incubated statically at 30°C for 1.5-2.5 h, centrifuged at 3500-4500 r / min for 3-5 min at room temperature, and the cells were collected and resuspended in YPG medium. The cells were then spread onto YPG solid medium containing bleomycin and incubated at 36-38°C for 2-3 days. Single colonies were picked for PCR identification. If the identification was correct, the recombinant yeast engineered strain for expressing recombinant nanobodies was obtained.

9. A drug for treating feline panleukopenia virus, characterized in that, The drug uses the nanobody described in claim 1 as its active ingredient.

Images