FISH (fluorescence in situ hybridization) probe specifically combined with radix bupleuri gene and application of FISH probe

By designing FISH probes that specifically bind to the Bupleurum gene, the problems of specificity, stability, and time-consuming identification of Bupleurum species have been solved, enabling rapid and accurate species identification and medicinal material identification, which has important application prospects.

CN121249965APending Publication Date: 2026-01-02SOUTHWEAT UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511817715.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-04
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing technologies for identifying species of the genus Bupleurum suffer from low specificity, stability, and accuracy, as well as being time-consuming, making it difficult to accurately identify plants of the genus Bupleurum when morphological characteristics are difficult to distinguish.

Method used

A FISH probe that specifically binds to the Bupleurum gene was designed. The fluorescently labeled probe directly hybridizes with the target repetitive sequence in cell chromosomes or tissue sections, binding to a specific 59bp base sequence, to achieve species identification with high specificity and sensitivity, simplifying the experimental procedure and shortening the detection time.

Benefits of technology

It enables rapid and accurate species identification of Bupleurum species, improving identification efficiency and accuracy. It can obtain clear detection signals in complex or low-quality samples, and is suitable for the identification of genuine and counterfeit medicinal materials and resource protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249965A_ABST
    Figure CN121249965A_ABST
Patent Text Reader

Abstract

The invention provides a FISH (fluorescence in situ hybridization) probe specifically bound with a radix bupleuri gene and application of the FISH probe. The nucleotide sequence of the FISH probe is shown as SEQ ID NO.1, and the 5'end of the nucleotide sequence is marked with a fluorophore. The FISH probe disclosed by the invention has the advantages of high specificity and high sensitivity, also has relatively high stability and repeatability, and can be used for quickly distinguishing and identifying bupleurum plants in a plurality of different plant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically to a FISH probe that specifically binds to the Bupleurum gene and its applications. Background Technology

[0002] Bupleurum genus ( Bupleuri Plants occupy an important position in plant taxonomy and medicinal plant research, and their accurate species identification plays a crucial role in the quality control and resource protection of medicinal materials. However, plants of the genus Bupleurum are often highly similar in morphology to some plants of the Apiaceae family and dicotyledonous plants, which can easily lead to confusion during field collection or medicinal material identification. Special attention needs to be paid to distinguishing them, and relying solely on traditional morphological methods for identification has significant limitations.

[0003] To address this challenge, modern research is shifting towards multidisciplinary approaches, such as combining morphological observation with molecular marker analysis (e.g., PCR amplification, DNA barcoding). While these methods provide species-level reference information, their specificity and stability are not always satisfactory. For example, morphological methods often lead to confusion as plants in the *Bupleurum* genus share highly similar external characteristics with certain other plants, such as wheat, Dioscoreaceae, and Apiaceae. Furthermore, marker-based PCR detection can be inaccurate due to non-specific amplification when dealing with complex or degraded samples. Additionally, DNA barcoding often requires high-quality DNA samples and numerous experimental steps, is time-consuming, and struggles to achieve consistent resolution across all species. Therefore, despite significant advancements in *Bupleurum* species identification, the classification and identification of the *Bupleurum* genus still requires substantial expertise and experience. Moreover, the application of these techniques is limited in situations demanding higher precision and sensitivity. Identification of *Bupleurum* germplasm resources remains a challenging area in plant taxonomy. Summary of the Invention

[0004] Fluorescence in situ hybridization (FISH) is a new molecular detection tool that can not only directly show the characteristics of the genome, but also locate the specific distribution of these repetitive sequences on the chromosome by hybridizing the probe with fluorescent markers to the target repetitive sequences in the cell chromosome or tissue section. This method not only improves the accuracy of species identification, but also overcomes the limitations of traditional methods due to morphological similarity or amplification bias. More importantly, FISH has high specificity and sensitivity, and stable detection signals can be obtained even in complex or low-quality samples. Compared with morphological and molecular marker methods, FISH performs better in efficiency and reliability, but the prerequisite is to obtain a FISH probe sequence with high specificity. In view of the above, in view of the problems of low specificity, stability, accuracy and long time-consuming of the existing species identification technology of Bupleurum, the application explores the application of FISH technology in the species identification and classification research of Bupleurum, and further provides a FISH probe specifically combined with Bupleurum gene and application thereof.

[0005] To achieve the above technical purposes, the technical scheme adopted by the present application is as follows: In a first aspect, the present application provides a FISH probe specifically combined with Bupleurum gene, wherein the nucleotide sequence of the FISH probe is shown as SEQ ID NO. 1, and the 5' end of the nucleotide sequence is labeled with a fluorescent group.

[0006] Preferably, the fluorescent group is selected from TAMRA, Cy3, Alexa Fluor 488, Alexa Fluor 555, ATTO550, ROX, Texas Red, or Alexa Fluor 594.

[0007] In a second aspect, the present application provides the use of the FISH probe of the first aspect in the preparation of a product for detecting Bupleurum gene.

[0008] In a third aspect, the present application provides the use of the FISH probe of the first aspect in the preparation of a product for distinguishing different Bupleurum germplasm resources.

[0009] In a fourth aspect, the present application provides the use of the FISH probe of the first aspect in the preparation of a product for distinguishing Bupleurum and other plant varieties.

[0010] In a fifth aspect, the present application provides a kit comprising: the FISH probe specifically combined with Bupleurum gene of the first aspect.

[0011] Preferably, the kit further comprises: a probe diluent and a reagent for hybridizing the probe with Bupleurum chromosome; preferably, the diluent is 2x ssc buffer or ultrapure water.

[0012] Optionally, the reagent for hybridizing the probe with the Bupleurum chromosome is 2xSSC buffer, and the volume ratio of the reagent to the probe solution is 3-5:1.

[0013] In a sixth aspect, the present application provides the FISH probe of the first aspect or the kit of the fifth aspect for use in detecting the Bupleurum gene.

[0014] In a seventh aspect, the present application provides the FISH probe of the first aspect or the kit of the fifth aspect for use in distinguishing different Bupleurum germplasm resources.

[0015] In an eighth aspect, the present application provides the FISH probe of the first aspect or the kit of the fifth aspect for use in distinguishing Bupleurum and other plant varieties.

[0016] Compared with the prior art, the present application has the following excellent effects: Firstly, the FISH probe designed in the present application has the advantages of high specificity and strong sensitivity. The probe is composed of a specific 59bp base sequence, can accurately recognize the repetitive sequences in the Bupleurum plant genome at the cellular level, and is highly specific to these repetitive sequences, avoiding non-specific hybridization with the genomes of non-target species. Especially in the case where morphological characteristics are difficult to distinguish, the present application shows unique advantages in quickly distinguishing and identifying Bupleurum plants among many different plant varieties. In addition, by analyzing the distribution mode of the fluorescent signal and the specific location of the conserved sequence on the chromosomes of different Bupleurum varieties, different Bupleurum varieties can be further distinguished.

[0017] Secondly, the FISH probe of the present application also has strong stability and repeatability, and can obtain clear and reliable detection signals in complex or degraded samples, thereby greatly improving the identification efficiency and accuracy. In addition, the FISH probe can significantly enhance the signal intensity of the detection, so that it can clearly identify the presence and distribution of the target species even in the case of low abundance of genomic repetitive sequences or poor sample quality, thereby realizing efficient and accurate detection of Bupleurum plants.

[0018] Thirdly, the FISH probe of the present application also has the characteristics of short identification time (about 2-5h from preparation to obtaining results) and strong cell permeability. First, in terms of detection efficiency, the probe can quickly enter the cell and bind to the target repetitive sequence, significantly shortening the time required for identification. Second, the probe considers the optimization of molecular structure and molecular weight in the design process, so that it has stronger cell permeability, reduces the potential damage to cells, and improves the safety of the experiment. Therefore, the probe of the present application is not only suitable for laboratory research, but also has application potential in plant identification and molecular marker detection.

[0019] In summary, the application can provide a powerful tool for rapid identification of Bupleurum plants, quality control of medicinal materials, resource protection and genetic diversity research, and has important application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0020] The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiments of the application and together with the description serve to explain the application. In the drawings: Figure 1 Figure 2 is a diagram showing the expression intensity of the two groups of probes in Example 1 in B. junciforme, wherein A is the first group of probes (rnd-0 TOP) and B is the second group of probes (rnd-12 TOP).

[0021] Figure 2 Figure 5 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in B. chinense No. 1 in Example 3.

[0022] Figure 3 Figure 6 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in B. junciforme in Example 3.

[0023] Figure 4 Figure 7 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in B. chinense No. 2 in Example 3.

[0024] Figure 5 Figure 8 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in B. scorzoneraefolium in Example 3.

[0025] Figure 6 Figure 9 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in monocotyledonous plant wheat HIF3A in Example 3.

[0026] Figure 7 Figure 10 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in dicotyledonous plant Dioscoreaceae in Example 3.

[0027] Figure 8 Figure 11 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in dicotyledonous plant Umbelliferae in Example 3.

[0028] Figure 9 Figure 12 is a diagram showing the expression intensity of the FISH probe and the plant universal 5s rRNA probe in dicotyledonous plant Umbelliferae in Example 3.

[0029] Figure 10 Figure 3 shows the expression intensity of the FISH probe and the plant universal 5s rRNA probe of the present application in the dicot plant Umbelliferae plant Angelica gigas Nakai.

[0030] Figure 11 Figure 4 shows the expression intensity of the FISH probe and the plant universal 5s rRNA probe of the present application in the dicot plant Umbelliferae plant Carum carvi L.

[0031] Figure 12 Figure 5 shows the expression intensity of the FISH probe in the hybridization generation of Chai 2 and Chai 1 in the Sichuan.

[0032] Figures 1 to 12 In the figure, red is the FISH probe signal of the present application, green is the plant universal 5s rRNA probe signal, yellow is the overlapping point of the FISH probe signal and the plant universal 5s rRNA probe signal, and blue is the signal produced by DAPI (4', 6-diamidino-2-phenylindole) staining of chromosomes. DETAILED DESCRIPTION

[0033] The FISH probe for identifying Bupleurum plant species provided by the embodiments of the present application can specifically hybridize with target repeat sequences at the cellular or chromosomal level, thereby forming stable fluorescent signals under a microscope, and achieving species identification of different Bupleurum plants.

[0034] The probe consists of 59 base sequences from 5' end to 3' end: TTGAGTGGTGACCAAGTTAGAGAACTAATAGCTTATAACATATCGTATCTTGATAAACA, which ensures that the probe can efficiently and accurately bind to the target site, avoiding non-specific binding to non-target genomic regions. By modifying a fluorescent group at the 5' or 3' end of the probe, the present application can directly present a visual signal during detection without additional multi-stage amplification steps, thereby simplifying the experimental process and shortening the detection time. Theoretically, any fluorescent group that can be used for FISH can be used in the present case. Specifically, the fluorescent group is selected from TAMRA, Cy3, Alexa Fluor 488, Alexa Fluor 555, ATTO 550, ROX, Texas Red, or Alexa Fluor 594.

[0035] In the detection process, the probe directly binds to the target repeat sequence in the genome of Bupleurum, and the position after binding is shown by fluorescence labeling. The signal has high stability and repeatability at the chromosome level, which can intuitively distinguish the genomic differences between different species, and realize the rapid and accurate detection of Bupleurum plant species. The probe of the application directly labels the repeat sequence in the genome, which not only ensures the specificity and sensitivity of the detection, but also avoids the limitations of traditional morphological identification, and provides an important technical means for the identification of medicinal materials, taxonomic research and germplasm resource protection.

[0036] In addition, since the probe can directly label the repeat sequence in the genome of Bupleurum and develop color without pre-amplification and multi-stage signal amplification, the application significantly simplifies the experimental steps and shortens the detection time. From chromosome preparation to finally obtaining the observation result, only about 5h is needed, and for the existing chromosome slice, only 2h is needed to obtain the observation result. At the same time, through the high sensitivity detection ability of the fluorescent group, even under the condition of low abundance target sequence, stable and clear signal can still be obtained.

[0037] It should be noted that before using the probe, the probe is diluted to a suitable working concentration (usually 5-20 ng / μL), and is prepared immediately before use to ensure the activity and stability of the probe. The reagent for diluting the probe can be 2×ssc buffer or ultrapure water.

[0038] The design ensures the reliability of the probe in species identification, so that it can not only be applied to laboratory research, but also be popularized to the identification of true and false Bupleurum medicinal materials and resource protection, and has important application value.

[0039] Further, in the description of the application, it should be noted that if the specific conditions are not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If the manufacturer of the reagent or instrument is not specified, it is a conventional product that can be purchased on the market.

[0040] The application will be further described in detail below in combination with the drawings and specific examples. The description of the application is an explanation rather than a limitation. Therefore, the following examples are only used as examples, and cannot limit the protection scope of the application. In addition, it should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should be understood as the usual meaning by the skilled person in the art to which the application belongs.

[0041] Example 1

[0042] In this embodiment, two groups of FISH probes are designed. The nucleotide sequence of the first group of probes (rnd-0 TOP) is shown in SEQ ID NO. 1, which is specifically: 5'-TTGAGTGGTGACCAAGTTAGAGAACTAATAGCTTATAACATATCGTATCTTGATAAACA-3'. The 5' end of the probe is modified with a fluorescent group adding a 6-carboxy tetramethyl rhodamine (TAMRA) label (red signal).

[0043] The nucleotide sequence of the second set of probes (rnd-12 TOP) is shown in SEQ ID NO. 2, specifically: 5'-TTGACTTTAATTTACGTATAATCTATACGACAAAATATAGTCATGAGTAATTTCATTTGATTCGTAT-3'. The 5' end of the probe is modified with a fluorescent group adding a 6-carboxy tetramethyl rhodamine (TAMRA) label (red signal).

[0044] The first set of probes consists of 59 bases, and the second set of probes consists of 67 bases.

[0045] Example 2

[0046] The two sets of FISH probes obtained in Example 1 were used for result verification on Radix Bupleuri, as follows: Step 1: Sample collection and pretreatment (1) Root tip treatment: about 0.8 cm root tips were cut from Radix Bupleuri plants and placed in a wet EP tube with holes, and then put into a laughing gas tank, treated at 0.9-1 atm and 90°C for 2.5 h to obtain clear chromosomes.

[0047] (2) Fixation and preservation: the treated root tips were fixed in freshly prepared 90% glacial acetic acid for 15 min, washed twice with double distilled water, and then transferred to 70% ethanol for preservation.

[0048] (3) Enzymatic digestion and cell dispersion: the preserved root tips were washed 3 times, and about 0.4 cm was cut and digested at 37°C for 1 h. After enzymatic digestion, 70% ethanol was added to stop the reaction and washed 3 times. The tissue was crushed, centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and 20 μL of glacial acetic acid was added and vortexed.

[0049] (4) Slide preparation and microscopic observation: 8-10 μL of sample solution was added dropwise to a glass slide, covered with a cover glass, and naturally dried. Under a microscope, clear and evenly distributed metaphase phases were selected for subsequent hybridization.

[0050] Step 2: FISH hybridization and washing (5) Hybridization solution preparation: 2 μL of probe solution + 8 μL of 2xSSC (0.3M NaCl, 0.03M sodium citrate, pH 7.0).

[0051] (6) Probe hybridization: Add 10 μL of hybridization solution to the sample on the slide and cover with a coverslip. Place in a humidified chamber and hybridize at 37°C for 12–14 h.

[0052] (7) Washing after hybridization: After hybridization, the slide was washed twice in 2×SSC solution at 37℃ for 5 min each time to remove unbound probes.

[0053] Step 3: Signal Detection and Analysis (8) Staining: After drying, stain with DAPI for 15 min.

[0054] (9) Fluorescence microscopy observation: The signal was observed using a fluorescence microscope (such as a Leica DM6000B) with an appropriate filter selected. Results are as follows: Figure 1 As shown in Figures A and B, the first set of FISH probes (SEQ ID NO.1) in Example 1 exhibited a bright and stable fluorescence signal in Bupleurum chinense, while the second set of probes (SEQ ID NO.2) showed no obvious signal in Bupleurum chinense. Therefore, the first set of FISH probes is a specific probe for the identification of Bupleurum chinense plants, and further subsequent experiments were conducted.

[0055] Example 3

[0056] The application of the first set of FISH probes in Example 1 for detecting Bupleurum gene is as follows: Step 1: Sample Collection and Preprocessing (1) Root tip treatment: Root tips of approximately 0.8 cm were taken from different varieties of Bupleurum chinense, wheat HIF3A (monocotyledonous), Dioscorea opposita (dicotyledonous), Angelica dahurica (dicotyledonous), carrot (dicotyledonous), Angelica sinensis (dicotyledonous), and coriander (dicotyledonous). These were placed in moistened perforated EP tubes, then into a nitrous oxide canister, and treated at 0.9–1 atm and 90℃ for 2.5 h. The experiment compared different treatment times (0.5–3 h), and the results showed that 2.5 h of treatment yielded the best results, resulting in clearly visible chromosomes.

[0057] (2) Fixation and preservation: The treated root tips were fixed in freshly prepared 90% glacial acetic acid for 15 min, washed twice with double-distilled water, and then transferred to 70% ethanol for preservation.

[0058] (3) Enzymatic hydrolysis and cell dispersion: Wash the preserved root tips three times, cut off about 0.4 cm, and enzymatically hydrolyze them at 37℃ for 1 h. After enzymatic hydrolysis, add 70% ethanol to stop the reaction and wash three times. Crush the tissue, centrifuge at 4000 rpm for 5 min, discard the supernatant, add 20 μL of glacial acetic acid and vortex to mix.

[0059] (4) Slide preparation and microscopic observation: Add 8–10 μL of sample solution to a glass slide, cover with a coverslip, and allow to air dry. Under a microscope, select clearly stained and evenly distributed metaphase cells for subsequent hybridization.

[0060] Step 2: FISH hybridization and washing FISH probes and 5S rDNA probes (nucleotide sequences shown in SEQ ID NO.3, specifically: TCAGAACTCCGAAGTTAAGCGTGCTTGGGCGAGAGTAGTAC) were used, and the operation steps are as follows: (5) Preparation of hybridization solution: 2 μL probe solution + 8 μL 2×SSC (0.3M NaCl, 0.03 M sodium citrate, pH 7.0).

[0061] (6) Probe hybridization: Add 10 μL of hybridization solution to the sample on a glass slide and cover with a coverslip. Place in a humidified chamber and perform hybridization at 37°C for 12–14 h.

[0062] (7) Washing after hybridization: After hybridization, the slide was washed twice in 2×SSC solution at 37℃ for 5 min each time to remove unbound probes.

[0063] Step 3: Signal Detection and Analysis (8) Staining: After drying, stain with DAPI for 15 min.

[0064] (9) Fluorescence microscopy observation: A fluorescence microscope (e.g., Leica DM6000B) was used, with appropriate filters selected to observe the signal. By comparing the presence and distribution characteristics of fluorescence signals in different samples, it was determined whether the target plant belonged to the genus *Bupleurum*. Results are as follows: Figures 2 to 12 As shown, where, Figures 2 to 5 As shown in Figures 1 and 12, the FISH probe of the present invention exhibits bright and stable fluorescence signals in the first-generation hybrids of Bupleurum chinense No. 1, Bupleurum chinense var. hei, Bupleurum chinense var. chuanchai, Bupleurum chinense var. mishima, Bupleurum chinense No. 1, and Bupleurum chinense var. chuanchai. ...

[0065] In addition, the existing plant universal 5S rDNA probe has signals in Bupleurum chinense No. 1, Bupleurum smithii collected in Gansu, Bupleurum kaoi No. 2 and Bupleurum triquetrum. At the same time, the 5S rDNA probe also has obvious signals in monocotyledonous wheat HIF3A, dicotyledonous Dioscoreaceae, dicotyledonous Apiaceae plant Angelica dahurica, dicotyledonous Apiaceae plant Daucus carota, dicotyledonous Apiaceae plant Angelica sinensis and dicotyledonous Apiaceae plant Carum carvi, so that the Bupleurum plants cannot be distinguished from other plants. In addition, the FISH probe of the present application has no fluorescence signal in monocotyledonous wheat HIF3A, dicotyledonous Dioscoreaceae, dicotyledonous Apiaceae plant Angelica dahurica, dicotyledonous Apiaceae plant Daucus carota, dicotyledonous Apiaceae plant Angelica sinensis and dicotyledonous Apiaceae plant Carum carvi, so that the Bupleurum and other plant varieties can be clearly distinguished.

[0066] In summary, the FISH technology of the present application for Bupleurum variety identification has the following advantages compared with the existing detection technology: In the FISH detection results, the probe of the present application produces bright and stable fluorescence signals at the target repeat sequence, the signal distribution patterns of different species are obviously different, and the species can be intuitively distinguished. Moreover, the FISH method of the present application does not need complex DNA extraction, and can directly detect at the chromosome level, the signal is intuitive and reliable, suitable for rapid identification, especially suitable for identification of true and false medicinal materials, rapid determination of species and resource protection research.

[0067] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but should not be understood as limiting the scope of the present patent. It should be noted that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, which all belong to the protection scope of the present application. Therefore, the protection scope of the present patent should be subject to the appended claims.

Claims

1. A FISH probe that specifically binds to the Bupleurum gene, characterized in that, The nucleotide sequence of the FISH probe is shown in SEQ ID NO.1, and the 5' end of the nucleotide sequence is labeled with a fluorescent group.

2. The FISH probe that specifically binds to the Bupleurum gene according to claim 1, characterized in that, The fluorescent group is selected from TAMRA, Cy3, Alexa Fluor 488, Alexa Fluor 555, ATTO 550, ROX, Texas Red, or Alexa Fluor 594.

3. The use of the FISH probe according to claim 1 or 2 in the preparation of products for detecting Bupleurum gene.

4. The application of the FISH probe according to claim 1 or 2 in the preparation of products for distinguishing different Bupleurum germplasm resources.

5. The use of the FISH probe according to claim 1 or 2 in the preparation of products for distinguishing Bupleurum chinense from other plant varieties.

6. A reagent kit, characterized in that, include: The FISH probe that specifically binds to the Bupleurum gene as described in claim 1 or 2.

7. The reagent kit according to claim 6, characterized in that, Also includes: The probe diluent and reagents for hybridizing the probe with Bupleurum chromosomes; preferably, the diluent is 2×SSC buffer or ultrapure water.

8. The application of the FISH probe according to claim 1 or 2 or the kit according to claim 6 or 7 in the detection of Bupleurum gene.

9. The application of the FISH probe according to claim 1 or 2 or the kit according to claim 6 or 7 in distinguishing different Bupleurum germplasm resources.

10. The use of the FISH probe of claim 1 or 2 or the kit of claim 6 or 7 in distinguishing Bupleurum from other plant varieties.