RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus and application of RT-ERA-CRISPR / Cas12a composition
The detection of avian influenza virus using an RT-ERA-CRISPR/Cas12a combination utilizes an RT-ERA primer set targeting the M gene and crRNA, combined with CRISPR/Cas12a enzymes for isothermal amplification and specific recognition. This solves the problems of complexity and low sensitivity of existing detection methods, and achieves rapid, convenient and efficient detection of avian influenza virus.
Patent Information
- Application Number
- CN202511454560.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-13
- Publication Date
- 2026-01-02
AI Technical Summary
Existing methods for detecting avian influenza viruses rely on specialized equipment and personnel, are complex to operate, time-consuming, and have limited sensitivity and specificity, making it difficult to achieve rapid, convenient, and efficient detection.
Using an RT-ERA-CRISPR/Cas12a combination, RT-ERA primers and crRNA targeting the M gene of avian influenza virus are designed, and combined with CRISPR/Cas12a enzymes for isothermal amplification and specific recognition. The detection results are presented by blue light or ultraviolet light irradiation, simplifying the operation process and reducing equipment dependence.
It enables rapid detection of avian influenza virus RNA at a constant temperature of 45℃, with a minimum concentration as low as 1 copy/μL. The operation is convenient, time-saving, and highly specific, making it suitable for grassroots and field applications, reducing detection costs and improving detection accuracy.
Smart Images

Figure CN121249970A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular biology, in particular to a RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus and application thereof. BACKGROUND
[0002] Avian influenza is an acute infectious disease caused by avian influenza virus (AIV). According to the pathogenicity of avian influenza virus, it can be divided into highly pathogenic avian influenza and low pathogenic avian influenza. Poultry infected with low pathogenic avian influenza shows significant decrease in feed intake and egg production, and shows mild respiratory symptoms such as cough, sneezing and rale, and also reduces the immunity of the host and is more susceptible to mixed infection with other pathogens. Poultry infected with highly pathogenic avian influenza mainly shows severe respiratory symptoms, cyanosis of the comb, decreased egg production, diarrhea, and extensive bleeding of organ tissues such as gizzard and glandular stomach, as well as high morbidity and mortality. In addition to infecting terrestrial birds, waterfowl and wild birds, avian influenza virus can also infect pigs, ferrets, tigers and cattle and other mammals. Currently, some subtypes of avian influenza virus have been found to infect humans and even cause death. Avian influenza virus has 16 HA (H1-H16) subtypes and 9 NA (N1-N9) subtypes; some H5 and H7 subtypes of highly pathogenic avian influenza virus infect poultry, which shows high morbidity and mortality, so highly pathogenic avian influenza is listed as a class of animal diseases. Therefore, avian influenza seriously threatens the development of animal husbandry and public health safety, and it is necessary to establish a rapid and efficient method for detecting avian influenza virus.
[0003] Avian influenza virus (AIV) belongs to the family of Orthomyxoviridae, and the genus of influenza A virus. Its genome consists of eight single-stranded negative-sense RNA segments, which encode viral nucleoprotein (NP), matrix protein (M), non-structural protein (NS), neuraminidase (NA), hemagglutinin (HA), and three polymerase subunits (PB2, PB1 and PA). HA and NA are the main glycoproteins on the surface of avian influenza virus, which are not only key proteins for infecting cells and hosts, but also main targets for neutralizing antibodies. The M gene encodes two matrix proteins: M1 and M2. The M gene is highly conserved among different subtypes of avian influenza virus and different strains of avian influenza virus, so it can be used as the main target gene for designing a universal detection method for avian influenza virus.
[0004] The routine avian influenza virus detection methods such as agar gel immunodiffusion test, hemagglutination and hemagglutination inhibition test have problems of relying on professional equipment and personnel, complicated operation, long time consumption, limited sensitivity and specificity, etc. Although the molecular biology avian influenza virus detection methods such as PCR and fluorescent quantitative PCR have strong specificity, they need to rely on professional thermal cycle equipment (PCR instrument and fluorescent quantitative PCR instrument), have complicated operation, long time consumption and are prone to false positive caused by non-specific amplification. In contrast, the RT-ERACRISPR / Cas12a detection method has significant advantages: the reverse transcription-enzyme amplification (RT-ERA) is convenient, fast and does not need complicated instruments, and the CRISPR / Cas is a nucleic acid endonuclease that can specifically recognize the target sequence guided by crRNA and non-specifically cut the foreign free nucleic acid, and can recognize and detect the amplification product with high sensitivity and high specificity. Therefore, the method does not need complicated equipment, has convenient operation, short time consumption, high sensitivity (can detect very low viral load) and strong specificity, and is very suitable for application and popularization in the grassroots and on-site.
[0005] Therefore, there is an urgent need for an avian influenza virus detection method based on the RT-ERACRISPR / Cas12a technology, so as to realize faster, more accurate and more convenient avian influenza detection method. SUMMARY
[0006] The purpose of the present application is to overcome the above-mentioned shortcomings of the prior art, and to provide an RT-ERACRISPR / Cas12a composition for detecting avian influenza virus and its application.
[0007] The first purpose of the present application is to provide an RT-ERA primer set for detecting avian influenza virus.
[0008] The second purpose of the present application is to provide the application of the above-mentioned RT-ERA primer set in the preparation of products for detecting avian influenza virus.
[0009] The third purpose of the present application is to provide an RT-ERACRISPR / Cas12a composition for detecting avian influenza virus.
[0010] The fourth purpose of the present application is to provide the application of the above-mentioned RT-ERACRISPR / Cas12a composition in the preparation of products for detecting avian influenza virus.
[0011] The fifth purpose of the present application is to provide a kit for detecting avian influenza virus.
[0012] In order to achieve the above-mentioned purposes, the present application is realized by the following scheme: The application claims an RT-ERA primer set for detecting avian influenza virus, which contains an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 6, or an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 7 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 8, or an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 9 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 10.
[0013] Preferably, the RT-ERA primer set contains an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 6.
[0014] The RT-ERA primer set can target the M genome of avian influenza virus, thereby achieving detection of avian influenza virus.
[0015] The application also claims the use of the above-mentioned RT-ERA primer set in the preparation of a product for detecting avian influenza virus.
[0016] Preferably, the product is a kit.
[0017] The application also claims an RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus, which contains any of the above-mentioned RT-ERA primer sets and a crRNA; the nucleotide sequence of the crRNA is shown in any one of SEQ ID NO: 1 and SEQ ID NO: 2.
[0018] Preferably, the nucleotide sequence of the crRNA is shown in SEQ ID NO: 1.
[0019] More preferably, it also contains ssDNA1 or ssDNA2; wherein the nucleotide sequence of ssDNA1 is FAM-CCCCCCCC-BHQ1, and the nucleotide sequence of ssDNA2 is shown in SEQ ID NO: 4.
[0020] Further preferably, it also contains ssDNA1.
[0021] The RT-ERA-CRISPR / Cas12a composition can achieve accurate detection of avian influenza virus without relying on professional thermal cycling equipment and professionals. The whole process only needs to be reacted at 45℃ for 20min under constant temperature conditions, combined with blue light or ultraviolet light irradiation, and can detect a minimum of 1 copy / μL of avian influenza virus RNA.
[0022] The application also claims the use of any of the above-mentioned RT-ERA-CRISPR / Cas12a compositions in the preparation of a product for detecting avian influenza virus.
[0023] Preferably, the product is a kit.
[0024] The application also claims a kit for detecting avian influenza virus, which contains an amplification reaction system and a cleavage detection system; the amplification reaction system contains the RT-ERA primer set of any of the above-mentioned; and the cleavage detection system contains a crRNA with a nucleotide sequence as shown in any of SEQ ID NO: 1 and SEQ ID NO: 2.
[0025] Preferably, the final concentration of the upstream primer and the downstream primer in the RT-ERA primer set in the amplification reaction system of the kit is 10 pmol to 120 pmol.
[0026] More preferably, the final concentration of the upstream primer and the downstream primer in the RT-ERA primer set in the amplification reaction system of the kit is 100 pmol.
[0027] Further preferably, the amplification reaction system further contains RT-ERA amplification reaction reagents.
[0028] More preferably, the RT-ERA amplification reaction reagents include an activator and RT-ERA basic amplification reagents, both of which are from the RT-ERA basic nucleic acid amplification kit of Suzhou Xinda Gene, with the kit model number KS303.
[0029] Preferably, the cleavage detection system contains a crRNA with a nucleotide sequence as shown in SEQ ID NO: 1.
[0030] Preferably, the cleavage detection system further contains ssDNA1 or ssDNA2; wherein the nucleotide sequence of ssDNA1 is FAM-CCCCCCCC-BHQ1; and the nucleotide sequence of ssDNA2 is as shown in SEQ ID NO: 4.
[0031] More preferably, the cleavage detection system further contains ssDNA1.
[0032] Preferably, the cleavage detection system further contains a CRISPR / Cas12a reaction buffer; and the CRISPR / Cas12a reaction buffer contains MgCl2, KCl, glycerol, BSA, Tris-HCl and / or TCEP.
[0033] More preferably, the CRISPR / Cas12a reaction buffer contains 100 mM MgCl2, 1.2 M KCl, 10% glycerol by volume, 1 mg / mL BSA, 100 mM Tris-HCl, and / or 1.5 mM TCEP.
[0034] Preferably, the cleavage detection system further contains a CRISPR / Cas12a enzyme and an RNase inhibitor.
[0035] The present application also claims the use method of the above-mentioned kit, comprising the following steps: S1. Extracting the RNA of the sample to be detected, mixing the RNA of the sample to be detected and the amplification reaction system in the above-mentioned kit uniformly according to the volume ratio of 2-4:46-48, reacting at 37-50℃ for 15-20 min, and collecting the amplification product; S2. Mixing the amplification product obtained in step S1 and the cleavage detection system in the above-mentioned kit uniformly according to the volume ratio of 2-4:16-18, reacting at 37-50℃ for 5-30 min, and collecting the reaction product; S3. Placing the reaction product obtained in step S2 under blue light and / or ultraviolet light for irradiation and observation, and the appearance of fluorescence indicates that the sample to be detected contains avian influenza virus, and the absence of fluorescence indicates that the sample to be detected does not contain avian influenza virus.
[0036] The present application provides an RT-ERA primer set for detecting avian influenza virus, and based on this, an RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus is provided, which contains the above-mentioned RT-ERA primer set and a crRNA with a nucleotide sequence as shown in any one of SEQ ID NO: 1 and SEQ ID NO: 2. The use of the RT-ERA-CRISPR / Cas12a composition can realize accurate detection of avian influenza virus, without relying on professional thermal cycling equipment and professional personnel, and the whole process only needs to be reacted under constant temperature conditions at 45℃, and combined with blue light or ultraviolet light irradiation, which can be completed, and can detect a minimum of 1 copy / μL of avian influenza virus RNA.
[0037] Compared with the prior art, the present application has the following advantages: (1) The present application finds the conserved region in the M gene by comparing the M gene sequences of 533 strains of avian influenza virus, and designs the primer set and crRNA. The design of the RT-ERA primer set and the crRNA of the present application takes into account the genetic diversity of avian influenza virus, which can specifically recognize the target virus and reduce the risk of cross-reaction. The RT-ERA-CRISPR / Cas12a detection method established by the present application for avian influenza virus M gene has high stability and specificity.
[0038] (2) The RT-ERA isothermal amplification technology is combined with CRISPR / Cas12a according to the application, and the RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus is used to detect the avian influenza virus, so that the target DNA is amplified and enriched by using the RT-ERA isothermal amplification technology, the high sensitivity of the method is ensured, the target DNA is specifically recognized and cut by using CRISPR / Cas12a, the false positive results caused by the non-specific amplification of RT-ERA or primer dimers can be effectively avoided, the high specificity of the method is ensured, the detection results can be presented by using a portable blue light or ultraviolet light irradiation instrument, and the shortcoming that the RT-ERA isothermal amplification technology cannot directly read results is effectively solved.
[0039] (3) When the RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus is used to detect the avian influenza virus, the following advantages are obtained compared with the qPCR method: the professional thermal cycler instrument is not needed, and the amplification and cutting of the target gene can be completed by using a conventional constant-temperature water bath kettle or an ordinary thermos cup; secondly, the detection results can be presented by using a conventional portable blue light or ultraviolet light irradiation instrument, the operation is convenient, the time consumption is short, the reading of the final results only needs 20 minutes from the RT-ERA amplification, and the minimum detection limit can reach 1 copy / µL of viral RNA; therefore, the application is more convenient, the time consumption is shorter, and the sensitivity and specificity are higher compared with the traditional PCR and qPCR methods.
[0040] (4) When the RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus is used to detect the avian influenza virus, the positive coincidence rate and the negative coincidence rate of the detection results of the tissue samples infected with avian influenza by the SYBR Green qPCR method are both 100%; it is shown that the universal RT-ERA-CRISPR / Cas12a detection method for avian influenza virus established in the application has the advantages of short time, high accuracy, and wide application prospect in the rapid detection of the avian influenza virus RNA in clinical samples on the spot.
[0041] (5) When the RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus is used to detect the avian influenza virus, the self-made 10×CRISPR / Cas12a buffer is added, so that the final detection speed is faster, and the fluorescence effect is stronger; and the ssDNA fluorescent reporter molecule (FAM-CCCCCCCC-BHQ1) used is more stable, has stronger fluorescence effect, and has faster reaction rate compared with the commonly used commercial fluorescent reporter molecule.
[0042] (6) When the RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus shown in the present application is used to detect avian influenza virus, the detection process is simplified, and users can quickly get started; without expensive laboratory equipment, on-site detection can be performed using portable test instruments, greatly reducing detection costs; it can be quickly deployed for detection in remote areas or on-site, and has a wide application prospect. It is of great significance for early detection and control of avian influenza virus outbreaks. BRIEF DESCRIPTION OF DRAWINGS
[0043] Figure 1 PCR amplification identification results of standard plasmids based on cDNA constructed for each avian influenza virus in Example 1; Figure 2 Conserved region analysis results of M gene sequences of 533 avian influenza viruses in Example 1; Figure 3 Fluorescence test results of each crRNA in Example 1; A is a fluorescence color development result; B is a fluorescence value result; Figure 4 Fluorescence test results of each ssDNA fluorescent probe in Example 1; A is a fluorescence value result of a hairpin structure ssDNA probe with different fluorescent groups; B is a fluorescence value result of a hairpin structure ssDNA probe; C is a fluorescence value result of a linear ssDNA probe; D is a fluorescence value result of ssDNA with serial number 9 and serial number 15; Figure 5 Fluorescence test results of ssDNA in Example 1; A is a fluorescence test result of ssDNA fluorescent probe FAM-L5T-BHQ1; B is a fluorescence test result of ssDNA fluorescent probe FAM-L8C-BHQ1; C is a fluorescence test result of ssDNA fluorescent probe FAM-H10C-BHQ1; Figure 6 Fluorescence test results of CRISPR / Cas12a enzyme with different concentrations in Example 1; Figure 7 Fluorescence test results of different concentration ratios in Example 1; Figure 8Figure 1 is a diagram of the results of optimization of each component in the buffer in Example 1; A is a diagram of the results of the first round of optimization of MgCl2concentration; B is a diagram of the results of the second round of optimization of MgCl2concentration; C is a diagram of the results of the first round of optimization of BSA concentration; D is a diagram of the results of the second round of optimization of BSA concentration; E is a diagram of the results of the first round of optimization of glycerol concentration; F is a diagram of the results of the second round of optimization of glycerol concentration; G is a diagram of the results of the first round of optimization of Tris-HCl concentration; H is a diagram of the results of the second round of optimization of Tris-HCl concentration; I is a diagram of the results of the first round of optimization of TCEP concentration; J is a diagram of the results of the second round of optimization of TCEP concentration; K is a diagram of the results of the first round of optimization of KCl concentration; L is a diagram of the results of the second round of optimization of KCl concentration; M is a diagram of the results of the first round of optimization of pH; N is a diagram of the results of comparison test of 10x CRISPR / Cas12a reaction buffer and 10x NEB buffer r2.1 fluorescence effect; Figure 9 Figure 2 is a diagram of the results of sensitivity test of 10x CRISPR / Cas12a reaction buffer in Example 1; Figure 10 Figure 3 is a diagram of the results of fluorescence test of different shearing times when the DNA template copy number is 1x10 9 copies / μL in Example 1; A is a diagram of the results of fluorescence test of shearing time 5 min; B is a diagram of the results of fluorescence test of shearing time 10 min; C is a diagram of the results of fluorescence test of shearing time 15 min; D is a diagram of the results of fluorescence test of shearing time 20 min; Figure 11 Figure 4 is a diagram of the results of fluorescence test of different shearing times when the DNA template copy number is 1x10 10 copies / μL in Example 1; A is a diagram of the results of fluorescence test of shearing time 5 min; B is a diagram of the results of fluorescence test of shearing time 10 min; C is a diagram of the results of fluorescence test of shearing time 15 min; D is a diagram of the results of fluorescence test of shearing time 20 min; Figure 12 Figure 5 is a diagram of the results of fluorescence test of different shearing temperatures in Example 1; Figure 13 Figure 6 is a diagram of the results of agarose gel electrophoresis identification of each RT-ERA primer set in Example 2; A is a diagram of agarose gel electrophoresis; B is a diagram of gray value results of agarose gel electrophoresis; Figure 14 Figure 7 is a diagram of the results of agarose gel electrophoresis identification of RT-ERA primer amplification of different concentrations in Example 2; Figure 15 Figure 8 is a diagram of the results of agarose gel electrophoresis identification of different amounts of activator addition in Example 2; Figure 16 Figure 9 is a diagram of the results of agarose gel electrophoresis identification of different reaction temperatures in Example 2; Figure 17 Detection results of RNA dilutions with different copy numbers in Example 4; Figure 18 Detection results of RNA of each virus in Example 5; Figure 19 Detection results of each clinical tissue sample in Example 6; A is the detection result of SYBR Green qPCR; B is the detection result of the detection method shown in Example 3. DETAILED DESCRIPTION
[0044] The present application will be further described in conjunction with the drawings and specific examples in the description, which are only used to explain the present application and are not used to limit the scope of the present application. The test methods used in the following examples are conventional methods unless otherwise specified; and the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.
[0045] The freeze-dried microspheres and the activator in the examples of the present application are both derived from RT-ERA Basic Nucleic Acid Amplification Kit with the item number KS303.
[0046] Example 1: Establishment of CRISPR / Cas12a cleavage system for avian influenza virus I. Amplification of avian influenza virus M gene DNA template and construction of standard plasmid 1. Experimental method The RNA of H5N6 subtype avian influenza virus (S23 strain, GenBank: OQ830456.1), H7N9 subtype avian influenza virus (Q102 strain, GenBank: OP718215.1) and H9N2 subtype avian influenza virus (S183 strain, recorded in the prior art “Song Sumei, Guanyun, Lu Jun, et al. Genetic evolution analysis of 5 strains of H9N2 subtype avian influenza virus [J / OL]. Chinese Journal of Animal Infectious Diseases, 1-11 [2025-10-09]. https: / / doi.org / 10.19958 / j.cnki.cn31-2031 / s.20240730.002.”) was extracted using the RNA rapid extraction kit of Shanghai Feijie Biotechnology Co., Ltd. (Shanghai Feijie, item number: 220011), and then the RNA was reverse transcribed to obtain the cDNA of H5 subtype avian influenza virus, the cDNA of H7 subtype avian influenza virus and the cDNA of H9 subtype avian influenza virus using the M-MLV Reverse Transcriptase kit of Promega Company (M1705) according to the kit instructions.
[0047] Then, the cDNA of H5 subtype avian influenza virus, H7 subtype avian influenza virus and H9 subtype avian influenza virus was respectively used as the amplification template to perform PCR amplification, and the PCR amplification product was purified and recovered by using the DNA purification kit (D2111-03) of Magen Company, and the recovered PCR amplification product was used to construct the standard plasmid of H5 subtype avian influenza virus M gene, the standard plasmid of H7 subtype avian influenza virus M gene and the standard plasmid of H9 subtype avian influenza virus M gene by using the pMD TM 19-T Vector Cloning Kit kit (TAKARA, item number: 6013) according to the kit instructions to construct the standard plasmid, and then the standard plasmid of avian influenza virus M gene was respectively identified by PCR amplification.
[0048] The PCR amplification reaction system is: 0.5 μL of TaKaRa Taq enzyme, 5 μL of 10×PCR Buffer, 1 μL of dNTP Mixture with a concentration of 2.5 mM, 0.5 μL of upstream primer MF (10 μM, 5'-AGCAAAAGCAGGTAGATATTGAAAG-3'), 0.5 μL of downstream primer MR (10 μM, 5'-AGTAGAAACAAGGTAGTTTTTTACTC-3'), 3 μL of cDNA and 39.5 μL of RNase-free water.
[0049] The PCR amplification program is: 95°C, 5 min; 94°C, 1 min, 55°C, 30 s, 72°C, 1 min, 35 cycles; 72°C, 10 min.
[0050] 2. Experimental results The PCR amplification identification results of the avian influenza virus M gene standard plasmid constructed based on the cDNA of each avian influenza virus are shown in Figure 1 The results show that an electrophoresis band of about 1000 bp (M gene fragment of avian influenza virus) appears in the PCR amplification identification results, indicating that each avian influenza virus M gene standard plasmid constructed contains the M gene of avian influenza virus.
[0051] II. Design and test of crRNA in CRISPR / Cas12a cleavage system 1. Experimental method 533 sequences of M gene of avian influenza virus were downloaded from NCBI GenBank database, then aligned by MegAlign software, and the conserved region in the M gene sequence of avian influenza virus was found. According to the conserved region of the M gene of avian influenza virus and the PAM motif (5'-TTTV-3') and suboptimal PAM motif (5'-VTTV-3') of CRISPR / Cas12a, 3 crRNAs shown in Table 1 were designed; wherein crRNA1 and crRNA2 are located in the same region.
[0052] Table 1 Information of 3 crRNAs
[0053] Note: For the explanation of SEQ ID NO: 1-3 in the specification sequence table: according to the editing rules of WIPO·Sequence software, the nucleotide sequence must only contain the symbols listed in "WIPO·ST.26 Annex I Part 1", and the base "t" in the RNA sequence is "u", so SEQ ID NO: 1-3 in Table 1 of the specification of the application is substantially the same as in the sequence table.
[0054] Then, the 3 crRNAs shown in Table 1 were tested, as follows: The final concentration of CRISPR / Cas12a enzyme (M0653S, NEB) was 100 nM, 200 nM of crRNA1 (SEQ ID NO: 1), 1 μM of ssDNA fluorescent probe (FAM-TTATT-BHQ1), 0.4 U of RNase inhibitor (R301-01, Vazyme), 2 μL of 10×NEBbuffer r2.1, 2 μL of H5 subtype avian influenza virus M gene standard plasmid (DNA template), and supplemented to 20 μL of RNase-free water, placed at 37°C for 30 min, the cleavage product was collected for fluorescence test on a real-time fluorescence quantitative PCR instrument and the results were recorded, and the test was repeated 3 times in parallel.
[0055] The H5 subtype avian influenza virus M gene standard plasmid was replaced with H7 subtype avian influenza virus M gene standard plasmid and H9 subtype avian influenza virus M gene standard plasmid, respectively, and tested according to the above method and the results were recorded.
[0056] The crRNA1 (SEQ ID NO: 1) was replaced with crRNA2 (SEQ ID NO: 2) and crRNA-3 (SEQ ID NO: 3), respectively, and tested according to the above method and the results were recorded.
[0057] 2. Experimental results The analysis result graph of the conserved region of 533 sequences of M gene of avian influenza virus is as follows: Figure 2The fluorescence test results of each crRNA are shown in the following figures: Figure 3 A in the following figure is the fluorescence development results, Figure 3 B in the following figure is the fluorescence value results. Figure 3
[0058] The results show that the use of crRNA1, crRNA2 and crRNA3 can produce fluorescence when cutting the standard plasmid containing the M gene of the H5 subtype avian influenza virus, the standard plasmid containing the M gene of the H7 subtype avian influenza virus and the standard plasmid containing the M gene of the H9 subtype avian influenza virus, respectively, indicating that the three crRNAs are suitable for the CRISPR / Cas12a cutting system; among them, the crRNA1 with the nucleotide sequence shown in SEQ ID NO: 1 produces the highest fluorescence value when cutting, indicating that the effect of crRNA1 cutting is the best.
[0059] III. Design and testing of ssDNA probe in CRPSPR / Cas12a cutting system 1. Experimental method The ssDNA probes shown in Table 2 were designed, including 15 ssDNA fluorescent probes, of which Nos. 1-4 are hairpin structure ssDNA probes with different fluorescent groups, Nos. 5-10 are linear ssDNA probes, and Nos. 1 and 11-15 are hairpin structure ssDNA probes with the same fluorescent group.
[0060] Table 2 ssDNA probes
[0061] Then, crRNA1 with the nucleotide sequence shown in SEQ ID NO: 1 was used as the crRNA of the CRISPR / Cas12a cutting system, and the CRISPR / Cas12a cutting system was set as follows: final concentration of 100 nM CRISPR / Cas12a enzyme (M0653S, NEB), 200 nM crRNA1 (SEQ ID NO: 1), 1 μM ssDNA fluorescent probe, 0.4 U of RNAase inhibitor (R301-01, Vazyme), 2 μL of 10×NEBbuffer r2.1, 2 μL of H5 subtype avian influenza virus M gene standard plasmid (DNA template) and supplemented to 20 μL of RNase-free water; wherein the ssDNA fluorescent probes are shown in Table 2.
[0062] The CRISPR / Cas12a cutting system was placed at 37°C for 30 min, and the cutting products were collected for fluorescence testing on a real-time fluorescence quantitative PCR instrument and the results were recorded. Each ssDNA fluorescent probe was tested in triplicate, and RNase-free water was used as a negative control (NC).
[0063] 2. Experimental results The fluorescence test results of each ssDNA fluorescent probe are shown in Figure 4 , Figure 4 A in the above table is a fluorescence value result chart of hairpin structure ssDNA probes with different fluorescent groups, Figure 4 B in the above table is a fluorescence value result chart of hairpin structure ssDNA probes with the same fluorescent group, Figure 4 C in the above table is a fluorescence value result chart of linear ssDNA probes, Figure 4 D in the above table is a fluorescence value result chart of ssDNA with SEQ ID NO: 9 and SEQ ID NO: 15.
[0064] The results show that under the same reaction conditions, the fluorescence values of the cleavage products are quite different when 15 different ssDNA probes are combined with CRISPR / Cas12a cleavage, among which the fluorescence values of FAM-L8C-BHQ1 (SEQ ID NO: 9) and FAM-H10C-BHQ1 (SEQ ID NO: 4, SEQ ID NO: 15) are higher, and the fluorescence value of FAM-L8C-BHQ1 (SEQ ID NO: 9) is the highest.
[0065] Four, sensitivity test of ssDNA probe 1. Experimental method The copy number of the H5 subtype avian influenza virus M gene standard plasmid (DNA template) was adjusted to 1 x 10 11 copies / μL, 1 x 10 10 copies / μL, 1 x 10 9 copies / μL, 1 x 10 8 copies / μL and 1 x 10 7 copies / μL, respectively, to obtain standard plasmid DNA templates with different copy number concentrations.
[0066] The CRISPR / Cas12a cleavage system was set as follows: CRISPR / Cas12a enzyme (M0653S, NEB) with a final concentration of 100 nM, crRNA1 (SEQ ID NO: 1) with a concentration of 200 nM, ssDNA fluorescent probe FAM-L8C-BHQ1 (SEQ ID NO: 9 in Table 2) with a concentration of 1 μM, RNAase inhibitor (R301-01, Vazyme) with a concentration of 0.4 U, 10 x NEB buffer r2.1 with a concentration of 2 μL, H5 subtype avian influenza virus M gene standard plasmid with a copy number of 1 x 10 11 copies / μL, and RNase-free water added to 20 μL.
[0067] The CRISPR / Cas12a cleavage system was placed at 37°C for 30 min, the cleavage products were collected and tested for fluorescence on a real-time fluorescence quantitative PCR instrument, and the results were recorded, with three parallel tests.
[0068] Then the copy number of the H5 subtype avian influenza virus M gene standard plasmid (DNA template) was adjusted to 1 x 10 10 copies / μL, 1 x 10 9 copies / μL, 1 x 10 8 copies / μL and 1 x 10 7 copies / μL, respectively, and the fluorescence test was carried out according to the above method, and the fluorescence test results of different copy numbers were recorded; and the non-ribonuclease water was used as a negative control (NC).
[0069] The ssDNA fluorescent probe FAM-L8C-BHQ1 (SEQ ID NO: 9) in the CRISPR / Cas12a cleavage system was replaced by ssDNA fluorescent probe FAM-H10C-BHQ1 (SEQ ID NO: 4) and ssDNA fluorescent probe FAM-L5T-BHQ1 (FAM-TTATT-BHQ1) in turn, and the fluorescence test was carried out according to the above method, and the fluorescence test results of different ssDNA fluorescent probes were recorded.
[0070] 2. Experimental results The ssDNA sensitivity test results are shown in Figure 5 , Figure 5 A in which is the fluorescence test result of ssDNA fluorescent probe FAM-L5T-BHQ1, Figure 5 B in which is the fluorescence test result of ssDNA fluorescent probe FAM-L8C-BHQ1, Figure 5 C in which is the fluorescence test result of ssDNA fluorescent probe FAM-H10C-BHQ1.
[0071] The results show that: under the same reaction conditions, when FAM-L8C-BHQ1 shown in SEQ ID NO: 9 or FAM-H10C-BHQ1 shown in SEQ ID NO: 4 is used as the ssDNA fluorescent probe in the CRISPR / Cas12a cleavage system, when the copy number of the H5 subtype avian influenza virus M gene standard plasmid is 1 x 10 11 copies / μL, 1 x 10 10 copies / μL and 1 x 10 9 copies / μL, all can produce obvious fluorescence, and when the copy number is lower than 1 x 10 9 copies / μL, there is no fluorescence reaction; while the commercial ssDNA fluorescent probe FAM-L5T-BHQ1 has no fluorescence reaction when the copy number is lower than 1 x 10 10 copies / μL, and the sensitivity is significantly lower than the above two ssDNA fluorescent probes.
[0072] V. Optimization of CRISPR / Cas12a enzyme concentration in CRISPR / Cas12a cleavage system 1. Experimental method The CRISPR / Cas12a cleavage system was set as follows: CRISPR / Cas12a enzyme (M0653S, NEB) at a final concentration of 100 nM, crRNA1 (SEQ ID NO: 1) at 200 nM, ssDNA fluorescent probe FAM-L8C-BHQ1 (No. 9 in Table 2) at 1 μM, 0.4 U of RNase inhibitor (R301-01, Vazyme), 2 μL of 10x NEB buffer r2.1, 2 μL of 1x10 10 copies / μL of H5 subtype avian influenza virus M gene standard plasmid, and the volume was made up to 20 μL with RNase-free water.
[0073] The CRISPR / Cas12a cleavage system was placed at 37°C for 30 min, the cleavage product was collected for fluorescence testing on a real-time fluorescence quantitative PCR instrument, and the results were recorded, and the test was performed in triplicate; RNase-free water was used as a negative control (NC).
[0074] Then the concentration of CRISPR / Cas12a enzyme was adjusted to 12.5 nM, 25 nM, 50 nM and 200 nM, respectively, and the above method was used for processing, and the fluorescence test results of different concentrations of CRISPR / Cas12a enzyme were recorded.
[0075] 2. Experimental results The fluorescence test results of CRISPR / Cas12a enzyme at different concentrations are shown in Figure 6 The results show that when the concentration of CRISPR / Cas12a enzyme in the CRISPR / Cas12a cleavage system is 100 nM, the fluorescence intensity in the fluorescence test result is the largest, and therefore the optimal concentration of CRISPR / Cas12a enzyme in the CRISPR / Cas12a cleavage system is 100 nM.
[0076] VI. Optimization of CRISPR / Cas12a enzyme and crRNA concentration ratio in CRISPR / Cas12a cleavage system 1. Experimental method According to the CRISPR / Cas12a cleavage system (the concentration ratio of CRISPR / Cas12a enzyme to crRNA in the system is 1:2) shown in "V. Optimization of CRISPR / Cas12a enzyme concentration in CRISPR / Cas12a cleavage system", the CRISPR / Cas12a cleavage system was placed at 37°C for 30 min, the cleavage product was collected for fluorescence test on a real-time fluorescence quantitative PCR instrument, and the results were recorded, and the test was performed in parallel for 3 times; the nuclease-free water was used as a negative control (NC).
[0077] The CRISPR / Cas12a cleavage system was placed at 37°C for 30 min, the cleavage product was collected for fluorescence test on a real-time fluorescence quantitative PCR instrument, and the results were recorded, and the test was performed in parallel for 3 times; the nuclease-free water was used as a negative control (NC).
[0078] Then the concentration of crRNA1 in the CRISPR / Cas12a cleavage system was adjusted to 50nM (the concentration ratio of CRISPR / Cas12a enzyme to crRNA was 1:0.5), 100nM (the concentration ratio of CRISPR / Cas12a enzyme to crRNA was 1:1) and 300nM (the concentration ratio of CRISPR / Cas12a enzyme to crRNA was 1:3) in turn, and the fluorescence test results at different concentration ratios were recorded according to the above method.
[0079] 2. Experimental results The fluorescence test results at different concentration ratios are shown in Figure 7 The results show that under the same reaction conditions, when the concentration ratio of CRISPR / Cas12a enzyme to crRNA1 in the CRISPR / Cas12a cleavage system is 1:2, the fluorescence intensity is the highest, that is, the concentration of CRISPR / Cas12a enzyme in the CRISPR / Cas12a cleavage system is 100nM, and the concentration of crRNA1 is 200nM.
[0080] Seven, optimization of buffer buffer in CRISPR / Cas12a cleavage system 1. Experimental method The CRISPR / Cas12a cleavage system was set up as follows: a final concentration of 100 nM of CRISPR / Cas12a enzyme (M0653S, NEB), 200 nM of crRNA1 (SEQ ID NO: 1, the concentration ratio of CRISPR / Cas12a enzyme to crRNA is 1:2), 1 μM of ssDNA fluorescent probe FAM-L8C-BHQ1 (No. 9 in Table 2), 0.4 U of RNase inhibitor (R301-01, Vazyme), 2 μL of buffer buffer (10x CRISPR / Cas12a reaction buffer), 2 μL of H5 subtype avian influenza virus M gene standard plasmid with a copy number of 1x10 10 copies / μL, and RNase-free water added to 20 μL; The buffer buffer (10x CRISPR / Cas12a reaction buffer) is composed of MgCl2 with a final concentration of 50 mM, BSA with a concentration of 1 mg / mL, glycerol with a concentration of 10% (v / v), Tris-HCl with a concentration of 200 mM, TCEP with a concentration of 1 mM, and KCl with a concentration of 1 M, and the pH is 8.0.
[0081] The CRISPR / Cas12a cleavage system was placed at 37°C for 30 min, the cleavage products were collected and tested for fluorescence on a real-time fluorescence quantitative PCR instrument, and the results were recorded. Three parallel tests were performed.
[0082] The concentrations of each component in the buffer buffer (10x CRISPR / Cas12a reaction buffer) were optimized, and each component was optimized for two rounds, as follows: In the first round of optimization, the final concentration of MgCl2 in the buffer buffer (10x CRISPR / Cas12a reaction buffer) was adjusted to 10 mM, 100 mM, and 150 mM, respectively; the final concentration of BSA was adjusted to 10 mg / mL, 100 μg / mL, and 10 μg / mL, respectively; the volume final concentration of glycerol was adjusted to 20% (v / v), 10% (v / v), and 5% (v / v), respectively; the final concentration of Tris-HCl was adjusted to 400 mM, 300 mM, and 100 mM, respectively; the final concentration of TCEP was adjusted to 100 mM, 10 mM, and 0.1 mM, respectively; the final concentration of KCl was adjusted to 1.5 M, 0.5 M, and 0.15 M, respectively; the pH was adjusted to 6.8, 7.8, 8.5, and 8.8, respectively. The buffer buffer (10x CRISPR / Cas12a reaction buffer) with different concentrations in the first round of optimization was tested for fluorescence according to the above method, and the fluorescence test results were recorded.
[0083] Second round of optimization: based on the experimental results of the first round of optimization, the final concentration of MgCl2 in the buffer (10x CRISPR / Cas12a reaction buffer) was adjusted to 120 mM, 100 mM and 80 mM in turn; the final concentration of BSA was adjusted to 5 mg / mL, 1 mg / mL and 500 μg / mL in turn; the final concentration of glycerol was adjusted to 12% (v / v), 10% (v / v) and 8% (v / v) in turn; the final concentration of Tris-HCl was adjusted to 150 mM, 100 mM and 50 mM in turn; the final concentration of TCEP was adjusted to 1.5 mM, 1 mM and 0.5 mM in turn; the final concentration of KCl was adjusted to 1.2 M, 1 M and 0.8 M in turn, and the buffer (10x CRISPR / Cas12a reaction buffer) with different concentrations in the second round of optimization was tested for fluorescence according to the method shown above, and the fluorescence test results were recorded.
[0084] The buffer (10x CRISPR / Cas12a reaction buffer) was replaced with an equal amount of 10x NEB buffer r2.1 as a control, and the fluorescence test was performed according to the method shown above, and the fluorescence test results were recorded.
[0085] 2. Experimental results The optimization results of each component in the buffer are shown in Figure 8 Figure 8 A in FIG. 1 is the first round of optimization results of MgCl2 concentration, Figure 8 B in FIG. 1 is the second round of optimization results of MgCl2 concentration; Figure 8 C in FIG. 1 is the first round of optimization results of BSA concentration, Figure 8 D in FIG. 1 is the second round of optimization results of BSA concentration; Figure 8 E in FIG. 1 is the first round of optimization results of glycerol concentration, Figure 8 F in FIG. 1 is the second round of optimization results of glycerol concentration; Figure 8 G in FIG. 1 is the first round of optimization results of Tris-HCl concentration, Figure 8 H in FIG. 1 is the second round of optimization results of Tris-HCl concentration; Figure 8 I in FIG. 1 is the first round of optimization results of TCEP concentration, Figure 8 J in FIG. 1 is the second round of optimization results of TCEP concentration; Figure 8 K in FIG. 1 is the first round of optimization results of KCl concentration, Figure 8 L in FIG. 1 is the second round of optimization results of KCl concentration; Figure 8 M in FIG. 1 is the first round of optimization results of pH, Figure 8 N is 10x CRISPR / Cas12a reaction buffer and 10x NEBbuffer r2.1 effect comparison test result graph.
[0086] The results show that under the same reaction conditions, the optimal concentration of MgCl2 in buffer buffer (10x CRISPR / Cas12a reaction buffer) is 100 mM, the optimal concentration of KCl is 1.2 M, the optimal concentration of BSA is 1 mg / mL, the optimal volume of glycerol is 10% (v / v), the optimal concentration of Tris-HCl is 100 mM, the optimal concentration of TCEP is 1.5 mM, and the optimal pH is 8.5.
[0087] And based on Figure 8 N, compared with using 10x NEBbuffer r2.1, using buffer buffer (10x CRISPR / Cas12a reaction buffer) as the buffer for the reaction has obviously better reaction efficiency.
[0088] Eight, sensitivity test of the optimal 10x CRISPR / Cas12a reaction buffer 1. Experimental method According to the method shown in "Four, sensitivity of ssDNA probe", replace 10x NEBbuffer r2.1 in CRISPR / Cas12a cutting system with 10x CRISPR / Cas12a reaction buffer composed of the optimal component concentration in step seven, and record the results.
[0089] 2. Experimental results The sensitivity test result graph of 10x CRISPR / Cas12a reaction buffer is shown in Figure 9 The results show that when the 10x CRISPR / Cas12a reaction buffer with the optimal component concentration is used as the buffer in the CRISPR / Cas12a cutting system, when the copy number of H5 subtype avian influenza virus M gene standard plasmid is 1x10 11 copies / μL, 1x10 10 copies / μL and 1x10 9 copies / μL, it can produce obvious fluorescence, and when the copy number is lower than 1x10 9 copies / μL, there is no fluorescence reaction, which shows that the 10x CRISPR / Cas12a reaction buffer with the optimal component concentration does not reduce the sensitivity of the cutting system.
[0090] Nine, optimization of CRISPR / Cas12a cutting time 1. Experimental method The CRISPR / Cas12a cleavage system was set up as follows: a final concentration of 100 nM CRISPR / Cas12a enzyme (M0653S, NEB), 200 nM crRNA1 (SEQ ID NO: 1, the concentration ratio of CRISPR / Cas12a enzyme to crRNA is 1:2), 1 mM ssDNA fluorescent probe FAM-L8C-BHQ1 (No. 9 in Table 2), 0.4 U of RNase inhibitor (R301-01, Vazyme), 2 mL of buffer (10x CRISPR / Cas12a reaction buffer), 2 mL of H5 subtype avian influenza virus M gene standard plasmid with a copy number of 1x10 9 copies / μL and supplemented with 20 mL of nuclease-free water; The buffer (10x CRISPR / Cas12a reaction buffer) is composed of 100 mM MgCl2, 1 mg / mL BSA, 10% (v / v) glycerol, 100 mM Tris-HCl, 1.5 mM TCEP and 1.2 M KCl with a final concentration of 10% (v / v), and the pH is 8.5.
[0091] The CRISPR / Cas12a cleavage system was placed at 37°C for 5 min, and the cleavage products were observed under ultraviolet light and blue light irradiation instrument and photographed. The results were recorded, and three parallel tests were performed.
[0092] Then the cleavage time was modified to 10 min, 15 min and 20 min, respectively, and the above method was used for processing. The fluorescence test was performed for different cleavage times and the results were recorded. The H5 subtype avian influenza virus M gene standard plasmid was replaced with nuclease-free water as a negative control.
[0093] Then the copy number of the H5 subtype avian influenza virus M gene standard plasmid was adjusted to 1x10 10 copies / μL, and the above method was used for processing. The fluorescence test results of different copy numbers of standard plasmid combined with different cleavage times were recorded.
[0094] 2. Experimental results The fluorescence test results of different cleavage times of the H5 subtype avian influenza virus M gene standard plasmid (DNA template) with a copy number of 1x10 9 copies / μL are shown in Figure 10 Figure 10 A in which A is the fluorescence test result of cleavage time 5 min, Figure 10 B in which B is the fluorescence test result of cleavage time 10 min, Figure 10 C in which C is the fluorescence test result of cleavage time 15 min, Figure 10 D in which D is the fluorescence test result of cleavage time 20 min.
[0095] The copy number of the H5 subtype avian influenza virus M gene standard plasmid (DNA template) was 1 x 10 10 The fluorescence test results of different shearing times when the copy number of the H5 subtype avian influenza virus M gene standard plasmid (DNA template) was 1 x 10 Figure 11 copies / μL are shown in Figure 11 A in the above table is the fluorescence test result of shearing time 5 min, Figure 11 B in the above table is the fluorescence test result of shearing time 10 min, Figure 11 C in the above table is the fluorescence test result of shearing time 15 min, Figure 11 D in the above table is the fluorescence test result of shearing time 20 min.
[0096] The results show that when the copy number concentration of the H5 subtype avian influenza virus M gene standard plasmid (DNA template) is 1 x 10 9 copies / μL or 1 x 10 10 copies / μL, a detectable fluorescence signal can be generated under blue light or ultraviolet light excitation after shearing for 5 min in the above-mentioned CRISPR / Cas12a shearing system; therefore, the shearing time of 5 min is taken as the optimal shearing time.
[0097] Ten, optimization of CRISPR / Cas12a shearing temperature 1. Experimental method The CRISPR / Cas12a shearing system was set up as shown in "Nine, optimization of CRISPR / Cas12a shearing time", and the CRISPR / Cas12a shearing system was placed at 37°C (shearing temperature) for 5 min, and the shearing product was observed under ultraviolet light and blue light irradiation instrument, and the results were photographed and recorded.
[0098] Then the shearing temperature was adjusted to 25°C, 30°C, 40°C, 45°C and 50°C in turn, and the above-mentioned method was used for processing, and the fluorescence test results under different shearing temperatures were recorded; during the fluorescence test, the H5 subtype avian influenza virus M gene standard plasmid was replaced by nuclease-free water as a negative control 2. Experimental results The fluorescence test results under different shearing temperatures are shown in Figure 12 The results show that when the shearing temperature is 25°C, 30°C, 37°C, 40°C, 45°C and 50°C, the CRISPR / Cas12a shearing can produce fluorescence under blue light and ultraviolet light irradiation, and when the shearing temperature is ≥30°C and the shearing time is 5 min, strong fluorescence can be observed under blue light and ultraviolet light irradiation. In order to combine with the optimal temperature 45°C of RT-ERA reaction in subsequent tests, therefore, 45°C is taken as the optimal shearing temperature.
[0099] Example 2 Establishment of RT-ERA system in avian influenza virus RT-ERA-CRISPR / Cas12a detection I. Design and test of RT-ERA primer 1. Experimental method 533 avian influenza virus M gene sequences were downloaded from NCBI GenBank, and the conserved region of the avian influenza virus M gene sequence was determined in the crRNA1 region containing the nucleotide sequence shown in SEQ ID NO: 1 by MegAlign software analysis, and the RT-ERA primer shown in Table 3 was designed.
[0100] Table 3 RT-ERA primer information
[0101] Then test the 3 groups of RT-ERA primers shown in Table 3 as follows: M-ERA-1 primer group test: mix 2 μL of M-ERA-F1 (10 μM), 2 μL of M-ERA-R1 (10 μM), and 2 μL of H5 subtype avian influenza virus RNA (from Example 1) and supplement to 48 μL of nuclease-free water, and transfer to a 200 μL reaction tube containing 0.02 g of freeze-dried microspheres, shake and mix, then add 2 μL of activator on the reaction tube cap, then centrifuge at 3000 rpm for 5 s, then place at 45°C (reaction temperature) for 20 min, then purify and recover the RT-ERA product by the DNA purification kit (D2111-03, Magen) after the reaction is completed, and identify the recovered product by 1% (w%) agarose gel electrophoresis; the RT-ERA reaction product with nuclease-free water as the template is used as a negative control during the agarose gel electrophoresis identification process.
[0102] Then replace the H5 subtype avian influenza virus RNA with H7 subtype avian influenza virus RNA and H9 subtype avian influenza virus RNA in turn, and identify by agarose gel electrophoresis according to the above method and record the identification results.
[0103] Replace M-ERA-F1 and M-ERA-R1 with equal amounts of M-ERA-F2 and M-ERA-R2, respectively, and process according to the above method, and record the agarose gel electrophoresis identification results of the M-ERA-2 primer group; replace M-ERA-F1 and M-ERA-R1 with equal amounts of M-ERA-F3 and M-ERA-R3, respectively, and process according to the above method, and record the agarose gel electrophoresis identification results of the M-ERA-3 primer group.
[0104] 2. Experimental results The results of agarose gel electrophoresis identification of each RT-ERA primer set are shown in Figure 13 Figure 13 A in the above table is an agarose gel electrophoresis chart, Figure 13 B in the above table is a gray value chart of agarose gel electrophoresis.
[0105] The results show that under the same reaction conditions, the three groups of RT-ERA primers shown in Table 3 can all amplify bands when tested with H5 subtype avian influenza virus RNA, H7 subtype avian influenza virus RNA and H9 subtype avian influenza virus RNA as templates respectively; and the electrophoresis band is the brightest when the M-ERA-1 primer set (consisting of M-ERA-F1 with nucleotide sequence as shown in SEQ ID NO: 5 and M-ERA-R1 with nucleotide sequence as shown in SEQ ID NO: 6) is used to amplify the template, so the M-ERA-1 primer set is the best primer set.
[0106] II. Optimization of the best RT-ERA primer concentration in the RT-ERA system 1. Experimental method 2 μL of M-ERA-F1 (SEQ ID NO: 5) with a concentration of 5 μM (added amount of 10 pmol), 2 μL of M-ERA-R1 (SEQ ID NO: 6) with a concentration of 5 μM (added amount of 10 pmol), 2 μL of H5 subtype avian influenza virus RNA and 48 μL of nuclease-free water were mixed uniformly, transferred to a 200 μL reaction tube containing 0.02 g of freeze-dried microspheres, shaken and mixed, 2 μL of activator was added on the cover of the reaction tube, then centrifuged at 3000 rpm for 5 s, placed at 45°C (reaction temperature) for 20 min, after the reaction, the RT-ERA product was purified and recovered by the DNA purification kit (D2111-03, Magen), and the recovered product was identified by 1% (w%) agarose gel electrophoresis; the RT-ERA reaction product with nuclease-free water as the template was used as a negative control in the agarose gel electrophoresis identification process.
[0107] Then the concentrations of M-ERA-F1 (SEQ ID NO: 5) and M-ERA-R1 (SEQ ID NO: 6) were adjusted to 10 μM (added amount of 20 pmol), 15 μM (added amount of 30 pmol), 25 μM (added amount of 50 pmol), 35 μM (added amount of 70 pmol), 40 μM (added amount of 80 pmol), 50 μM (added amount of 100 pmol) and 60 μM (added amount of 120 pmol) respectively, and the above method was used for processing, and the agarose gel electrophoresis identification results of RT-ERA primers with different concentrations were obtained.
[0108] 2. Experimental results The agarose gel electrophoresis identification results of RT-ERA primer amplification at different concentrations are shown in Figure 14 The results show that the electrophoresis lanes corresponding to the primer addition amounts of 10 pmol, 20 pmol, 30 pmol, 50 pmol, 70 pmol, 80 pmol, 100 pmol and 120 pmol all appear obvious electrophoresis bands, and the electrophoresis band corresponding to the primer addition amount of 100 pmol is the brightest, indicating that the amplification effect of the primer addition amount of 100 pmol is the best.
[0109] III. Optimization of the best activator amount in the RT-ERA system 1. Experimental method According to the experimental method shown in "II. Optimization of the best RT-ERA primer concentration in the RT-ERA system", the concentrations of M-ERA-F1 (SEQ ID NO: 5) and M-ERA-R1 (SEQ ID NO: 6) were both adjusted to 50 μM for identification; and the addition amount of the activator was adjusted to 1 μL, 3 μL, 4 μL and 5 μL in turn, which was treated according to the above method, and the agarose gel electrophoresis identification results at different activator addition amounts were recorded.
[0110] 2. Experimental results The agarose gel electrophoresis identification results at different activator addition amounts are shown in Figure 15 The results show that when the activator amount in the RT-ERA amplification system is 1 μL-5 μL, the RT-ERA has a better amplification effect, and an electrophoresis band appears; among them, when the activator amount is 2 μL, the corresponding electrophoresis band is the brightest, so 2 μL is taken as the best addition amount of the activator.
[0111] IV. Optimization of the reaction temperature in the RT-ERA system 1. Experimental method According to the experimental method shown in "II. Optimization of the best RT-ERA primer concentration in the RT-ERA system", the concentrations of M-ERA-F1 (SEQ ID NO: 5) and M-ERA-R1 (SEQ ID NO: 6) were both adjusted to 50 μM for identification; and the reaction temperature was adjusted to 35℃, 37℃, 37℃, 42℃ and 50℃ in turn, which was treated according to the above method, and the agarose gel electrophoresis identification results at different reaction temperatures were recorded.
[0112] 2. Experimental results The agarose gel electrophoresis identification results at different reaction temperatures are shown in Figure 16As shown, the results show that obvious target bands appear in the electrophoresis lanes corresponding to reaction temperatures of 37℃, 39℃, 42℃, 45℃ and 50℃, that is, when the reaction temperature of the RT-ERA amplification system is set to 37℃-50℃, the RT-ERA has good amplification effect; among them, the electrophoresis band corresponding to the reaction temperature of 45℃ is the brightest, and the RT-ERA amplification effect is the best, so the optimal reaction temperature of the RT-ERA amplification system is 45℃.
[0113] Example 3: A RT-ERA-CRISPR / Cas12a detection method for avian influenza virus A RT-ERA-CRISPR / Cas12a detection method for avian influenza virus, comprising the following steps: S1. Extracting the RNA of the sample to be tested by using the RNA rapid extraction kit; S2. Mixing 2μL of M-ERA-F1 (SEQ ID NO: 5) with a concentration of 50μM (the added amount is 100pmol), 2μL of M-ERA-R1 (SEQ ID NO: 6) with a concentration of 50μM (the added amount is 100pmol), 2μL of RNA obtained in step S1 and 48μL of RNase-free water to make up to 48μL, and then transferring them to a 200μL reaction tube containing 0.02g of freeze-dried microspheres, shaking to mix, adding 2μL of activator on the reaction tube cap, then centrifuging at 3000rpm for 5s, and then placing it in a 45℃ reaction for 15min, and then collecting the RT-ERA amplification product after the reaction is completed; S3. Mixing 100nM of CRISPR / Cas12a enzyme (M0653S, NEB), 200nM of crRNA1 (SEQ ID NO: 1, the concentration ratio of CRISPR / Cas12a enzyme to crRNA is 1:2), 1μM of ssDNA fluorescent probe FAM-L8C-BHQ1 (No. 9 in Table 2), 0.4U of RNAase inhibitor (R301-01, Vazyme), 2μL of buffer (10×CRISPR / Cas12a reaction buffer), 2μL of RT-ERA amplification product obtained in step S2 and 20μL of RNase-free water to make up to 20μL, and then mixing them uniformly, and then shearing them at 45℃ for 5min to obtain the final product; The buffer (10×CRISPR / Cas12a reaction buffer) is composed of 100mM of MgCl2, 1mg / mL of BSA, 10% (v / v) of glycerol in volume, 100mM of Tris-HCl, 1.5mM of TCEP and 1.2M of KCl, and the pH is 8.5; S4. The final product obtained in step S3 is placed under blue light or ultraviolet light, and fluorescence appears in the final product under the irradiation of blue light or ultraviolet light, indicating that the sample to be tested contains avian influenza virus; no fluorescence appears in the final product under the irradiation of blue light or ultraviolet light, indicating that the sample to be tested does not contain avian influenza virus.
[0114] Example 4 Sensitivity test of detection method I. Experimental method The RNA of H5 subtype avian influenza virus (mixed RNA fragments) was extracted by using the RNA rapid extraction kit of Shanghai Feijie Biotechnology Co., Ltd. (Shanghai Feijie, item number: 220011), and the extracted RNA was used as a template to perform reverse transcription to obtain the cDNA of H5 subtype avian influenza virus by using the M-MLV Reverse Transcriptase kit of Promega Co., Ltd. (Promega, item number: M1705) according to the instructions of the kit.
[0115] A T7 promoter (TAATACGACTCACTATAGGG) was added to the 5' end of the upstream primer MF (10 μM, 5'-AGCAAAAGCAGGTAGATATTGAAAG-3') to obtain the upstream primer T7-MF.
[0116] The H5 subtype avian influenza virus cDNA obtained above was used as a template, and the upstream primer T7-MF and the downstream primer MR were used to perform PCR amplification to obtain the DNA fragment of the M gene of avian influenza virus containing the T7 promoter, followed by agarose gel electrophoresis, cutting of the target band (about 1027 bp), and then purification by using the DNA purification kit of Magen Co., Ltd. (D2111-03, Magen) to obtain the purified DNA product of the M gene of avian influenza virus containing the T7 promoter as a template for RNA transcription; The PCR amplification reaction system was as follows: 0.5 μL of TaKaRa Taq enzyme, 5 μL of 10×PCR Buffer, 1 μL of dNTP Mixture with a concentration of 2.5 mM, 0.5 μL of the upstream primer T7-MF (10 μM, 5'-TAATACGACTCACTATAGGGAGCAAAAGCAGGTAGATATTGAAAG-3'), 0.5 μL of the downstream primer MR (10 μM, 5'-AGTAGAAACAAGGTAGTTTTTTACTC-3'), 3 μL of the template, and 39.5 μL of RNase-free water.
[0117] Then the DNA product containing T7 promoter of the purified avian influenza virus M gene was transcribed by using the T7 High Yield RNA Transcription kit (Vazyme, product number DD4202-01) to obtain a single fragment of H5 subtype avian influenza virus M gene RNA.
[0118] The nucleic acid concentration of the single fragment of H5 subtype avian influenza virus M gene RNA was determined, and the RNA copy number was calculated by using the NEBioCalculator calculator on the NEB website. Then the RNA copy number was diluted to 10 11 copies / μL by using RNase-free water to obtain the avian influenza virus M gene RNA dilution.
[0119] Then the H5 subtype avian influenza virus M gene RNA dilution with a copy number of 10 11 copies / μL was serially diluted by 10 times to obtain RNA dilutions with copy numbers of 10 10 copies / μL, 10 9 copies / μL, 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 copies / μL and 1 copy / μL.
[0120] The RNA dilutions with copy numbers of 10 7 copies / μL to 1 copy / μL were used as the sample RNA to be detected in the sensitivity test, and were detected according to the detection method shown in Example 3, and the RT-ERA reaction time was 15 min. The results corresponding to the RNA dilutions with different copy numbers were recorded. Then the reaction time (i.e. the RT-ERA reaction time) in step S2 of the detection method shown in Example 3 was adjusted to 5 min, 10 min and 20 min in turn, and the RNA dilutions with different copy numbers were detected and the results were recorded.
[0121] II. Experimental results The detection results of the H5 subtype avian influenza virus M gene RNA dilutions with different copy numbers are shown in Figure 17 The results show that under blue light and ultraviolet light irradiation, when the reaction time in step S2 of Example 3 is 5 min, 10 7The test reaction corresponding to the RNA dilution of 10 copies / µL can still be observed to have obvious fluorescence; the test reaction corresponding to the RNA dilution of 1 copy / µL can still be observed to have obvious fluorescence when the reaction in step S2 of Example 3 is for 15 min; and the test reaction corresponding to the RNA dilution of 1 copy / µL can be observed to have strong fluorescence when the reaction in step S2 of Example 3 is for 20 min. Therefore, the optimal reaction time in step S2 of the detection method shown in Example 3 is 15 min, and the minimum detection limit can be up to 1 copy / µL of viral RNA. 2 The test reaction corresponding to the RNA dilution of 10 copies / µL can still be observed to have obvious fluorescence; the test reaction corresponding to the RNA dilution of 1 copy / µL can still be observed to have obvious fluorescence when the reaction in step S2 of Example 3 is for 15 min; and the test reaction corresponding to the RNA dilution of 1 copy / µL can be observed to have strong fluorescence when the reaction in step S2 of Example 3 is for 20 min. Therefore, the optimal reaction time in step S2 of the detection method shown in Example 3 is 15 min, and the minimum detection limit can be up to 1 copy / µL of viral RNA.
[0122] Example 5 Specificity test of the detection method I. Experimental method The RNA of H1N1 subtype avian influenza virus (H1N1 AIV), H3N2 subtype avian influenza virus (H3N2 AIV), H6N6 subtype avian influenza virus (H6N6 AIV), H5N6 subtype avian influenza virus (H5N6 AIV), H7N9 subtype avian influenza virus (H7N9 AIV), H9N2 subtype avian influenza virus (H9N2 AIV), duck Tembusu virus (DTMUV), new duck reovirus (NDRV), chicken infectious bronchitis virus (IBV), and Newcastle disease virus (NDV) was extracted by using the RNA rapid extraction kit of Shanghai Feijie Biotechnology Co., Ltd. (Shanghai Feijie, item number: 220011), and the RNA of each virus was detected according to the detection method shown in Example 3, and the detection results were recorded.
[0123] II. Experimental results The detection results of the RNA of each virus are shown in Table 1. Figure 18 As shown in Table 1, the results show that when the RNA of H1N1, H3N2, H5N6, H6N6, H7N9, and H9N2 subtype avian influenza viruses is detected according to the detection method shown in Example 3, strong fluorescence is displayed under blue light and ultraviolet light irradiation; and when duck Tembusu virus, new duck reovirus, chicken infectious bronchitis virus, and Newcastle disease virus are detected according to the detection method shown in Example 3, no fluorescence is generated under blue light and ultraviolet light irradiation.
[0124] Therefore, the detection method shown in Example 3 can specifically detect avian influenza viruses, and has the advantages of high specificity, high sensitivity, and intuitive and easy-to-read.
[0125] Example 6 Application of RT-ERA-CRISPR / Cas12a detection of avian influenza virus I. Experimental method 40 clinical tissue samples (including 21 samples positive for avian influenza virus and 19 samples negative for avian influenza virus) infected artificially with each subtype of avian influenza virus in Example 5 were used as test samples, H5N6 subtype avian influenza virus (strain S23) RNA was used as a positive control sample, and no RNase water was used as a negative control sample. RNA of each test sample was extracted using an RNA rapid extraction kit (Shanghai Feijie Biotechnology Co., Ltd., item number: 220011), and the RNA of each test sample was divided into two parts. One part of the RNA of each test sample was detected according to the detection method shown in Example 3, and the detection results were recorded.
[0126] The remaining part of the RNA of each test sample was subjected to reverse transcription using an M-MLV Reverse Transcriptase kit (Promega, item number: M1705) to obtain cDNA of each test sample. The sample cDNA was used for clinical sample detection by SYBR Green qPCR, and each sample was repeated 3 times. In the clinical sample detection results by SYBR Green qPCR, Ct value ≤ 35 was judged as positive, and Ct value > 35 or no avian influenza virus cDNA was detected was judged as negative.
[0127] The reaction system of SYBR Green qPCR was as follows: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.2 μL of upstream primer M-F (10 μM, 5'-TTCTAACCGAGGTCGAAAC-3'), 0.2 μL of downstream primer M-R (10 μM, 5'-AAGCGTCTACGCTGCAGTCC-3'), 2 μL of cDNA, and 7.6 μL of no RNase water. The reaction program was as follows: 95℃, 30s; 95℃, 10s, 60℃, 30s, 40 cycles.
[0128] II. Experimental results The detection results of each clinical tissue sample are shown in Table 1. Figure 19 Figure 19 A in Table 1 is the detection result of SYBR Green qPCR, Figure 19 B in Table 1 is the detection result of the detection method shown in Example 3, Figure 19 1-40 in Table 1 represent clinical tissue samples, 41 is a positive control sample, and 42 is a negative control sample. Among the samples 1-40, the clinical samples with "*" marks below the numbers indicate that the identification results are negative. The results show that samples numbered 1-3, 6-9, 14-15, 19-22, 27-29, 33-36, and 39 (a total of 21 samples) were identified as positive by the avian influenza virus RT-ERA-CRISPR / Cas12a detection method, and the remaining 19 samples were all identified as negative, which is consistent with the detection results of the SYBR Green qPCR clinical tissue samples.
[0129] In summary, the positive and negative coincidence rates of the detection method shown in Example 3 and the SYBR Green qPCR method are both 100%, and the detection method shown in Example 3 has the advantages of short time, high specificity, high sensitivity, and intuitive and easy-to-read, and has a wide application prospect in clinical field detection.
[0130] Example 7 A kit for detecting avian influenza virus I. Composition of the kit A kit for detecting avian influenza virus contains an amplification reaction system and a cleavage detection system. The amplification reaction system contains 2 μL of M-ERA-F1 (SEQ ID NO: 5) with a concentration of 50 μM (an added amount of 100 pmol), 2 μL of M-ERA-R1 (SEQ ID NO: 6) with a concentration of 50 μM (an added amount of 100 pmol), 0.02 g of freeze-dried microspheres, and 2 μL of an activator. The freeze-dried microspheres and the activator are both derived from the RT-ERA basic nucleic acid amplification kit (KS303, Senda Gene). The cleavage detection system contains CRISPR / Cas12a enzyme (M0653S, NEB) with a final concentration of 100 nM, 200 nM of crRNA1 (SEQ ID NO: 1, the concentration ratio of CRISPR / Cas12a enzyme to crRNA is 1:2), 1 μM of ssDNA fluorescent probe FAM-L8C-BHQ1 (No. 9 in Table 2), 0.4 U of RNAase inhibitor (R301-01, Vazyme), and 2 μL of buffer buffer (10×CRISPR / Cas12a reaction buffer). The 10×CRISPR / Cas12a reaction buffer contains MgCl2 with a final concentration of 100 mM, KCl with a concentration of 1.2 M, BSA with a concentration of 1 mg / mL, glycerol with a mass concentration of 10%, Tris-HCl with a concentration of 100 mM, and TCEP with a concentration of 1.5 mM, and the pH is 8.5.
[0131] II. Method for using the kit The method for using the kit is as follows: S1. Extracting RNA of the sample to be detected by using RNA rapid extraction kit, mixing the RNA of the sample to be detected and the amplification reaction system in the kit according to the volume ratio of 2:48, and then collecting the amplification product after reaction at 37-50℃ for 15-20 min; S2. Mixing the amplification product obtained in step S1 and the cleavage detection system in the kit according to the volume ratio of 2:18, and then collecting the reaction product after reaction at 37-50℃ for 5-30 min; S3. Observing the reaction product obtained in step S2 under blue light and / or ultraviolet light, and the appearance of fluorescence indicates that the sample to be detected contains avian influenza virus, and the non-appearance of fluorescence indicates that the sample to be detected does not contain avian influenza virus.
[0132] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, but not to limit the protection scope of the present application. For those skilled in the art, on the basis of the above description and ideas, other different forms of changes or variations can also be made, which do not need to be or cannot be exhaustively listed here. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the claims of the present application.
Claims
1. An RT-ERA primer set for detecting avian influenza virus, characterized in that, The RT-ERA primer set contains an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 6, or an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 7 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 8, or an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 9 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:
10.
2. The RT-ERA primer set according to claim 1, characterized in that, The RT-ERA primer set contains an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 5 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:
6.
3. Use of the RT-ERA primer set of any one of claims 1 or 2 in the preparation of a product for detecting avian influenza virus.
4. A RT-ERA-CRISPR / Cas12a composition for detecting avian influenza virus, characterized in that, The RT-ERA primer set of any one of claims 1 or 2 and a crRNA; the nucleotide sequence of the crRNA is as shown in any one of SEQ ID NO: 1 and SEQ ID NO:
2.
5. The RT-ERA-CRISPR / Cas12a composition of claim 4, wherein, The nucleotide sequence of the crRNA is as shown in SEQ ID NO:
1.
6. Use of the RT-ERA-CRISPR / Cas12a composition of any one of claims 4 or 5 in the preparation of a product for detecting avian influenza virus.
7. A kit for detecting avian influenza virus, characterized by comprising the antibody according to claim 1 or 2. The kit contains an amplification reaction system and a cleavage detection system; the amplification reaction system contains the RT-ERA primer set of any one of claims 1 or 2; the cleavage detection system contains a crRNA with a nucleotide sequence as shown in any one of SEQ ID NO: 1 and SEQ ID NO:
2.
8. The kit of claim 7, wherein The cleavage detection system further contains ssDNA1 or ssDNA2; wherein the nucleotide sequence of ssDNA1 is: FAM-CCCCCCCC-BHQ1; the nucleotide sequence of ssDNA2 is as shown in SEQ ID NO:
4.
9. The kit of claim 8, wherein The cleavage detection system further contains ssDNA1.
10. The kit of claim 9, wherein The cleavage detection system further contains a CRISPR / Cas12a reaction buffer; the CRISPR / Cas12a reaction buffer contains MgCl2, KCl, glycerol, BSA, Tris-HCl and / or TCEP.