Application of CEBPZ gene in construction of mouse model with reduced adipose tissue content and construction method of CEBPZ gene
By constructing a CEBPZ gene-specific knockout mouse model, the problem of unsystematic adipose tissue generation mechanism in existing technologies has been solved, achieving a stable reduction in adipose tissue content and providing an experimental platform for drug screening and metabolic disease research.
Patent Information
- Application Number
- CN202511514201.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-22
- Publication Date
- 2026-01-06
AI Technical Summary
The current technology lacks a systematic understanding of the mechanism of adipose tissue formation, which leads to the development of drugs targeting adipose tissue facing problems such as limited targets and insufficient efficacy. Furthermore, the genetic mechanisms of existing animal models are well-defined, making them difficult to use for discovering new regulatory genes or pathways.
By exploring the function of the CEBPZ gene, an adipose-specific knockout mouse model was constructed. The nucleotide sequence of the CEBPZ gene was used to specifically knock out the adipose tissue of mice, thus establishing a mouse model with reduced adipose tissue content. The Cre-loxP system driven by the Adipoq promoter was used to achieve specific reduction of CEBPZ.
A fat tissue-specific CEBPZ knockout mouse model was successfully constructed, achieving a stable reduction in fat content. This model provides clear tissue targeting and phenotypic stability, serving as an ideal experimental tool for studying lipid metabolism abnormalities and drug screening. It simulates pathological processes related to fat tissue developmental defects and evaluates the intervention effects of candidate drugs.
Smart Images

Figure CN121271963A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and medical model technology, and in particular to the application of the CEBPZ gene in constructing a mouse model with reduced adipose tissue content and its construction method. Background Technology
[0002] Currently, the incidence of obesity and related metabolic diseases (such as type 2 diabetes and cardiovascular disease) continues to rise. As a core energy metabolism and endocrine organ, adipose tissue abnormalities or dysfunctions are key risk factors for inducing metabolic disorders.
[0003] Adipocyte formation is regulated by a sophisticated multi-level network: the transcriptional regulatory network centered on PPARγ dominates terminal differentiation of adipocytes. Furthermore, the Wnt / β-catenin pathway inhibits adipocyte formation in its early stages, the BMP / TGF-β pathway exhibits environment-dependent bidirectional regulatory characteristics, and the IGF / insulin pathway participates in regulating adipocyte development by coordinating metabolic reprogramming and cell proliferation. Histone modification dynamics, DNA methylation patterns, and chromatin accessibility together constitute important nodes in the adipocyte formation regulatory network. Non-coding RNAs achieve fine-grained regulation of adipocyte formation through post-transcriptional regulation and chromatin complex assembly.
[0004] However, our understanding of the mechanisms of adipose tissue formation remains unsystematic, leading to limitations in drug development targeting adipose tissue and insufficient therapeutic efficacy. Although various animal models of adipose tissue defects exist, the genetic mechanisms of most models are well-established, making them difficult to use for discovering new regulatory genes or pathways. Therefore, developing animal models with reduced adipose tissue content and well-defined phenotypes but unclear genetic mechanisms is of great significance for advancing research on adipose tissue formation mechanisms and drug screening. Summary of the Invention
[0005] The purpose of this invention is to provide the application of the CEBPZ gene in constructing a mouse model with reduced adipose tissue content and its construction method, thereby addressing the problems existing in the prior art. This invention, by exploring the function of the CEBPZ gene and constructing an adipose-specific knockout mouse model, has a wide range of applications. It can simulate the pathological process of reduced adipose tissue content, help evaluate the effects of candidate drugs on adipose tissue development, and provide an experimental platform for developing therapeutic drugs for adipose tissue-specific metabolic diseases.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides the use of the CEBPZ gene, with the nucleotide sequence shown in SEQ ID NO.1, in any of the following:
[0008] (1) Regulation of mouse adipose tissue content for purposes other than disease diagnosis or treatment;
[0009] (2) Construct a mouse model with reduced adipose tissue content.
[0010] Furthermore, by reducing the expression of the CEBPZ gene in adipose tissue, the adipose tissue content in mice can be reduced.
[0011] The present invention also provides a method for constructing a mouse model with reduced adipose tissue content, comprising the step of specifically knocking out the CEBPZ gene in mouse adipose tissue to obtain adipose-specific CEBPZ gene knockout mice; the adipose-specific CEBPZ gene knockout mice are the mouse model with reduced adipose tissue content.
[0012] The nucleotide sequence of the CEBPZ gene is shown in SEQ ID NO.1.
[0013] Furthermore, the construction method specifically includes the following steps:
[0014] The loxP nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3 were inserted upstream of exon 3 and downstream of exon 4 of the mouse CEBPZ gene, respectively, to construct F0 generation mice containing heterozygous fluxed-CEBPZ / CEBPZ and normal adipoq gene.
[0015] The F0 generation mice containing heterozygous fluxed-CEBPZ / CEBPZ and normal adipoq gene were self-crossed for one generation to obtain homozygous fluxed-CEBPZ / CEBPZ F1 generation mice.
[0016] The F1 generation mice of the homozygous fluxed-CEBPZ / floxed-CEBPZ were crossed with the F0 generation mice of the CEBPZ gene normal but containing the adipoq-Cre / adipoq gene to obtain the F2 generation mice containing heterozygous flowed-CEBPZ / CEBPZ and heterozygous adipoq-Cre / adipoq.
[0017] The F2 generation mice containing heterozygous flowed-CEBPZ / CEBPZ and heterozygous adipoq-Cre / adipoq were backcrossed with the F1 generation mice containing homozygous flowed-CEBPZ / floxed-CEBPZ to obtain the F3 generation mice containing homozygous flowed-CEBPZ / floxed-CEBPZ and heterozygous adipoq-Cre / adipoq, which are the fat-specific CEBPZ gene knockout mice.
[0018] Furthermore, the mice were 57BL / 6 mice.
[0019] The present invention also provides the application of a mouse model with reduced adipose tissue content constructed according to the above construction method in screening drugs for regulating adipose tissue development or treating obesity-related metabolic diseases.
[0020] The present invention also provides an application of a mouse model with reduced adipose tissue content constructed according to the above construction method in the study of the pathogenesis of obesity and related metabolic diseases.
[0021] The present invention also provides the application of a reagent for specifically knocking out the CEBPZ gene in mouse adipose tissue in constructing a mouse model with reduced adipose tissue content, wherein the nucleotide sequence of the CEBPZ gene is shown in SEQ ID NO.1.
[0022] The present invention discloses the following technical effects:
[0023] This invention, through functional validation and model construction, reveals for the first time the crucial role of the CEBPZ gene in regulating adipose tissue content in mammals, and successfully constructs an adipose tissue-specific CEBPZ knockout animal model. This discovery fills a gap in our understanding of the biological function of CEBPZ in the regulation of lipid metabolism and development, providing new targets and mechanistic perspectives for research on related metabolic diseases.
[0024] The adipose tissue-specific CEBPZ gene knockout mouse model (genotype aaBb) constructed in this invention exhibits clear tissue targeting and phenotypic stability. This model utilizes the Adipoq promoter-driven Cre-loxP system to specifically reduce CEBPZ expression in white adipocytes.
[0025] Compared with the littermate control group (genotype aaBB), this model mouse exhibited a stable weight gain trend after weaning, and the significant reduction in adipose tissue content was repeatedly verified in multiple independent families (P < 0.05). This model successfully achieved the effective separation of the two commonly associated phenotypes of "fat content" and "weight", providing an ideal experimental tool for studying simple lipid metabolism abnormalities.
[0026] Based on the above characteristics, this model can serve as a general research platform for functional verification of unknown genes regulating adipose development, and provide an important experimental vehicle for developing next-generation treatment strategies that focus on improving metabolic health rather than simply reducing weight.
[0027] Furthermore, this model has broad application prospects in drug development and pathological mechanism research: it can be used to simulate pathological processes related to adipose tissue development defects, evaluate the intervention effects of candidate drugs on adipose formation and metabolic functions, improve the targeting and efficiency of drug screening, and provide a reliable preclinical experimental platform for developing adipose tissue-specific metabolic disease treatments. Attached Figure Description
[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0029] Figure 1 The results of Western blot analysis of CEBPZ expression levels in various tissues of wild-type C57BL / 6 mice were used; where: M: protein marker, BAT: brown adipose tissue, GAT: periepididymal adipose tissue, SAT: subcutaneous adipose tissue, and GAPDH was used as an internal control.
[0030] Figure 2 Genotypic characteristics and nomenclature of fluxed-CEBPZ and adipoq-Cre mice;
[0031] Figure 3 A diagram illustrating the breeding protocol for adipose tissue-specific knockout CEBPZ mice using adipoq-Cre tool mice and fluxed-CEBPZ mice;
[0032] Figure 4 Genotyping diagrams of mice carrying the fluxed-CEBPZ genotype were obtained using PCR technology.
[0033] Figure 5 Genotyping diagram of adipoq-Cre tool mice using PCR technology;
[0034] Figure 6 The image shows the results of PCR analysis of CEBPZ gene editing in various tissues of adipose tissue-specific knockout CEBPZ mice (genotype aaBb) and their control mice (genotype aaBB) using primer set Lox-F1 / Lox-R2; where BAT: brown adipose tissue, GAT: periepididymal adipose tissue, and SAT: subcutaneous adipose tissue.
[0035] Figure 7The image shows the results of PCR analysis of CEBPZ gene editing in various tissues of adipose tissue-specific knockout CEBPZ mice (genotype aaBb) and their control mice (genotype aaBB) using primer group Lox-F3 / Lox-R3; where BAT: brown adipose tissue, GAT: peritesticular adipose tissue, and SAT: subcutaneous adipose tissue.
[0036] Figure 8 The figure shows the expression of CEBPZ in various tissues of adipose tissue-specific knockout CEBPZ mice (genotype aaBb) and their control mice (genotype aaBB) using Western blot technology; where BAT: brown adipose tissue, GAT: periepididymal adipose tissue, SAT: subcutaneous adipose tissue; GAPDH was used as an internal control.
[0037] Figure 9 The body weight measurements of adipose tissue-specific knockout CEBPZ mice (genotype aaBb) and their littermate control mice (genotype aaBB) are shown by sex and age.
[0038] Figure 10 A genotypic summary of body weight data measured before 120 days of age for adipose tissue-specific knockout CEBPZ mice (genotype aaBb) and their littermate control mice (genotype aaBB) from multiple families.
[0039] Figure 11 A genotypic summary of body weight data measured before 85 days of age in adipose tissue-specific CEBPZ knockout mice (aaBb) and their littermate control group (aaBB) from multiple families during their growth period.
[0040] Figure 12 A summary diagram showing the weight data of adipose tissue-specific knockout CEBPZ mice (genotype aaBb) from multiple families and their littermate control mice (genotype aaBB) at 85-12 days of age (adulthood);
[0041] Figure 13 Representative anatomical images for direct comparison of brown adipose tissue-specific CEBPZ knockout mice (aaBb) from family 2 and their littermate control group (aaBB) after sacrifice, including brown adipose tissue (BAT), epididymal fat (GAT), subcutaneous fat (SAT), testis, brain, and heart volume.
[0042] Figure 14A graph showing the analysis of brown adipose tissue-specific CEBPZ knockout mice (aaBb) and their littermate control mice (aaBB) from four families at 120 days of age (n=16). In this graph, A is a kernel density plot with Duncan's multiple test to show the overall distribution of the data; B is a box plot with T test to show the specific situation of each family.
[0043] Figure 15 A graph showing the data analysis of brown adipose tissue-specific knockout CEBPZ mice (genotype aaBb) and their littermate control mice (genotype aaBB) at 120 days of age (n=16); where A is a kernel density plot with Duncan's multiple test to show the overall distribution of the data; B is a box plot with T test to show the specific situation of each family.
[0044] Figure 16 A graph showing the subcutaneous white adipose tissue weight data of CEBPZ knockout mice (aaBb) and their littermate control mice (aaBB) from four families at 120 days of age (n=16). In the figure, A is a kernel density plot with Duncan's multiple test to show the overall distribution of the data; B is a box plot with T test to show the specific situation of each family.
[0045] Figure 17 This is a data analysis of subcutaneous white fat percentage (subcutaneous white fat weight / body weight) in adipose tissue-specific CEBPZ knockout mice (aaBb) and their littermate control mice (aaBB) from four families at 120 days of age (n=16). In this figure, A is a kernel density plot with Duncan's multiple test to show the overall distribution of the data; B is a box plot with T test to show the specific situation of each family.
[0046] Figure 18 Figure 1 shows the weight data of periepididymal white adipose tissue in four families of 120-day-old adipose tissue-specific CEBPZ knockout mice (aaBb) and their littermate control mice (aaBB) (n=16). In Figure 2, A shows the overall distribution of data with a kernel density plot with Duncan's multiple test; B shows the specific situation of each family with a box plot with T test.
[0047] Figure 19 Figure 1 (n=16) shows the epididymal white fat percentage (epididymal white fat weight / body weight) of adipose tissue-specific CEBPZ knockout mice (aaBb) and their littermate control mice (aaBB) from four families at 120 days of age. In Figure 2, A shows the overall distribution of data using a kernel density plot with Duncan's multiple test; B shows the specific situation of each family using a box plot with T test. Detailed Implementation
[0048] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0049] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0050] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0051] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0052] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0053] Example 1: Analysis of CEBPZ expression patterns in multiple mouse tissues
[0054] 1. Tissue sampling
[0055] Eight-week-old wild-type male C57BL / 6 mice were euthanized by cervical dislocation. Immediately afterward, the hearts were perfused with pre-chilled PBS (containing 1 mM EDTA, pH 7.4) to remove residual blood. Dissection was performed rapidly in priority order (brain, eyes, brown adipose tissue → testes and epididymal adipose tissue → muscle tissue → large intestine) to avoid RNase and protease degradation. Tissue blocks (approximately 50-100 mg) were placed in pre-chilled RNase-free EP tubes, flash-frozen in liquid nitrogen, and stored at -80°C.
[0056] 2. Tissue homogenization
[0057] Add 500 μL of RIPA lysis buffer (containing 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM PMSF, protease inhibitor, and phosphatase inhibitor) to every 100 mg of tissue. First, cut the tissue into small pieces, then add grinding beads to assist in the lysis. Homogenize the tissue using a tissue homogenizer (6500 rpm, 2 x 30 seconds, with 10-second ice bath intervals) to avoid heat generation.
[0058] 3. Protein extraction and BCA concentration determination
[0059] Centrifuge at 12,000 ×g for 15 minutes at 4℃, collect the supernatant, and determine the protein concentration using the BCA method (standard curve R). 2 >0.995). All samples were adjusted to a uniform concentration (2 μg / μL), and 5× buffer (containing 5% β-mercaptoethanol) was added. The samples were then denatured at 95°C for 10 minutes.
[0060] 4. Western Blot
[0061] Prepare an 8% separating gel (5.5 mL ddH₂O, 3.2 mL 30% acrylamide (Acr-Bis 29:1), 3 mL Tris-HCl (pH=8.8, 1.5 mol / L), 120 μL 10% SDS, 120 μL 10% AP, and 7.2 μL TEMED) and a stacking gel (6.8 mL ddH₂O, 1.7 mL 30% acrylamide, 1.25 mL Tris-HCl (pH=6.8, 1 mol / L), 100 μL 10% SDS, 100 μL 10% AP, and 10 μL TEMED). After preparing the gels, pour in the electrophoresis buffer, add the sample, and perform electrophoresis at 70 V for 1 hour, followed by 120 V for 1 hour. After electrophoresis, transfer the membrane at a constant current of 300 mA for 1 hour. After transfer, block with 5% BSA at room temperature for 2 hours. After blocking, the membrane was incubated with primary antibody using rabbit anti-CEBPZ (Proteintech 25612-1-AP) at a working concentration of 1:1000; internal control: recombinant anti-GAPDH antibody (HRP conjugated) at a working concentration of 1:1000, incubated overnight. After primary antibody incubation, the membrane was washed three times with TBST for 10 min each time, with shaking at 60 rpm. After washing, the membrane was incubated with HRP-goat anti-rabbit IgG (Servicebio GB23303) at a concentration of 1:5000, with shaking at 60 rpm for 1 h at room temperature. After secondary antibody incubation, the membrane was washed three times with TBST for 10 min each time, with shaking at 60 rpm. After washing, the membrane was exposed to ECL chemiluminescent substrate (Biosharp, BL520A) at a ratio of A:B = 1:1, freshly prepared and used immediately.
[0062] The results are as follows Figure 1 As shown, CEBPZ was significantly expressed in the large intestine, brain, testes, muscles, brown adipose tissue, peritesticular fat, subcutaneous fat, and eyes, providing a theoretical basis for subsequent specific knockout of CEBPZ in adipose tissue.
[0063]
[0064] Example 2 Breeding of fat-specific CEBPZ knockout mice and their littermate control group
[0065] 1. Program design and genotype definition
[0066] The adipoq gene encodes adiponectin, a protein hormone specifically secreted by adipocytes that regulates glucose metabolism, fatty acid oxidation, and energy homeostasis. The adipoq-Cre mouse is a genetically engineered tool mouse that achieves regulation of adipose tissue-specific genes by expressing Cre recombinase under the drive of the adipoq gene promoter. The mouse CEBPZ gene is located on chromosome 17, and the mouse adipoq gene is located on chromosome 9; according to Mendel's laws of inheritance, mice carrying both the fluxed-CEBPZ and adipoq-Cre genotypes can be obtained by crossing mice with the fluxed-CEBPZ genotype with mice carrying the adipoq-Cre genotype. Figure 2 As shown, for the sake of simplicity, the normal CEBPZ gene in wild-type mice is defined as allele A, and the fluxed-CEBPZ genotype obtained through genetic engineering is defined as allele a; the normal wild-type adipoq gene is defined as B, and the adipoq-Cre genotype is defined as b.
[0067] 2. Breeding Program
[0068] Breeding programs such as Figure 3 As shown, Cyagen Biosciences was commissioned to insert loxP sequences with the same direction upstream of exon 3 and downstream of exon 4 of CEBPZ in C57BL / 6 mice (the nucleotide sequence inserted upstream of exon 3 of CEBPZ is shown in SEQ ID NO. 2, and the nucleotide sequence inserted downstream of exon 4 is shown in SEQ ID NO. 3) to construct F0 generation C57BL / 6 mice (AaBB) containing heterozygous fluxed-CEBPZ / CEBPZ and with normal adipoq gene. Figure 2 According to the breeding program ( Figure 3F0 generation C57BL / 6 mice (AaBB) were self-crossed for one generation to obtain homozygous fluxed-CEBPZ / floxed-CEBPZ F1 generation mice (aaBB). These were then crossed with F0 generation C57BL / 6 mice (AABb) that had normal CEBPZ genes but contained the adipoq-Cre / adipoq gene to obtain F2 generation mice (floxed-CEBPZ / CEBPZ; adipoq-Cre / adipoq) (AaBb). These were then backcrossed with F1 generation mice with the aaBB genotype to obtain F3 generation mice with genotypes aaBb and aaBB. The F3 generation mice with genotypes aaBb and aaBB were then divided into multiple groups according to family lineage for crossbreeding to produce offspring with both aaBb and aaBB genotypes. AaBb mice were adipose tissue-specific gene knockout mice, and their littermates of the same sex and type, aaBB mice, were used as littermate control groups.
[0069] SEQ ID NO.2: CCGTGGTTACCGGATCCACGTAAACGGCCACAAGTTCGAATAACTTCGTATAGCATACATTATACGAAGTTA;
[0070] SEQ ID NO. 3: GGATCCGGTACCGTGGATTCGGACCAGTCTGACATAACTTCGTATAATGTATGCTATACGAAGTTAT.
[0071] Example 3: Method for identifying mouse genotypes
[0072] 1. Extraction of mouse tail genome
[0073] Take mice four weeks after birth whose genotypes are to be tested, and cut off about 0.5 cm of their tails. Mince the tails (or grind them with liquid nitrogen) and transfer them to a 1.5 mL centrifuge tube. Add 500 μL of lysis buffer (containing proteinase K) and incubate at 55–60°C overnight (or at least 4–6 hours) until the tissue is completely lysed. Ensure proteinase K activity (avoid high-temperature inactivation), as incomplete lysis will result in low DNA yield. Add an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1), vortex to mix, and centrifuge at 12,000 rpm for 10 minutes. Carefully transfer the supernatant (aqueous phase) to a new tube, avoiding aspiration of the intermediate protein layer. Repeat the phenol-chloroform extraction 1–2 times to improve purity. Add 1 / 10 volume of 3 M NaAc (pH 5.2) and 2 volumes of pre-chilled anhydrous ethanol, and gently invert to mix. A white flocculent DNA precipitate will appear; centrifuge at 12,000 rpm for 10 minutes and collect the precipitate. Wash the precipitate twice with 70% ethanol to remove salt, and air dry at room temperature. Dissolve in 50–100 μL TE buffer or sterile water as a template for PCR.
[0074] 2. Reagent preparation
[0075] 50×TAE: Add 242 g Tris base to 800 mL of deionized water and stir to dissolve; then slowly add 57.1 mL of glacial acetic acid (corrosive, must be handled in a fume hood). Finally, add 100 mL of 0.5 M EDTA (pH 8.0) and stir to mix well. Make up to 1 L with deionized water and store at room temperature. Dilute 50 times with distilled water before use.
[0076] 10× Loading buffer: 60% glycerol, 50 mM EDTA, bromophenol blue (0.05%-0.1%), and xylene cyanol FF (0.05%-0.1%). Dilute with PCR products 1:9 before use.
[0077] Preparation of EB (ethidium bromide) staining solution: Weigh 100 mg of EB powder and dissolve it in 10 mL of ultrapure water (or TE buffer). Stir in the dark until completely dissolved (a 37°C water bath can be used to aid dissolution). Store at 4°C in the dark.
[0078] 3. PCR reaction
[0079] PCR reaction systems were prepared according to the systems shown in Table 2 using 20 μL and 0.5 μL pipettes. Lox-F1 / Lox-R1 or Lox-F2 / Lox-R2 primers were used to identify the fluxed-CEBPZ genotype; Lox-F1 / Lox-R2 and Lox-F3 / Lox-R3 primers were used to identify CEBPZ gene editing; and CRE_F and CRE_R primers were used to identify adipoq-Cre (see Table 1).
[0080] Table 1 Primers used for mouse genotyping
[0081]
[0082] Table 2. 20 μL PCR reaction system for a single sample
[0083]
[0084] Place the 0.2 mL EP tube containing the reaction system onto the PCR instrument and set the PCR instrument amplification program as follows: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min, and store at 4℃.
[0085] After the reaction is complete, turn off the PCR instrument and remove it to a 4°C refrigerator for later use.
[0086] 4. Agarose gel electrophoresis
[0087] Weigh 0.6 g of agarose and place it in an Erlenmeyer flask. Pour in 40 mL of 1×TAE solution, cover with aluminum foil to prevent boiling over, and cover with a damp gauze. Microwave for 5 minutes until the agarose melts. After slightly cooling, add 3 μL of EB nucleic acid dye, mix well, and pour into a template to prepare the gel. Once the gel has completely cooled and solidified, remove it and place it in an electrophoresis tank containing 1×TAE electrophoresis buffer. Add samples one well at a time. After sample loading, turn on the power and perform DNA electrophoresis. When the blue band displayed in the loading buffer has reached halfway, remove the gel and observe the band pattern in the gel electrophoresis program system. An example of floxed-CEBPZ mouse genotyping results is shown below. Figure 4 As shown, an example of adipoq-Cre mouse genotyping results is as follows: Figure 5 As shown, the genotype results of the corresponding mice were obtained by combining the two subtypes.
[0088] Example 4: Weight determination of CEBPZ adipose tissue knockout mice
[0089] 1. Western blot analysis of CEBPZ expression levels in adipose tissue of CEBPZ knockout mice and control mice.
[0090] Eight-week-old male C57BL / 6 mice (genotype aaBb) with CEBPZ knockout and control mice (genotype aaBB) were sacrificed by cervical dislocation. Brain, subcutaneous fat, peritesticular fat, brown adipose tissue, muscle tissue, and testicular tissue were collected. Tissue blocks (approximately 50-100 mg) were placed in pre-chilled RNase-free EP tubes, flash-frozen in liquid nitrogen, and stored at -80°C. 500 μL of RIPA lysis buffer was added to every 100 mg of tissue. The tissue was first minced and then homogenized with grinding beads to aid in disruption. Homogenization was performed using a tissue homogenizer (6500 rpm, 2 × 30 seconds, 10-second ice bath intervals) to avoid heat generation. Genomic DNA and total protein were extracted from the tissues. PCR analysis of CEBPZ gene editing in these tissues was performed using primer sets Lox-F1 / Lox-R2 and Lox-F3 / Lox-R3, respectively. Results showed that... Figure 6 As shown, significant editing of the CEBPZ gene was observed in the brain, testes, muscles, peritesticular adipose tissue, and subcutaneous adipose tissue of adipose tissue-specific knockout CEBPZ mice, but this phenomenon was not observed in the control group, suggesting that the target site of adipoq-Cre mice is not limited to white adipose tissue. Furthermore, as... Figure 7As shown, the wild-type CEBPZ gene could be detected in all tissues in the control group. The unedited wild-type CEBPZ could still be detected in the brain, testis, muscle, epididymal peri-fat and subcutaneous fat of the adipose tissue-specific knockout CEBPZ mice, indicating that its gene editing efficiency did not reach 100%.
[0091] Furthermore, the expression pattern of CEBPZ in these tissues of the two mouse species was analyzed using Western blot, and the results are as follows: Figure 8 The results showed that in adipose tissue-specific knockout mice, the expression levels of CEBPZ in subcutaneous and epididymal adipose tissue and in the testes were significantly lower than those in control mice. However, the expression levels of CEBPZ in the liver and brown adipose tissue were not significantly reduced. These results indicate that the expression level of CEBPZ in the white adipose tissue of adipose tissue-specific knockout CEBPZ mice is lower than that in control mice, and the adipose tissue-specific knockout CEBPZ gene mouse has been successfully constructed.
[0092] 2. Mouse body weight determination
[0093] The obtained aaBB and aaBb mice were divided into multiple families for breeding. After weaning at the end of the third week, the offspring of each family were separated into different cages according to sex. Genotyping was then performed. When mice of the same sex exhibited both aaBB and aaBb genotypes, all of them were placed in a littermate control group and housed together. Body weight was measured weekly, and the measured weight data are as follows: Figure 9 As shown, the Shapiro-Wilk test indicates that the data do not conform to a normal distribution. Nonparametric tests were used to analyze the correlation between body weight and genotype. After controlling for age, sex, and family history, the results were... Figure 10 The results showed no significant correlation between overall mouse body weight measured at multiple time points within 120 days of age and the two genotypes (H = 1.4355, P = 0.151). Using 85 days of age as the dividing point for adulthood, the mouse developmental stage was divided into two phases: growth and adulthood. Correlation analysis was performed on body weight and genotype at multiple time points for both growth-stage (under 85 days of age) and adult (over 85 days of age) mice. The results are as follows: Figure 11 As shown, after controlling for age, sex, and pedigree factors, the body weight of growing mice (under 85 days old) was significantly correlated with both genotypes (H = 2.3059, P = 0.02111); the body weight of aaBb genotype mice (under 85 days old) was higher than that of their littermate control group, indicating that after knocking out CEBPZ in adipose tissue, the body weight of growing mice was higher than that of their littermate control group. However, as... Figure 12As shown, there was no significant correlation between body weight and genotype in adult mice (85-120 days old) (H=−0.30807, P=0.758).
[0094] 3. Determination of adipose tissue content in mice
[0095] At 120 days of age, male mice were euthanized by cervical dislocation. Brown fat, subcutaneous fat, periepididymal fat, brain, and testes were dissected and their weights were measured. The Shapiro-Wilk test was used to analyze whether the data conformed to a normal distribution. Data that conformed to a normal distribution were analyzed using ANOVA, while data that did not conform to a normal distribution were analyzed using Aligned Rank Transform (ART) ANOVA. Considering family pedigree, the correlation between tissue weight, the ratio of tissue weight to body weight, and genotype was studied. The results are shown in Table 3. The weight of brown fat, subcutaneous fat, periepididymal fat, brown fat percentage, subcutaneous fat percentage, and periepididymal fat percentage in mice were significantly correlated with both genotypes (P<0.05).
[0096] Table 3. Correlation analysis between mouse tissue weight and proportion and genotype
[0097]
[0098] Further data analysis, such as Figures 13-19 As shown, the brown fat weight, subcutaneous fat weight, and epididymal fat weight, as well as their ratios to body weight, in male mice with the aaBb genotype were significantly lower than those in littermate control mice with the aaBB genotype (P<0.05). Figure 13 As shown in Table 3, there were no significant differences in brain, testis, and heart weights and their ratios to body weight between aaBb genotype male mice and their littermate control groups (P>0.05). This indicates that, compared with the littermate control group, adipose tissue-specific knockout of the CEBPZ gene specifically reduced the adipose tissue content in mice.
[0099] In summary, this invention demonstrates that knocking out the CEBPZ gene specifically in adipose tissue can effectively reduce fat content in mice, and the model phenotype is stable, showing consistent differences across multiple families.
[0100] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Use of a CEBPZ gene having a nucleotide sequence as shown in SEQ ID NO. 1 in any of the following: (1) regulating fat content in mice for non-disease diagnosis or treatment purposes; or (2) constructing a mouse model with reduced fat content.
2. Use according to claim 1, characterized in that, Fat content in mice can be reduced by reducing expression of the CEBPZ gene in adipose tissue.
3. A method for constructing a mouse model with reduced fat tissue content, characterized by, The method comprises the steps of specifically knocking out the CEBPZ gene in adipose tissue of mice to obtain a fat-specific CEBPZ gene knockout mouse, wherein the fat-specific CEBPZ gene knockout mouse is the mouse model with reduced fat content. The nucleotide sequence of the CEBPZ gene is as shown in SEQ ID NO.
1.
4. The construction method according to claim 3, characterized in that, The construction method specifically comprises the following steps: a loxP sequence having a nucleotide sequence as shown in SEQ ID NO. 2 and SEQ ID NO. 3 is inserted upstream of the 3rd exon and downstream of the 4th exon of the mouse CEBPZ gene, respectively, to construct an F0 generation mouse containing a hybrid floxed-CEBPZ / CEBPZ and a normal adipoq gene; the F0 generation mouse containing the hybrid floxed-CEBPZ / CEBPZ and the normal adipoq gene is self-crossed to obtain an F1 generation mouse of a homozygous floxed-CEBPZ / floxed-CEBPZ; the F1 generation mouse of the homozygous floxed-CEBPZ / floxed-CEBPZ is crossbred with an F0 generation mouse having a normal CEBPZ gene but containing an adipoq-Cre / adipoq gene to obtain an F2 generation mouse containing a hybrid flowed-CEBPZ / CEBPZ and a hybrid adipoq-Cre / adipoq; the F2 generation mouse containing the hybrid flowed-CEBPZ / CEBPZ and the hybrid adipoq-Cre / adipoq is backcrossed with the F1 generation mouse of the homozygous floxed-CEBPZ / floxed-CEBPZ to obtain an F3 generation mouse containing a homozygous floxed-CEBPZ / floxed-CEBPZ and a hybrid adipoq-Cre / adipoq, which is the fat-specific CEBPZ gene knockout mouse.
5. The construction method of claim 1, wherein, The mouse is a 57BL / 6 mouse.
6. Use of a mouse model with reduced fat content constructed by the construction method according to any one of claims 3-5 in screening drugs for treating adipose tissue formation disorders or obesity-related metabolic diseases.
7. Use of a mouse model with reduced fat content constructed by the construction method according to any one of claims 3-5 in studying the pathogenesis of adipose tissue formation disorders, obesity and related metabolic diseases.
8. Use of a reagent for specific knockout of the CEBPZ gene in mouse adipose tissue in the construction of a mouse model with reduced adipose tissue content, characterized in that, The nucleotide sequence of the CEBPZ gene is as shown in SEQ ID NO. 1.