A pharmaceutical composition for protecting intestinal injury caused by chemotherapy and use thereof

Abstract

The application provides a pharmaceutical composition for protecting intestinal injury caused by chemotherapy and use, and belongs to the field of medicines. The application also provides a pharmaceutical composition for protecting tight junction injury of intestinal mucosa caused by chemotherapy, which is prepared from raw medicinal materials in the following proportions by weight: 1-3 parts of astragalus polysaccharide and 1-3 parts of sanguisorba officinalis saponin I. The astragalus polysaccharide combined with the sanguisorba officinalis saponin I can not only improve the immunity of the body after chemotherapy, but also protect the intestinal mucosa injury caused by intestinal chemotherapy drugs, and solves the problem that there is no specific drug for intestinal injury after chemotherapy on the market. The drug efficacy test proves that the astragalus polysaccharide combined with the sanguisorba officinalis saponin I has a synergistic effect on protecting the tight junction injury of intestinal mucosa caused by chemotherapy. The composition of the application can protect the intestinal injury of pets caused by chemotherapy or diarrhea of young animals, maintain the integrity of the intestinal tissue morphology and structure, enhance the immunity of young animals, reduce economic losses, and reduce the use of antibiotics.

Description

TECHNICAL FIELD

[0001] The present application relates to a pharmaceutical composition for protecting intestinal injury caused by chemotherapy and use thereof, and belongs to the field of medicine. BACKGROUND

[0002] Intestinal mucosal barrier injury is a key gastrointestinal reaction during chemotherapy in tumor patients. Studies have shown that the integrity of the intestinal barrier depends on the tight junction between epithelial cells, and in the pathological state of chemotherapy, drugs such as 5-FU can increase the apoptosis of intestinal epithelial cells and destroy the expression and distribution of tight junction proteins, leading to intestinal mucosal barrier dysfunction, and further causing symptoms such as diarrhea, ulcer, and hematochezia. This not only limits the clinical use of chemotherapy drugs, but also seriously threatens the quality of life and overall survival of tumor patients. Modern medicine mainly uses loperamide and other antidiarrheal drugs for symptomatic treatment, and the curative effect is single, and the side effects are obvious after long-term use. Therefore, exploring drugs that can enhance the tight junction of intestinal mucosa and maintain the function of intestinal mucosal barrier is urgent to prevent and treat chemotherapy-induced adverse reactions. In recent years, traditional Chinese medicine compounds and active ingredients have shown outstanding advantages in preventing and treating chemotherapy-induced intestinal mucosal injury.

[0003] The overall incidence of adverse reactions in dogs treated with chemotherapy was 69.8%, and intestinal injury was one of the core adverse reactions. The overall incidence of adverse reactions in cats treated with chemotherapy was 52.4%. Gastrointestinal reactions were common toxic reactions in cats after epirubicin chemotherapy, and 36% of the cats had related symptoms. The incidence of intestinal perforation after chemotherapy was as high as 17%. In view of the above adverse reactions, there is no specific drug in veterinary clinics at present, and montmorillonite powder, metronidazole, loperamide and other drugs are generally used for treatment, but cats have poor tolerance to metronidazole, loperamide and other drugs. In recent years, traditional Chinese medicine extracts such as astragalus polysaccharide and curcumin have been added to pet food to treat intestinal adverse reactions in pets after chemotherapy, and have achieved certain therapeutic effect.

[0004] Diarrhea in young animals, especially weaned animals, is an important challenge faced by the breeding industry, not only causing huge economic losses, but also exacerbating the risk of bacterial drug resistance due to the overuse of antibiotics during the treatment process for a long time. Drug-resistant strains are transmitted to humans through the food chain and the environment, posing a great threat to public health safety, and drug residues affect food safety. Under the background of "antibiotic ban and reduction" in 2020, the incidence and mortality of diarrhea in young animals have increased explosively, and the breeding end urgently needs the support of green alternative antibiotic products. In recent years, Chinese herbal medicine products have been increasingly used in breeding production. Studies have shown that Chinese herbal medicine can regulate intestinal microbial balance, maintain the integrity of intestinal morphological structure, promote the ability to digest and absorb nutrients, and inhibit or kill pathogenic bacteria, thereby promoting the healthy and rapid growth of animals.

[0005] Astragalus polysaccharide (APS) is the main active component of Chinese medicine Huangqi, which has immunomodulatory, antioxidant, anti-inflammatory and other pharmacological effects. Studies have shown that APS can reduce the diarrhea symptoms of acute enteritis mice, which may be related to the protective effect of increasing the expression levels of tight junction proteins ZO-1, Occludin and Claudin-1 on intestinal injury. Ziyu-glycoside I (ZGI) is the main active component of Chinese medicine Disyru, which has anti-inflammatory, detumescence and anti-tumor and other pharmacological effects. In cell experiments, it was found that Ziyu-glycoside I can significantly increase the expression levels of Occludin, Claudin-1 and ZO-1 tight junction proteins in colon Caco-2 cells, and has a protective effect on cell connection. There is no literature report on the combination of the two. SUMMARY

[0006] The technical scheme of the present application provides a drug composition for protecting intestinal injury caused by chemotherapy and its use, and also provides the use of astragalus polysaccharide and ziyu-glycoside I in preparing a drug for protecting intestinal injury caused by chemotherapy.

[0007] The present application provides the use of astragalus polysaccharide and ziyu-glycoside I in preparing a drug for protecting intestinal injury caused by chemotherapy, and the weight ratio of astragalus polysaccharide and ziyu-glycoside I is (1-3) :(1-3).

[0008] The drug has immune enhancing effect or can improve the damage of intestinal tight junction by inhibiting the ERK / MAPK signal pathway.

[0009] Preferably, the weight ratio of astragalus polysaccharide and ziyu-glycoside I is 1:1.

[0010] The present application provides a drug composition for protecting intestinal injury caused by chemotherapy, which is prepared from raw materials with the following weight ratio:

[0011] Astragalus polysaccharide 1-3 parts, ziyu-glycoside I 1-3 parts;

[0012] The present application provides a drug composition for protecting intestinal injury caused by chemotherapy, which is prepared from raw materials with the following weight ratio:

[0013] Astragalus polysaccharide 1 part, ziyu-glycoside I 1 part.

[0014] The present application provides a drug composition for protecting intestinal injury caused by chemotherapy, which is prepared from raw materials with the following weight ratio:

[0015] The oral preparation is tablet, capsule, pill, oral liquid, granule.

[0016] The application also provides use of the pharmaceutical composition in preparation of a medicine for protecting intestinal injury caused by chemotherapy, or in preparation of a traditional Chinese veterinary medicine for protecting pets from intestinal injury caused by chemotherapy or diarrhea of young animals.

[0017] The medicine is a medicine with immune enhancement effect.

[0018] The application proves that, compared with APS or ZGI alone, the combination of the two can more effectively improve the infiltration of inflammatory cells in the intestinal epithelium of mice and the atrophy of intestinal villi, and relieve the intestinal toxicity caused by chemotherapy.

[0019] The mechanism of intestinal mucosal tight junction injury caused by chemotherapy is complex, and the abnormal activation of extracellular regulated protein kinase (ERK) / mitogen-activated protein kinase (MAPK) signaling pathway is considered to be an important driving factor for the development and aggravation of the disease. Activation of the ERK / MAPK signaling pathway related regulatory kinase can produce a Ras-Raf-MEK-ERK signal cascade. Qu et al. found that inhibiting the expression level of ERK and other proteins in the MAPK signaling pathway can increase the expression of tight junction proteins ZO-1, Occludin and Muc2 in the colon of the colonitis model mice, thereby helping to restore the intestinal epithelial mucosal barrier function. Zhai et al. pointed out that down-regulating the MEK / ERK pathway promotes the expression of ZO-1, Claudin-1 and Occludin proteins in intestinal epithelial cells, and enhances the barrier function of intestinal epithelial cells. It is thus confirmed that targeted inhibition of the ERK / MAPK signaling pathway promotes the expression of intestinal tight junction proteins, providing a potential entry point for preventing and treating chemotherapy-induced intestinal mucosal barrier injury. Based on the ERK / MAPK signaling pathway, the application explores the protective effect and mechanism of APS combined with ZGI on 5-FU-induced intestinal mucosal tight junction injury model mice, in order to provide a new treatment strategy and theoretical basis for chemotherapy-induced intestinal mucosal barrier damage.

[0020] Modern medicine mainly uses loperamide and other antidiarrheal drugs for symptomatic treatment, and the curative effect is single, and the side effects are obvious after long-term use. Therefore, it is urgent to explore drugs that can enhance the intestinal mucosal tight junction and maintain the function of the intestinal mucosal barrier for preventing and treating chemotherapy-induced intestinal adverse reactions.

[0021] The application has the following beneficial effects:

[0022] The astragalus polysaccharide and sanguisorba officinalis saponin I of the application can not only improve the immunity of the body after chemotherapy, but also protect the intestinal mucosa from damage caused by chemotherapy drugs, solve the problem that there is no specific drug for intestinal damage after chemotherapy on the market, and prove that the astragalus polysaccharide and sanguisorba officinalis saponin I have a synergistic effect in protecting the intestinal mucosa from damage caused by chemotherapy. The composition of the application can protect the intestinal damage caused by chemotherapy of pets or diarrhea of young animals, maintain the integrity of the intestinal tissue morphology and structure, enhance the immunity of young animals, reduce economic losses, and reduce the use of antibiotics. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Effects of the same dose of drugs alone and different proportions of drugs on the pathological changes of ileum tissues of mice after chemotherapy;

[0024] Figure 2 Effects on the pathological structure of ileum tissues of mice after chemotherapy (representative pathological pictures of each group);

[0025] Figure 3 Effects on the pathological structure of ileum tissues of mice after chemotherapy (pathological score results);

[0026] Figure 4 Effects on the ultrastructure of ileum tissues of mice after chemotherapy (transmission electron microscopy, x10000, bar=500 nm) (intestinal mucosa epithelial microvilli (yellow arrow); tight junction (red arrow); mitochondria (green arrow); endoplasmic reticulum (gray arrow); mucosa layer goblet cell (purple arrow); lipid droplet (blue arrow); autophagosome (black arrow); mucosa epithelial cell desmosome (orange arrow));

[0027] Figure 5 Effects of APS+ZGI on the mRNA expression of Occludin, Claudin-1 / 2 / 6, ZO-1 and Cingulin in ileum of mice after chemotherapy;

[0028] Figure 6 Western blotting was used to detect Occludin, ZO-1, RAS, RAF and p-ERK (A). The expression levels of Occludin, ZO-1, RAS, RAF and p-ERK proteins (B-F). DETAILED DESCRIPTION

[0029] The astragalus polysaccharide and sanguisorba officinalis saponin I used in the application are purchased from Chengdu Desit Biotechnology Co., Ltd., and the batch numbers are DSTDH010901 and DST230407-033, respectively.

[0030] Example 1 Preparation of the drug composition of the application

[0031] Take 100 mg of Astragalus polysaccharide and 100 mg of Sanguisorba officinalis saponin I, mix, add starch, granulate, press into tablets, and obtain tablets.

[0032] The beneficial effects of the present application are demonstrated by the following pharmacodynamic tests.

[0033] Test Example 1: Comparative test of the present application drug alone and different proportions of compatibility

[0034] The male mice were divided into 9 groups, namely the model group, the control group, the Astragalus polysaccharide 200 mg / kg group, the Sanguisorba officinalis saponin I 200 mg / kg group, the Astragalus polysaccharide + Sanguisorba officinalis saponin I (100 mg / kg + 100 mg / kg) group, the Astragalus polysaccharide + Sanguisorba officinalis saponin I (50 mg / kg + 150 mg / kg) group, the Astragalus polysaccharide + Sanguisorba officinalis saponin I (25 mg / kg + 175 mg / kg) group, the Astragalus polysaccharide + Sanguisorba officinalis saponin I (175 mg / kg + 25 mg / kg) group, the Astragalus polysaccharide + Sanguisorba officinalis saponin I (150 mg / kg + 50 mg / kg) group. Except that the model group and the control group were given the same amount of 0.5% CMC-Na, the rest of the groups were given the corresponding drugs according to 0.2 mL / 10 g by gavage, continuously for two weeks. From the 11th day of gavage, the control group was injected with normal saline intraperitoneally, and the rest of the groups were injected with 5-fluorouracil (5-FU) 120 mg / kg intraperitoneally according to 0.1 mL / 10 g, continuously for 4 days. The mice were sacrificed by cervical dislocation the day after the modeling was completed, and the thymus and spleen were weighed and the organ index was calculated; the ileum was fixed, dehydrated, paraffin-embedded, sectioned, HE stained, and observed under a light microscope for pathological changes.

[0035] 1. Effect on organ index test

[0036] As shown in Table 1, chemotherapy can damage the immune function of the body. Compared with the control group, the thymus and spleen indices of the model group mice decreased; gavage of Astragalus polysaccharide (APS) or Sanguisorba officinalis saponin (ZGI) alone had no significant effect on the thymus index and spleen index of mice after chemotherapy; gavage of Astragalus polysaccharide 100 mg / kg + Sanguisorba officinalis saponin I 100 mg / kg or Astragalus polysaccharide 150 mg / kg + Sanguisorba officinalis saponin I 50 mg / kg for two weeks can significantly increase the thymus and spleen indices of mice after chemotherapy; Astragalus polysaccharide 50 mg / kg + Sanguisorba officinalis saponin I 150 mg / kg can significantly increase the thymus index of mice after chemotherapy, which has statistical significance compared with the model group; the thymus index and spleen index of mice in the rest of the proportion groups also showed a significant growth trend. Therefore, Astragalus polysaccharide combined with Sanguisorba officinalis saponin I has a good regulating effect on immune function, and the synergistic effect is better than that of a single component. Among them, Astragalus polysaccharide 100 mg / kg + Sanguisorba officinalis saponin I 100 mg / kg (1:1) has the best effect.

[0037] Table 1 Effects of equal dose of single drug and different proportion of combination on organ index ±s

[0038] Group Dose (mg / kg) n Thymus index (mg / 10g) Spleen index (mg / 10g) Control group — 8 31.3±9.2 40.4±19.3 Model group — 6 7.7 ± 2.5 ** ]] 18.7 ± 4.0 * ]] APS 200 8 9.8±2.7 21.2±3.3 ZGI 200 8 8.2±3.7 19.2±4.2 APS+ZGI 100+100（1:1） 8 15.0 ± 6.4 # ]] 27.1 ± 8.1 # ]] APS+ZGI 50+150（1:3） 7 13.5 ± 4.8 # ]] 24.5±6.6 APS+ZGI 25+175（1:7） 6 9.6±3.7 23.5±7.4 APS+ZGI 175+25（7:1） 8 13.3±8.6 24.7±8.6 Figure 1 150+50（3:1） 8 10.7 ± 2.0 # ]] 25.4 ± 6.2 # ]]

[0039] *P<0.05, **P<0.01 compared with control group; #P<0.05, same below compared with model group.

[0040] 2. Experiment of pathological damage of ileum tissue of mice after chemotherapy

[0041] The structure of mucosa layer, muscle layer and serosa layer of control group mice was clear, and villus fusion, intestinal gland structure disorder and inflammatory cell infiltration were not observed. Compared with the control group, the ileum tissue of mice after chemotherapy showed villus fusion, intestinal gland structure disorder, intestinal gland expansion and a large number of inflammatory cell infiltration in the interstitium. Compared with the model group, the APS+ZGI (100 mg+100 mg) group showed local villus fusion, local intestinal gland structure disorder, partial intestinal gland mild expansion and a small amount of inflammatory cell infiltration in the interstitium. The incidence of lesions and the degree of lesions were significantly reduced, and the difference was statistically significant. The use of APS or ZGI alone did not significantly improve the ileum damage. The pathological tissue observation and score statistics showed that the rest of the APS+ZGI dose groups had a certain improvement effect on the chemotherapy-induced intestinal damage (see Table 2). No. Therefore, the combination of APS and ZGI is better than single use, and in different proportion experiments, APS:AGI=1:1 has the best protective effect on chemotherapy-induced intestinal damage.

[0042] Example 2: Exploring the protective effect of Astragalus polysaccharide combined with Sanguisorba officinalis saponin I on chemotherapy-induced tight junction damage in mice based on ERK / MAPK signaling pathway

[0043] Fifty KM mice were randomly divided into normal group, model group, high-dose group (APS 100 mg / kg + ZGI 100 mg / kg), medium-dose group (APS 50 mg / kg + ZGI 50 mg / kg) and low-dose group (APS 25 mg / kg + ZGI 25 mg / kg), 10 mice in each group. Continuous gavage for 2 weeks, 1 time / day, 0.2 mL / 10g, the blank group and the model group were given the same dose of 0.5% CMC-Na. According to the results of the pre-experiment, from the 11th day of administration, except for the blank group, the rest of the groups were injected intraperitoneally with 5-FU 120 mg / kg, 0.1 mL / 10g, 1 time / day, for 4 consecutive days, to prepare the chemotherapy-induced intestinal tight junction damage mouse model. The next day after modeling, the mice were sacrificed by cervical dislocation, and the ileum segment was fixed in 10% formaldehyde solution, dehydrated, paraffin-embedded, sectioned, HE stained, and observed under a light microscope for pathological changes. Histological diagnosis score reference, with interstitial inflammatory cell infiltration, intestinal villus epithelial necrosis and shedding, intestinal villus fusion, and intestinal mucosa atrophy as observation indicators, the lesion degree was analyzed by semi-quantitative analysis: grade 1, mild; grade 2, mild-moderate; grade 3, moderate; grade 4, severe, and the sum of each index score was the pathological score. Another ileum segment was fixed in 3% glutaraldehyde phosphate buffer, 1% osmium acid fixative, ethanol acetone, acetone epoxy resin mixture, embedding, block, ultrathin section, uranium and lead double staining, and transmission electron microscopy was used to observe the ultrastructural changes of the tissue. Another part of the ileum was transferred to a-80°C refrigerator for storage for real-time fluorescent quantitative PCR (RT-PCR) and Western blot (WB) detection.

[0044] Table 2 Real-time fluorescent quantitative PCR primer sequences

[0045] Name Sequence SEQ ID NO. 1 GAPDH gene forward primer TGCCCCCATGTTTGTGATG SEQ ID NO. 2 GAPDH gene reverse primer TGTGGTCATGAGCCCTTCC SEQ ID NO. 3 Occludin gene forward primer TGGCAAGCGATCATACCCAGAG SEQ ID NO. 4 Occludin gene reverse primer CTGCCTGAAGTCATCCACACTC SEQ ID NO. 5 Claudin-1 gene forward primer TGTGTCCACCATTGGCATGA SEQ ID NO. 6 Claudin-1 gene reverse primer CCCAATGACAGCCATCCACA SEQ ID NO. 7 Claudin-2 gene forward primer AGGACTTCCTGCTGACATCCAG SEQ ID NO. 8 Claudin-2 gene reverse primer AATCCTGGCAGAACACGGTGCA SEQ ID NO. 9 Claudin-6 gene forward primer GGAACTCCAAGTCTCGTCTGGT SEQ ID NO. 10 Claudin-6 gene reverse primer AGTCCTGGATGATAGAGTGGGC SEQ ID NO. 11 ZO-1 gene forward primer GTTGGTACGGTGCCCTGAAAGA SEQ ID NO. 12 ZO-1 gene reverse primer GCTGACAGGTAGGACAGACGAT SEQ ID NO. 13 Cingulin gene forward primer CAGGACTGTGAAGAGGCTTCCA SEQ ID NO. 14 Cingulin gene reverse primer CCTCTTGTGTCTCCCGAAGTGT Figure 2

[0046] 2.1 Effect on pathological injury score of ileum tissue of mice after chemotherapy

[0047] Compared with the blank group, the pathological injury score of ileum tissue of mice in the model group was significantly increased. Compared with the model group, the pathological injury score of APS combined with ZGI in the medium and high dose groups was significantly reduced, and the low dose group had a tendency to reduce. Results Figure 3 、 Figure 4 .

[0048] 2.2 Effect on ultrastructure of ileum tissue of mice after chemotherapy

[0049] Transmission electron microscopy observation results found that the blank group of mice ileum structure is normal, mucosal epithelial microvilli arranged in order, epithelial cells tight junction clear, organelles such as mitochondria and endoplasmic reticulum rich, clear and full structure, no obvious autophagosome. Model group ileum tissue structure is abnormal, mucosal epithelial cell microvilli arranged disorder, can see a large number of microvilli shedding short, part of the mucosal epithelial desmosome structure is not clear, tight junction damage, mucosal epithelial cells can see a large number of lipid droplets and a little autophagosome, no obvious swelling and necrosis of mitochondria. Compared with the model group, APS+ZGI each administration group of ileum tissue pathological changes have different degrees of improvement, among which the high dose effect is the best. Results see Figure 5 .

[0050] 2.3 Influence on the expression of Occludin, Claudin-1, Claudin-2, Claudin-6, ZO-1, Cingulin mRNA in the ileum tissue of mice after chemotherapy

[0051] Compared with the blank group, the expression levels of Occludin, Claudin-1, Claudin-2, Claudin-6, ZO-1 and Cingulin mRNA in the model group were significantly decreased. Compared with the model group, the expression levels of Occludin, Claudin-2, Claudin-6, ZO-1 and Cingulin mRNA in the APS+ZGI administration groups were significantly increased; the expression level of Claudin-1 mRNA in the medium and high dose groups was significantly increased, and the low dose group had an upward trend, but there was no statistical difference. Results see Figure 6 .

[0052] 2.4 Influence on the expression of Occludin, ZO-1, RAS, RAF and p-ERK protein in the ileum tissue of mice after chemotherapy

[0053] Compared with the control group, the protein expression of Occludin and ZO-1 in the model group was significantly down-regulated, and RAS, RAF and p-ERK were significantly up-regulated. After APS+ZGI treatment, the protein expression of Occludin and ZO-1 was significantly increased, the expression of p-ERK was significantly decreased, and the expression of upstream RAS and RAF was also significantly decreased ​ .

[0054] 3、Discussion

[0055] The present application adopts the way of intraperitoneal injection of 5-Fu to construct a mouse intestinal mucosa tight junction damage model. The results show that after modeling, the mice activity, body weight decrease, feces soften, and gradually increase, histopathology suggests that the ileum mucosa epithelial structure is destroyed, a large number of inflammatory cell infiltration is seen, intestinal villi epithelial necrosis and shedding fusion, intestinal mucosa atrophy, which shows that the chemotherapy induced intestinal mucosa damage model is successfully constructed. At the same time, the tight junction structure of ileum tissue is significantly damaged, since the tight junction is closely related to the integrity and permeability of intestinal mucosa, it is suggested that the chemotherapy induced intestinal mucosa damage is closely related to the destruction of tight junction. After the intervention of APS combined with ZGI, the activity, mental state and feces of mice in each administration group are improved; the spleen and thymus index is significantly increased; the histopathology score is significantly reduced; the ileum ultrastructure tends to be normal, the epithelial microvilli is arranged in order, and the cell tight junction is clear without obvious expansion and destruction, which shows that the combination of the two has a clear protective effect on the intestinal epithelial tight junction damage caused by 5-Fu.

[0056] ERK / MAPK signaling pathway is involved in the destruction of intestinal tight junction and barrier function damage induced by exogenous chemicals, and in this process, as a key molecule of damage signal, it includes RAS, RAF, MEK1 / 2, ERK1 / 2 and other kinases. When the body is in the pathological state of chemotherapy, RAS is activated and combined with RAF on the cell membrane, and transmits the active signal to RAF, and the phosphorylated RAF activates MEK, and the phosphorylated MEK activates ERK into the nucleus for transcription. Studies have shown that inhibiting the phosphorylation of MAPK signaling pathway target protein can significantly increase the expression of tight junction protein in the colon tissue of mice with intestinal mucositis induced by 5-FU. The present application finds that 5-FU can significantly activate the expression of ERK / MAPK signaling pathway while affecting the function of the tight junction of the intestinal mucosa of mice, and reduce the expression of tight junction protein. After the intervention of APS combined with ZGI, the Western blot results show that it can significantly improve the tight junction function of mice with chemotherapy induced intestinal mucosa damage, and the protein expression levels of RAS, RAF, ERK1 / 2 and phosphorylated ERK1 / 2 are all reduced, although the changes of RAF and ERK2 protein expression do not reach statistical significance, but the reducing trend suggests that it may also have a regulatory effect on the expression of other proteins of ERK / MAPK signaling pathway. This suggests that APS combined with ZGI can improve the destruction of intestinal mucosa tight junction caused by 5-FU by down-regulating the ERK / MAPK signaling pathway.

[0057] In summary, the present application shows that APS combined with ZGI can alleviate the general condition of mice with chemotherapy induced intestinal mucosa damage, enhance immunity, increase the expression of tight junction protein, and reduce the damage of intestinal mucosa barrier. Its mechanism may be realized by inhibiting the activation of ERK / MAPK signaling pathway.

Claims

1. A pharmaceutical composition for protecting against chemotherapy-induced intestinal damage, characterized in that: It is prepared from the following raw materials in the indicated weight ratios: Astragalus polysaccharide 1-3 parts, Sanguisorba officinalis saponin I 1-3 parts.

2. The pharmaceutical composition for protecting against chemotherapy-induced intestinal damage according to claim 1, characterized in that: It is prepared from the following raw materials in the indicated weight ratios: One part of Astragalus polysaccharide and one part of Sanguisorba officinalis saponin I.

3. The pharmaceutical composition for protecting against chemotherapy-induced intestinal damage according to claim 1 or 2, characterized in that: It is prepared into a commonly used oral pharmaceutical preparation by adding pharmaceutically acceptable excipients or auxiliary ingredients to the active ingredient of the raw drug.

4. The pharmaceutical composition for protecting against chemotherapy-induced intestinal damage according to claim 3, characterized in that: The oral preparations mentioned are tablets, capsules, pills, oral liquids, and granules.

5. Use of the pharmaceutical composition according to any one of claims 1-4 in the preparation of a medicament for protecting against chemotherapy-induced intestinal damage.

Images