Virus vector for accurately regulating and controlling human telomerase gene by using human interleukin-6 core promoter and application of virus vector

Abstract

The invention discloses a viral vector for accurately regulating and controlling a human telomerase gene by using a human interleukin-6 core promoter and application of the viral vector. The virus vector comprises an expression cassette with a human interleukin-6 core promoter sequence and a human telomerase gene sequence, and the human interleukin-6 core promoter sequence is activated in a natural physiological process of cell aging and inhibited in a normal cell physiological state; further accurately regulating and controlling the human telomerase gene to be expressed as telomerase protein; according to the invention, a human interleukin-6 core promoter and a human telomerase gene (hT) are respectively inserted into a virus vector to obtain the virus vector, and after the virus vector is transfected into human tissue cells, the aging of the cells can be delayed. According to the invention, the human interleukin-6 core promoter is utilized to dynamically and accurately regulate and control the expression of the human telomerase gene and construct the expression cassette and the virus vector, so that the expression cassette and the virus vector have a wide application prospect in the anti-aging and aging-related fields.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a virus vector for precisely regulating human telomerase genes by human interleukin-6 core promoter and use thereof. BACKGROUND

[0002] Due to the increasingly serious population aging, aging seriously affects the quality of life of the elderly, and brings heavy economic burden to families and society. Reducing aging and prolonging healthy life span are urgent problems to be solved, and have great economic value. Cellular senescence is a major risk factor for chronic / degenerative aging, which shortens the healthy life span. With age, accumulation of DNA damage, appearance of chronic inflammation, increase of reactive oxygen species, and continuous shortening of telomeres lead to cellular senescence. Senescent cells exhibit a senescence-associated secretory phenotype (SASP), such as pro-inflammatory cytokines and chemokines (IL-6, IL-1α and TNFα), which further induce cellular senescence. The inflammatory factor IL-6 promotes the occurrence of various chronic / degenerative aging. Therefore, reducing chronic inflammation can delay cellular senescence and prolong healthy life span.

[0003] Telomerase is a ribonucleoprotein complex mainly composed of telomerase catalytic subunit protein (TERT) and RNA template (TERC). Telomerase protects the genome from damage by lengthening telomeres, thereby delaying cellular senescence and prolonging cell life span. In the past classic theory, TERT is expressed and plays a biological function in stem cells, most cancer cells and precursor cells. It is inhibited in terminally differentiated somatic cells. The latest research finds that the expression of TERT is transiently induced in somatic cells, and delays cellular senescence during the aging process. TERT is also distributed in organelles such as mitochondria, lysosomes and endoplasmic reticulum, which can improve mitochondrial function, promote DNA repair capacity, inhibit inflammatory factors and increase cell survival rate.

[0004] In 2022, Hua Zhu and colleagues used a new nasal inhalation and traditional intraperitoneal injection to deliver the telomerase (mT) gene to old mice; the results showed that the telomeres of the mice were extended by 6 times, and the functions of various tissues such as the brain, heart, kidney, and muscle were improved, ultimately extending the life of the mice by 41.4%. Hua Zhu's team used the IE promoter of human cytomegalovirus (HCMV) to induce the expression of mouse telomerase (mT). The IE promoter is a constitutive promoter that induces high-level expression of mouse telomerase (mT). In stem cells, high-level expression of telomerase maintains stem cell function; in somatic cells, the expression levels of human and mouse telomerase differ greatly. In human somatic cells, the expression of human telomerase (hT) is strictly regulated, and the expression level is very low; while in mouse somatic cells, the expression of telomerase (mT) is relatively high. Human telomerase (hT) is strictly regulated in human somatic cells; therefore, there is a risk of promoting cancer development by inducing high-level expression of human telomerase (hT) in human somatic cells through a constitutive promoter. There is still a lack of precise regulation of telomerase gene to delay cell aging in existing technologies. SUMMARY

[0005] To solve the problems in the background art, the present application uses the human interleukin-6 core promoter (IL) to precisely regulate the human telomerase gene (hT) for delaying cell aging.

[0006] The technical solution adopted by the present application is:

[0007] (1) A viral vector for precisely regulating the human telomerase gene using the human interleukin-6 core promoter.

[0008] The viral vector comprises an expression cassette comprising a human interleukin-6 core promoter sequence and a human telomerase gene sequence, wherein the human telomerase gene sequence is operably linked downstream of the human interleukin-6 core promoter sequence.

[0009] The human interleukin-6 core promoter responds to changes in the physiological state of cells during the aging process, dynamically and precisely regulating the expression of the human telomerase gene, which is expressed as telomerase protein in cells. Telomerase can repair and lengthen telomeres, reduce DNA damage accumulation, reduce chronic inflammation, improve mitochondrial function, enhance autophagy, and reduce oxidative stress, thereby delaying cell aging.

[0010] In the cell, the human interleukin-6 core promoter sequence is activated in the process of cell aging, the expression of the human telomerase gene sequence connected behind the activated promoter sequence is up-regulated, the anti-aging effect of human telomerase is exerted after the expression of the human telomerase gene sequence rises, and then the cell inflammation is reduced, so that the aging cell enters a normal cell physiological state; in the normal cell physiological state, the human interleukin-6 core promoter is inhibited, and then the expression of the human telomerase gene sequence decreases. The expression level of the human telomerase gene is regulated by the inflammation level of the cell, and presents an oscillating dynamic change in the cell, thereby delaying cell aging.

[0011] The base of the human interleukin-6 core promoter sequence is 22725656-22727234 of human interleukin-6 genome (chromosome 7-NC_000007.14).

[0012] The base of the human telomerase gene sequence is 80-3475 of human telomerase gene (NM_198253.3).

[0013] The expression frame further comprises a self-cleavage sequence and a fluorescent protein gene.

[0014] The self-cleavage sequence and the fluorescent protein gene are both operably linked downstream of the human telomerase gene sequence.

[0015] In the present application, the self-cleavage sequence is short, and therefore does not easily affect the virus packaging titer.

[0016] In a specific implementation, the self-cleavage sequence is as shown in SEQ ID NO. 1.

[0017] The fluorescent protein gene is an EGFP sequence, as shown in SEQ ID NO. 2.

[0018] The virus vector is a lentivirus vector.

[0019] (II) Construction method of virus vector for precise regulation of human interleukin-6 core promoter on human telomerase gene.

[0020] The method specifically comprises the following steps:

[0021] 1) Obtain the DNA fragment in the expression frame: obtain the human interleukin-6 core promoter fragment by PCR amplification using primers; cut and recover and purify the DNA fragment of the protein coding region of the human telomerase in the plasmid using a restriction enzyme to obtain the DNA fragment of the protein coding region of the human telomerase;

[0022] The primer in the step 1) is: an upstream primer as shown in SEQ ID NO. 3, CAGCCATCCTCCCCCATTTT; and a downstream primer as shown in SEQ ID NO. 4, TTCTCTTTCGTTCCCGGTGG.

[0023] 2) Constructing an expression plasmid with an expression frame: inserting a DNA fragment of a protein coding region of human telomerase into an expression plasmid containing P2A-EGFP, and the DNA fragment of the protein coding region of human telomerase is inserted at the 5' end of P2A-EGFP; then inserting a human interleukin-6 core promoter fragment at the 5' end of the DNA fragment of the protein coding region of human telomerase to obtain an expression plasmid with an expression frame IL-hT-EGFP.

[0024] 3) Obtaining a viral vector by transfection: obtaining a viral vector by transfecting cells with the expression plasmid with the expression frame IL-hT-EGFP using a viral packaging plasmid.

[0025] (Three) The viral vector for precisely regulating human telomerase genes by human interleukin-6 core promoters is used for anti-aging in non-disease diagnosis and treatment.

[0026] The viral vector can transfect cells of organs or tissues of humans or animals.

[0027] The application can dynamically and precisely regulate the expression of human telomerase genes in different physiological states of cells by the characteristics that the human interleukin-6 core promoter is activated in the process of cell aging and is inhibited in the normal physiological state of cells, and responds to inflammatory factors in cells.

[0028] The human interleukin-6 (IL-6) core promoter (IL) precisely regulates human telomerase genes (hT), and can be used for cell aging intervention.

[0029] (Four) An anti-aging pharmaceutical composition containing the viral vector for precisely regulating human telomerase genes by human interleukin-6 core promoters.

[0030] (Five) An aging pharmaceutical composition containing the viral vector for precisely regulating human telomerase genes by human interleukin-6 core promoters.

[0031] The beneficial effects of the present application are as follows:

[0032] (1) The expression plasmid with expression frame IL-hT-EGFP utilizes human interleukin-6 (IL-6) core promoter (IL) to precisely regulate human telomerase (hT) gene to reduce DNA damage accumulation; the expression plasmid with expression frame IL-hT-EGFP utilizes human interleukin-6 (IL-6) core promoter (IL) to precisely regulate human telomerase (hT) gene to reduce inflammatory factors of cells; the expression plasmid with expression frame IL-hT-EGFP utilizes human interleukin-6 (IL-6) core promoter (IL) to precisely regulate human telomerase (hT) gene to delay cell aging.

[0033] (2) The present application utilizes the activated characteristics of human interleukin-6 (IL-6) core promoter (IL) in the process of cell aging, adopts human interleukin-6 (IL-6) core promoter (IL) to precisely regulate the expression of human telomerase gene (hT), makes the human telomerase gene (hT) oscillatory dynamic expression into human telomerase, and further reduces the accumulation of DNA damage in the process of cell aging, reduces chronic inflammation, and delays cell aging.

[0034] (3) The present application realizes the momentary induced expression of telomerase in somatic cells, and further delays cell aging and inhibits the occurrence of cancer. Compared with the constitutive overexpression of telomerase, the precise regulation of dynamic expression of telomerase is more important for prolonging telomere, reducing DNA damage accumulation, reducing inflammation, increasing the ability of cells to resist stress, and safely delaying cell aging. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 Workflow for GV3-IL-EGFP and GV3-IL-hT-EGFP expression vector construction and phenotype analysis process.

[0036] Figure 2GV3-IL-hT-EGFP reduced inflammatory factors during human fibroblast aging; (A) is GV3-IL-EGFP immunofluorescence staining of cells from P13 to P15 (P13: passage 13, P14: passage 14, P15: passage 15), (B) is a heat map of the expression profile of GV3-IL-EGFP and GV3-IL-hT-EGFP inflammatory phenotype; (T13, T14, T15 are GV3-IL-hT-EGFP of passage 13, passage 14, passage 15, respectively, C13, C14, C15 are GV3-IL-EGFP of passage 13, passage 14, passage 15, respectively), (C) is the volcano plot of inflammatory gene expression in GV3-IL-EGFP and GV3-IL-hT-EGFP; the transcript level of GV3-IL-hT-EGFP is increased (right) or decreased (left) (T12: GV3-IL-hT-EGFP of passage 12, C12: GV3-IL-EGFP of passage 12), (D) is the Western blotting result of IL-1α and IL-6 from P15 to P19 in GV3-IL-EGFP and GV3-IL-hT-EGFP, with β-actin as a control (C: GV3-IL-EGFP, hT: GV3-IL-hT-EGFP).

[0037] Figure 3 GV3-IL-hT-EGFP reduced DNA damage accumulation during human fibroblast aging; (A) is a heat map of the expression profile of GV3-IL-EGFP and GV3-IL-hT-EGFP DNA damage response / repair factors, (B) is the volcano plot of damage response / repair gene expression in GV3-IL-EGFP and GV3-IL-hT-EGFP, the transcript level of GV3-IL-hT-EGFP is increased (right) or decreased (left), (C) is the Western blotting of ATR, PARP1, RAD51 and γ-H2AX from P12 to P15 in GV3-IL-EGFP and GV3-IL-hT-EGFP, with β-actin as a control, the normalized relative γ-H2AX protein level is shown in the lower panel, the error bar represents the standard deviation between 3 independent biological replicates (n=3), statistical significance was determined using two-stage progressive non-paired t-test, *p<0.05, **p<0.01, ***p<0.001, (D) is the gene set enrichment analysis GSEA plot comparing homologous recombination (HR) gene sets of T14 and C14 and T15 and C15.

[0038] Figure 4Schematic diagram of GV3-IL-hT-EGFP reducing DNA damage in Dox-induced human fibroblasts; (A) is a GSEA plot of comparing T15 and C15 cell senescence gene set, (B) is a heatmap of GV3-IL-EGFP and GV3-IL-hT-EGFP cell senescence factor expression profile.

[0039] Figure 5 Schematic diagram of GV3-IL-hT-EGFP reducing DNA damage in Dox-induced human fibroblasts; (A) is a heatmap of GV3-IL-EGFP and GV3-IL-hT-EGFP inflammatory factor expression after human fibroblasts were treated with 100 nM of Dox for 48 hours (DT13~DT15: Dox-induced GV3-IL-hT-EGFP of passage 13~15, DC13~DC15: Dox-induced GV3-IL-EGFP of passage 13~15), (B) is a volcano plot of GV3-IL-EGFP and GV3-IL-hT-EGFP inflammatory factor expression after human fibroblasts were treated with 100 nM of Dox for 48 hours, the transcript level of GV3-IL-hT-GEFP increased (right) or decreased (left), (DT12: Dox-induced GV3-IL-hT-EGFP of passage 12, DC12: Dox-induced GV3-IL-EGFP of passage 12), (C) is a western blot of ATR, PARP1, RAD51 and γ-H2AX from P12 to P15 of GV3-IL-EGFP and GV3-IL-hT-EGFP after human fibroblasts were treated with 100 nM of Dox for 48 hours, with β-actin as a control, (D) is a heatmap of GV3-IL-EGFP and GV3-IL-hT-EGFP DNA damage response / repair factor expression profile after human fibroblasts were treated with 100 nM of Dox for 48 hours, (E) is a volcano plot of GV3-IL-EGFP and GV3-IL-hT-EGFP DNA damage response / repair gene expression after human fibroblasts were treated with 100 nM of Dox for 48 hours, the transcript level of GV3-IL-hT-EGFP increased (right) or decreased (left).

[0040] Figure 6To delay the Dox-induced human fibroblast aging of GV3-IL-hT-EGFP, (A) is the GSEA plot of the cell aging gene set of DT13 vs. DC13, DT14 vs. DC14 and DT15 vs. DC15, (B) is the Western blot of γ-H2AX from P12 to P15 of GV3-IL-EGFP and GV3-IL-hT-EGFP treated with 100 nM of Dox for 48 hours (D0: no doxorubicin treatment, D1-R0: doxorubicin treatment for 48 hours, D1-R1: recovery for 24 hours after doxorubicin treatment for 48 hours, D1-R2: recovery for 48 hours after doxorubicin treatment for 48 hours, with β-actin as a control), (C) is the heat map of the cell aging factor expression profile of GV3-IL-EGFP and GV3-IL-hT-EGFP after treatment with 100 nM of Dox for 48 hours. DETAILED DESCRIPTION

[0041] The application will be further described in detail below in conjunction with the accompanying drawings and specific examples.

[0042] In the application, the human interleukin-6 (IL-6) core promoter (IL) sequence is activated in the natural physiological process of cell aging, and then can up-regulate the expression of the human telomerase gene (hT) connected behind. The human telomerase gene (hT) is a longevity gene, which can lengthen telomeres, reduce DNA damage accumulation, reduce chronic inflammation, improve mitochondrial function, enhance autophagy, reduce oxidative stress, and thus delay cell aging. Therefore, precise regulation of the expression of the human telomerase gene (hT) can be used for anti-aging.

[0043] The application utilizes the human interleukin-6 (IL-6) core promoter (IL) to precisely regulate the human telomerase (hT) gene in the natural physiological process of cell aging, the physiological process of cell damage stress, and the physiological process of cell carcinogenesis, and then is used for preparing or screening anti-aging drugs / products or aging-related drugs / products.

[0044] Firstly, IL-6 is an important inflammatory factor and one of the main biomarkers of aging. With the increase of age, the IL-6 in the body of the elderly population increases, which can accelerate aging. The application utilizes the natural physiological process of aging to activate the core IL-6 promoter and up-regulate the expression of hT to delay aging; when the cell enters the normal physiological state from the aging state, the IL-6 core promoter is inhibited and the expression of hT stops; then the cell enters the aging state again and repeats the above process. The IL-hT introduced into the cell precisely activates or inhibits the IL-6 core promoter by using the natural physiological process of cell aging, the IL-6 core promoter precisely regulates the longevity gene hT, and the IL-6 core promoter plays the role of a "gene oscillator". Other promoters cannot achieve this function.

[0045] The precise regulation refers to that in the aging process of cells, the human interleukin-6 (IL-6) core promoter (IL) is activated, the expression amount of human interleukin-6 (IL-6) is increased, meanwhile, the human interleukin-6 (IL-6) core promoter (IL) in the IL-hT expression frame is activated to promote the expression of human telomerase gene (hT), and the aging of cells is delayed; after the aging of cells is delayed, the human interleukin-6 (IL-6) core promoter (IL) is inhibited, and the human telomerase gene (hT) stops expressing; when the cells enter the physiological state of aging again, the human interleukin-6 (IL-6) core promoter (IL) is activated again, and the above process is repeated in the cells again. Therefore, the introduced IL-hT expression frame can combine the physiological process of cell aging, so that the human interleukin-6 (IL-6) core promoter (IL) plays a role of a "gene oscillator".

[0046] The application constructs an expression frame of human interleukin-6 (IL-6) core promoter (IL) precisely regulating human telomerase (hT) gene, and the expression frame is composed of human interleukin-6 (IL-6) core promoter (IL) sequence, human telomerase (hT) gene sequence, P2A sequence and EGFP sequence.

[0047] The application also constructs a virus vector with the above expression frame, and the construction method of the virus vector comprises the following steps:

[0048] 1) obtaining a DNA fragment in the expression frame;

[0049] Human genome is extracted, and a 1579bp human interleukin-6 (IL-6) core promoter (IL) DNA fragment is obtained by PCR amplification using IL-6 core promoter primers (upstream primer: CAGCCATCCTCCCCCATTTT, downstream primer: TTCTCTTTCGTTCCCGGTGG); the DNA fragment of the protein coding region (CDS) of human telomerase (hT) in the plasmid pCI-neo-hTERT is cut and recovered and purified using a restriction enzyme, and a 3396bp DNA fragment of the protein coding region (CDS) of human telomerase (hT) is obtained.

[0050] 2) constructing an expression plasmid with the expression frame;

[0051] The DNA fragment of the protein coding region (CDS) of human telomerase (hT) is inserted into the expression plasmid containing P2A-EGFP, and the hT fragment is inserted into the 5' end of P2A-EGFP; then the DNA fragment of the human interleukin-6 (IL-6) core promoter (IL) is inserted into the 5' end of the hT fragment, and an expression plasmid with the expression frame IL-hT-EGFP is obtained;

[0052] 3) transfection to obtain a viral vector;

[0053] The expression plasmid with the expression frame IL-hT-EGFP is transfected into HEK293T cells together with a viral packaging plasmid to obtain viral vector particles.

[0054] In the embodiment of the present application, a lentiviral expression plasmid GV3-IL-hT-EGFP with the above expression frame is constructed. Specifically, after the expression plasmid with the expression frame is constructed according to steps 1) to 2), HEK293T cells are transfected with lentiviral packaging plasmid pSPAX2 and envelope plasmid pMD2.G to obtain viral particles.

[0055] The viral vector in the present application can be used to prepare an anti-aging drug.

[0056] The viral vector in the present application can reduce chronic inflammation of transfected cells, reduce DNA damage accumulation, and delay cell aging, thereby achieving anti-aging.

[0057] The anti-aging includes delaying skin aging, respiratory system aging, muscle system aging, skeletal system aging, cardiovascular system aging, immune system aging, and nervous system aging.

[0058] The present application is further described below in combination with examples and comparative examples. The specific examples and comparative examples of the present application are as follows:

[0059] Example 1

[0060] As shown in Figure 1 , the present embodiment first inserts a DNA fragment of the protein coding region (CDS) of human telomerase (hT) into a lentiviral expression vector GV3 containing P2A-EGFP, and the hT fragment is inserted at the 5' end of P2A-EGFP; then a DNA fragment of the human interleukin-6 (IL-6) core promoter (IL) is inserted at the 5' end of the hT fragment to obtain a lentiviral expression vector GV3-IL-hT-EGFP.

[0061] The GV3-IL-hT-EGFP lentiviral expression plasmid is transfected into HEK293T cells together with lentiviral packaging plasmid pSPAX2 and envelope plasmid pMD2.G to obtain GV3-IL-hT-EGFP viral particles.

[0062] Human fibroblasts (HFF-1) are transfected with GV3-IL-hT-EGFP viral particles.

[0063] Example 2

[0064] This example is used to illustrate the resistance of GV3-IL-hT-EGFP to DNA damage.

[0065] This example used the method in Example 1 to prepare GV3-IL-hT-EGFP virus particles. After transfecting human fibroblasts (HFF-1) with GV3-IL-hT-EGFP virus particles, the human fibroblasts were treated with 100 nM doxorubicin (Doxorubicin, Dox) for 48 hours.

[0066] Comparative Example 1

[0067] In this comparative example, a human interleukin-6 (IL-6) core promoter (IL) DNA fragment was inserted into a lentiviral expression vector GV3 containing P2A-EGFP. The IL fragment was inserted at the 5' end of P2A-EGFP to obtain a lentiviral expression vector GV3-IL-EGFP. Then, the GV3-IL-EGFP lentiviral expression plasmid was transfected into HEK293T cells together with lentiviral packaging plasmid pSPAX2 and envelope plasmid pMD2.G to obtain GV3-IL-EGFP virus particles.

[0068] Human fibroblasts (HFF-1) were transfected with GV3-IL-EGFP virus particles.

[0069] Comparative Example 2

[0070] In this comparative example, GV3-IL-EGFP virus particles were prepared using the method in Comparative Example 1. After transfecting human fibroblasts (HFF-1) with GV3-IL-EGFP virus particles, the human fibroblasts were treated with 100 nM doxorubicin (Doxorubicin, Dox) for 48 hours.

[0071] Analysis of Example 1 and Comparative Example 1

[0072] Example 1 and Comparative Example 1 were analyzed by RNA-seq data set analysis and Western blot analysis by immunoblotting. The results are shown in Figures 2-4

[0073] In Comparative Example 1, 5% of the cells in the 13th passage (P13) of GV3-IL-EGFP produced EGFP fluorescence, and 10% of the cells in the 14th passage (P14) produced EGFP fluorescence. In the 15th passage (P15) of GV3-IL-EGFP, nearly 80% of the cells appeared fluorescent Figure 2 ​A). As EGFP gradually increased during passaging, it indicated that the IL-6 core promoter upregulated EGFP expression when GV3-IL-EGFP approached cellular senescence, thus the IL-6 core promoter can precisely regulate gene expression. The IL-6 core promoter in GV3-IL-hT-EGFP precisely regulated human telomerase gene (hT) when Example 1 approached cellular senescence. Transcriptomic expression pattern analysis on the RNA-seq dataset showed that from P13 to P15, the expression of TNF, IL-6 and IL-1a gradually upregulated in Comparative Example 1 compared to Example 1 Figure 2 B and Figure 2 C). The NFKB1 / 2 and REL A / B inflammatory pathways were activated in Comparative Example 1 at P14 and P15, and the pro-inflammatory chemokines CXCL8 and CXCL1 increased Figure 2 B). While Example 1 downregulated TNF, IL-6 and IL-1a, reducing inflammatory factors from P13 to P15. At the same time, Example 1 inhibited the activation of NF-κB Figure 2 B). Western blot analysis showed that IL-1a and IL-6 proteins of Comparative Example 1 significantly increased at passage 19 (P19) Figure 2 D). The results showed that Example 1 reduced the expression of IL-1a and IL-6 during the process of human fibroblast senescence, while the expression of IL-1a and IL-6 gradually increased in Comparative Example 1 during the process of human fibroblast senescence.

[0074] As Figure 3 shown, BRCA1 / 2, RAD51 / 52 and CHEK1 gradually increased in Comparative Example 1 from P13 to P15, but Example 1 maintained a lower expression level of DNA damage response / repair factors from P13 to P15 Figure 3 A). By volcano plot analysis of mRNA expression differences at P13, P14 and P15, it was found that there was no difference in RAD51 expression between Example 1 and Comparative Example 1 at P13 and P14. But RAD51 in Comparative Example 1 was slightly upregulated at P15 compared to Example 1 Figure 3 B). Although there was no difference between ATR and PARP1, RAD51 and γ-H2AX in Comparative Example 1 began to increase at P14 and significantly increased at P15, especially γ-H2AX Figure 3 C). The expression of RAD51 and γ-H2AX in Example 1 from P12 to P15 was very low, indicating that GV3-IL-hT-EGFP could reduce the accumulation of DNA damage Figure 3 C and Figure 3 D). The results showed that Example 1 reduced the accumulation of DNA damage during the process of human fibroblast senescence, while Comparative Example 1 showed a large accumulation of DNA damage during the process of human fibroblast senescence.

[0075] like Figure 4 As shown, GSEA analysis confirmed that Comparative Example 1 showed more aging signals at P15. Figure 4 A). RNA-seq analysis showed that, compared with Comparative Example 1, Example 1 reduced the expression of aging biomarkers CDKN2A and CD38, increased the expression of longevity proteins LaminB1 and GDF11, and delayed cellular senescence. Figure 4 B). The results showed that Example 1 reduced aging biomarkers during human fibroblast aging, while Comparative Example 1 increased aging biomarkers during human fibroblast aging.

[0076] Analysis of Example 2 and Comparative Example 2

[0077] The analyses of Example 2 and Comparative Example 2 were performed using RNA-seq dataset analysis and Western blot analysis of immunoprotein imprinting data. The results are as follows: Figures 5-6 As shown.

[0078] Doxorubicin is a DNA damage inducer that induces DNA double-strand breaks (DSBs) by inhibiting topoisomerase II. After 48 hours of incubation, in cells transfected with GV3-IL-hT-EGFP, γ-H2AX levels remained low, DNA damage was rapidly repaired, and GV3-IL-hT-EGFP reduced Dox-induced inflammatory factors, delaying Dox-induced cellular senescence. In GV3-IL-EGFP transfected cells, γ-H2AX expression was increased, DNA damage accumulated, and Dox treatment increased the inflammatory factors associated with GV3-IL-EGFP, accelerating cellular senescence.

[0079] like Figure 5 As shown, RNA-seq analysis revealed that Dox-induced DNA damage exacerbated the increases in inflammatory cytokines (TNF, IL-6, and IL-1α) and pro-inflammatory chemokine (CXCL8) in Comparative Example 2; while in Example 2, the inflammatory cytokines and pro-inflammatory chemokines remained at lower levels. Figure 5 A and Figure 5 B). Example 2 repaired Dox-induced DNA damage, with γ-H2AX maintained at a low level; Comparative Example 2 showed significant Dox-induced DNA damage, with high levels of γ-H2AX expression at P14 and P15. Figure 5 C~ Figure 5 E).

[0080] The results showed that Example 2 alleviated Dox-induced DNA damage and reduced Dox-induced inflammatory factors, while in Comparative Example 2, Dox induced a large amount of DNA damage and aggravated the secretion of inflammatory factors.

[0081] likeFigure 6 As shown, Dox-induced DNA damage accelerated cellular senescence (CDKN2A and CD38) in Comparative Example 2; Example 2 delayed Dox-induced cellular senescence (LaminB1 and GDF11) Figure 6 A~ Figure 6 C)。

[0082] The gene sequences involved in the present application are as follows:

[0083] SEQ ID NO. 1;

[0084] Name: Self-cleavage sequence

[0085] Sequence type: DNA

[0086] Source: Artificial Sequence (Artificial Sequence)

[0087] gcaacaaacttctctctgctgaaacaagccggagatgtcgaagagaatcctggaccg

[0088] SEQ ID NO. 2;

[0089] Name: EGFP sequence

[0090] Sequence type: DNA

[0091] Source: Artificial Sequence (Artificial Sequence)

[0092] ​atggtgtctaagggcgaagagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag

[0093] SEQ ID NO. 3: Primer

[0094] Name: Upstream primer

[0095] Sequence type: DNA

[0096] Source: Artificial Sequence

[0097] CAGCCATCCTCCCCCATTTT

[0098] SEQ ID NO. 4: Primer

[0099] Sequence type: DNA

[0100] Source: Artificial Sequence

[0101] TTCTCTTTCGTTCCCGGTGG.

Claims

1. A viral vector for precise regulation of human telomerase gene by human interleukin-6 core promoter, characterized in that: The expression frame comprises a human interleukin-6 core promoter sequence and a human telomerase gene sequence, the human interleukin-6 core promoter regulates the expression of the human telomerase gene, and the human telomerase gene is expressed as a telomerase protein.

2. The virus vector of claim 1, wherein the virus vector is a virus vector of human interleukin-6 core promoter precisely regulating human telomerase gene. The human interleukin-6 core promoter sequence is from position 22725656 to position 22727234 of the human interleukin-6 genome.

3. The virus vector of claim 1, wherein the virus vector is a virus vector of human interleukin-6 core promoter precisely regulating human telomerase gene. The human telomerase gene sequence is from position 80 to position 3475 of the human telomerase gene.

4. The viral vector of claim 1, wherein the human interleukin-6 core promoter precisely regulates the expression of the human telomerase gene. The expression frame further comprises a self-cleavage sequence and a fluorescent protein gene.

5. The viral vector of claim 1, wherein the viral vector is a lentiviral vector.

6. A method for constructing the viral vector of any one of claims 1-5, comprising the following steps: 1) obtaining a DNA fragment in the expression frame: using primers, a human interleukin-6 core promoter fragment is obtained by PCR amplification; a DNA fragment of the protein coding region of the human telomerase is cut and recovered and purified using a restriction enzyme, to obtain a DNA fragment of the protein coding region of the human telomerase; 2) constructing an expression plasmid with an expression frame: the DNA fragment of the protein coding region of the human telomerase is inserted into the 5' end of the self-cleavage sequence-fluorescent protein gene sequence on the expression plasmid containing the self-cleavage sequence-fluorescent protein gene sequence; the human interleukin-6 core promoter fragment is inserted into the 5' end of the DNA fragment of the protein coding region of the human telomerase, to obtain an expression plasmid with an expression frame; 3) transfection to obtain a viral vector: the expression plasmid with an expression frame is transfected into cells using a viral packaging plasmid to obtain a viral vector.

7. The method of claim 6, wherein the primers in step 1) are as follows: the upstream primer is as shown in SEQ ID NO. 3, and the downstream primer is as shown in SEQ ID NO.

4.

8. Use of the viral vector of any one of claims 1-5 or the viral vector constructed by the method of any one of claims 6-7 for anti-aging.

9. An anti-aging pharmaceutical composition comprising the viral vector of any one of claims 1-5 or the viral vector constructed by the method of any one of claims 6-7.

10. A pharmaceutical composition comprising the viral vector of any one of claims 1-5 or the viral vector constructed by the method of any one of claims 6-7. ​ ​ ​

Images