Molecular marker related to watermelon disease resistance and application thereof

By developing the microsatellite marker WM-08, which is tightly linked to watermelon resistance to Fusarium wilt, and combining it with PCR amplification and gel electrophoresis typing, the problems of long breeding cycles, large environmental interferences, and high detection costs in watermelon breeding have been solved, enabling rapid and accurate breeding of disease-resistant varieties.

CN121294729AActive Publication Date: 2026-01-09WEIFANG UNIV OF SCI & TECH +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511873961.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-12
Publication Date
2026-01-09
Estimated Expiration
2045-12-12

AI Technical Summary

Technical Problem

Existing technologies for breeding watermelon wilt resistance suffer from problems such as long breeding cycles, significant interference from environmental factors, a negative correlation between disease resistance and quality traits, and high costs and limited applications of existing molecular marker detection methods, making it difficult to achieve rapid and accurate breeding of disease-resistant varieties.

Method used

We developed a microsatellite marker, WM-08, which is closely linked to resistance to watermelon wilt. We screened resistant plants by PCR amplification and gel electrophoresis typing, and used specific primers to screen individuals with a CT repeat of 4, thus realizing molecular marker-assisted selection (MAS) breeding.

Benefits of technology

It significantly shortens the breeding cycle, improves breeding efficiency, and ensures that the selected plants maintain stable resistance under disease pressure, reducing the damage caused by Fusarium wilt. It solves the bottleneck of traditional breeding methods and achieves rapid and precise breeding of disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294729A_ABST
    Figure CN121294729A_ABST
Patent Text Reader

Abstract

According to the molecular marker related to the watermelon disease resistance and the application thereof, the molecular marker linked with the disease resistance character is screened by analyzing the difference between the disease resistance character of a high-resistance watermelon population and the disease resistance character of a high-susceptibility watermelon population, and the molecular marker is used for screening parents for genetic breeding of watermelons. According to the method for screening the disease-resistant watermelon plant, a parent with a genotype sequence of SEQ ID NO: 1 is screened. The microsatellite marker linked with watermelon disease resistance characters is obtained by analyzing amplification products of watermelon varieties with different disease resistance, and watermelon plants with disease resistance potential can be screened by using the microsatellite marker, so that an effective molecular marker is provided for disease resistance breeding operation of watermelons.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of crop genetics and breeding technology, specifically relating to a molecular marker related to watermelon disease resistance and its application. Background Technology

[0002] Watermelon (Citrullus lanatus), a globally important economic crop, has long been severely threatened by soil-borne diseases. Among these, Fusarium wilt, caused by Fusarium oxysporum f.sp. niveum, is particularly prominent. This pathogen can survive in the soil for over 10 years, invading the vascular bundles through the roots and causing systemic wilting and death of the plant. According to disease monitoring data from the Chinese Academy of Agricultural Sciences from 2020 to 2023, the incidence rate of this disease in continuously cropped areas is as high as 60-90%, causing yield losses of 30-80%, seriously hindering the sustainable development of the watermelon industry.

[0003] Current disease-resistant breeding mainly relies on traditional phenotypic selection techniques, which have three major bottlenecks: First, phenotypic identification requires artificial inoculation with pathogens and observation for 2-3 months, and only one round of screening can be completed in a single growing season, resulting in a breeding cycle of 5-6 years; Second, environmental factors have significant interference, and the disease index of the same genotype fluctuates by 25-40% under different soil types, temperature and humidity conditions, causing selection errors; Third, disease resistance is negatively correlated with quality traits, and highly resistant materials generally have problems such as small fruit and low sugar content, making it difficult to achieve synergistic improvement of multiple traits through conventional hybridization.

[0004] Molecular marker-assisted selection (MAS) technology offers a new direction for overcoming the aforementioned bottlenecks. Although reported SNP markers (such as Chr02:18,736,492) are associated with disease resistance, their detection relies on high-throughput sequencing or microarray platforms, resulting in high costs per sample. Furthermore, field applications require sophisticated instruments, making it difficult to promote in grassroots breeding units. While microsatellite markers (SSRs) offer advantages such as high polymorphism, good stability, and convenient PCR detection, the linkage strength between existing publicly available SSR markers (such as BVWS001 and MCPI-15) and disease resistance traits is low (R² < 0.35), failing to meet the needs of precision breeding.

[0005] Therefore, developing novel SSR markers that are closely linked to watermelon wilt resistance and suitable for rapid field detection is an urgent industrial need to accelerate the breeding of disease-resistant varieties. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker related to watermelon disease resistance and its application. By analyzing the differences in disease resistance traits between highly resistant and highly susceptible watermelon populations, molecular markers linked to disease resistance traits are screened, and these molecular markers are used to screen parents for watermelon genetic breeding.

[0007] This invention first provides a microsatellite locus WM-08 associated with disease resistance traits in watermelon, the nucleotide sequence of which is as follows;

[0008] GTACAAGTGCTGCGTACAAGTTCCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACAT(CT) n ATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTCTTCCAACGAGCCCATTTTTCTTTTGATTTGGAAGACGGGCGTTGCGTTCGAAAG; where n is a natural number 4-6;

[0009] The microsatellite loci provided by this invention are used to select watermelon plants resistant to Fusarium wilt.

[0010] Another aspect of the present invention provides a method for screening disease-resistant watermelon plants, which involves screening individuals with a CT repeat number of 4 for the microsatellite markers;

[0011] The method described above involves amplifying the nucleic acid sample of the watermelon plant to be tested by PCR, and then determining the genotype of the plant by gel electrophoresis of the PCR product.

[0012] The PCR amplification method described above uses primers with the following sequence information:

[0013] F:5'-CCGGCCAGGATAATTGGGAA-3' (SEQ ID NO:2),

[0014] R:5'-GGGCTCGTTGGGAAGAAAGA-3' (SEQ ID NO:3);

[0015] The gel electrophoresis typing showed that plants with genotype 225 / 225 exhibited significantly higher disease resistance than those with other genotypes (p<0.01). The sequences of the genotypes are as follows:

[0016] CCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACATCTTCCTCTATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTTCTTCCCAACGAGCCC (SEQ ID NO: 1).

[0017] This invention analyzes the amplification products of watermelon varieties with different disease resistance and obtains microsatellite markers linked to the disease resistance trait of watermelon. Using these microsatellite markers, watermelon plants with disease resistance potential can be screened, thus providing effective molecular markers for watermelon disease resistance breeding. Attached Figure Description

[0018] Figure 1 : Capillary electrophoresis image of microsatellite loci;

[0019] Figure 2 : Disease resistance data of parents and offspring. Detailed Implementation

[0020] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings.

[0021] Example 1: Identification of disease-resistant phenotypes

[0022] From April 2023 to August 2024, disease resistance phenotype identification was conducted at the experimental base. A flat area with convenient irrigation and drainage, prone to severe disease outbreaks due to continuous cropping, was selected as the experimental field, with watermelon as the previous crop. Seventy-two watermelon germplasm accessions (48 cultivars + 24 wild materials) were uniformly raised in March and transplanted in April using a double-row planting pattern, with a plant spacing of 0.8 meters and a row spacing of 2 meters, and 30 plants per material. Fusarium oxysporum was inoculated during the flowering period.

[0023] Fusarium oxysporum (FON-Race2) was isolated and purified from diseased plants, cultured on PDA medium at 28°C for 5 days, and then a spore suspension (1×10⁻⁶) was prepared with sterile water. 6 CFU / mL

[0024] Dig a 10cm deep hole 5cm away from the main root of the plant, inject 20mL of spore suspension into each hole, cover with soil and then manage normally in the field.

[0025] 21 days after inoculation, plants are graded according to the following criteria: Grade 0: no symptoms; Grade 1: 1-2 lower leaves wither; Grade 3: half of the leaves turn yellow; Grade 5: stunted plant with wilted upper leaves; Grade 7: entire plant dies.

[0026] Twenty plants were randomly selected from each material, and the disease index was calculated: Disease index = Σ(disease grade × number of plants) / (highest disease grade × total number of plants) × 100. Twenty-five highly resistant materials with a disease index < 20 and twenty-five highly susceptible materials with a disease index > 80 were selected (Table 1).

[0027] Table 1: Results of Disease Resistance Identification in Watermelon Populations

[0028] Group type Number of materials Disease index range Average disease index High Antibody Group 25 12.3-19.8 16.5±2.7 High Sensitivity Group 25 81.5-92.6 86.3±4.9

[0029] Example 2: Microsatellite marker screening and verification

[0030] Twenty-five leaf samples each from the highly resistant and highly susceptible watermelon groups were collected. Genomic DNA was extracted from the watermelon leaves using a modified CTAB method. The specific procedure was as follows: 100 mg of young leaves were ground into a fine powder in liquid nitrogen, and 800 μL of preheated lysis buffer (containing 2% CTAB, 1.4 M NaCl, 20 mM EDTA, 100 mM Tris-HCl pH 8.0, and 1% β-mercaptoethanol) was added. The mixture was incubated at 65°C with shaking for 1 hour. After extraction with chloroform:isoamyl alcohol (24:1), the supernatant was added to 0.7 volumes of pre-cooled isopropanol at -20°C to precipitate the DNA. The mixture was washed twice with 70% ethanol (containing 10 mM NH4Ac) and finally dissolved in TE buffer. The DNA quality was determined by Nanodrop (A260 / A280 = 1.8-2.0) and Qubit quantification (≥50 ng / μL), meeting the requirements for subsequent experiments.

[0031] To address the interference characteristics of plant polysaccharides and polyphenols, the SSR-PCR reaction system was optimized as follows: 10 μL of Tiangen Plant-Specific 2×PCRMix (PC201) was used, along with 0.6 μL of 10 μM forward / reverse primers (synthesized by Shanghai Sangon Biotech), 100 ng of template DNA, 0.5 μL of LBSA (10 mg / mL, Sigma B9000S), and DEPC water to a final volume of 20 μL. The amplification program was set as follows: 94℃ pre-denaturation for 5 minutes; 35 cycles (94℃ for 30 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 45 seconds); and a final extension at 72℃ for 10 minutes.

[0032] The amplified products were separated using an 8% non-denaturing PAGE gel (acrylamide:methylene = 37.5:1) with 1×TBE as the electrophoresis buffer. Electrophoresis was performed at a constant voltage of 180V and a temperature of 4℃ using a cold water cycle for 1.5 hours. A three-step silver staining method was used for development: fixation with 10% ethanol + 0.5% glacial acetic acid for 10 minutes, staining with 0.2% AgNO3 + 0.056% formaldehyde for 15 minutes, and development with 3% Na2CO3 + 0.056% formaldehyde until the bands were clear.

[0033] The WM-08 locus, which was significantly associated with disease resistance, was screened from 15 SSR loci. Some microsatellite loci are shown in Table 2. Through population genetics analysis and phenotypic-genotypic association verification, the WM-08 locus was found to be significantly associated with watermelon wilt resistance. The chi-square test showed that the genotype distribution deviated significantly from random (χ²=58.37, p<0.001). The frequency of the 225 / 225 genotype in the disease-resistant group reached 84.0%, which was significantly higher than that in the susceptible group (Table 3).

[0034] Table 2: Information on some microsatellite primers for watermelon

[0035] Molecular marker sites Primer sequence Repeating primitives Amplified fragment (bp) Annealing temperature (°C) PIC value WM-01 F:TCAAATTGTGATCCGTACTCTR:CACCATTACAAAACATCACCT <![CDATA[(GA) n ]]> 150-180 55 0.62 WM-03 F:CTCATAAGTACCCCTGTGCTAR:AATACCCACGTAACATTTCTG <![CDATA[(AAAGT) n ]]> 140-180 57 0.58 WM-05 F:AACTGTGTCAAATGGTGATTCR:GGCCTATATGGTGTATGTTGT <![CDATA[(AT) n ]]> 140-170 58 0.71 WM-08 F:CCGGCCAGGATAATTGGGAAR:GGGCTCGTTGGGAAGAAAGA <![CDATA[(CT) n ]]> 220-230 58 0.82 WM-10 F:AGAACATGCCATAAGCATAACR:CACCTAGGCACATTGTAGTTC <![CDATA[(GTT) n ]]> 180-210 60 0.65 WM-12 F:TAAAGAAAACCGAACACAGTTR:TTTTCAGGAATTTACAACAGG <![CDATA[(GACA) n ]]> 140-155 56 0.74 WM-15 F:GTCCTCTGTTTCTGTTTCTCCR:CAGAAGGTTCTGAAGAAGTACC <![CDATA[(GGC) n ]]> 140-155 59 0.68

[0036] Table 3. Association data between WM-08 locus and watermelon Fusarium wilt phenotype.

[0037] genotype High-resistance group (25 samples) High sensitivity group (25 samples) Average disease index 225 / 225 21(84.0%) 1(4.0%) 15.3±2.1 225 / 227 3(12.0%) 6(24.0%) 43.5±3.8 227 / 227 1(4.0%) 18(72.0%) 82.7±5.3

[0038] Sequencing of the WM-08 site revealed a 225bp allele containing a (CT)4 repeat located 1.2kb upstream of the disease resistance gene Cla97C10G195200 in the regulatory region. Bioinformatics prediction showed that (CT)4 forms a special secondary structure that enhances the binding ability of WRKY transcription factors.

[0039] The microsatellite locus WM-08 was screened to identify dominant genes associated with resistance to Fusarium oxysporum in watermelon. The nucleotide sequence of microsatellite locus WM-08 is as follows:

[0040] GTACAAGTGCTGCGTACAAGTTCCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACAT(CT) nATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTCTTCCCAACGAGCCCATTTTCTTTTGATTTGGAAGACGGGCGTTGCGTTCGAAAG;

[0041] The primer pair sequences used for this satellite site are as follows:

[0042] Forward primer F: CCGGCCAGGATAATTGGGAA (SEQ ID NO:2)

[0043] Reverse primer R: GGGCTCGTTGGGAAGAAAGA (SEQ ID NO:3).

[0044] Its core repeat unit is (CT)n, which is amplified using upstream and downstream primers of SEQ ID NO:2 and SEQ ID NO:3. There are three genotypes: 225 / 225, 225 / 227 and 227 / 227. Among them, 225 / 225 is the dominant gene, and the specific band amplified is 225bp.

[0045] Example 3: Application of Molecular Marker-Assisted Breeding

[0046] In March 2024, molecular marker-assisted breeding research was conducted at the watermelon breeding base. A segregating F2 population of 560 plants was constructed using a susceptible variety (genotype 227 / 227) as the female parent and the highly resistant germplasm "Kangyuan 8" (genotype 225 / 225) as the male parent. Genomic DNA was extracted from young leaves at the three-leaf stage and amplified using the methods described in the examples. The results showed that the 225 / 225 homozygous population accounted for 24.6%, the 225 / 227 heterozygous population accounted for 50.4%, and the 227 / 227 homozygous population accounted for 25.0% (Table 4 and...). Figure 1 ).

[0047] In areas severely affected by Fusarium wilt, the screening group (type 225 / 225) and the ordinary plant group (type 227 / 227) were inoculated with Fusarium oxysporum for verification. During the flowering period, the spore suspension (1×10⁻⁶) was inoculated using the root wound irrigation method. 6 (CFU / mL) A survey conducted 21 days post-inoculation revealed that the vascular bundles of plants in the screening group showed only slight browning, with a disease index of 18.7±3.1 and a mortality rate of 1.8%; while the control group exhibited severe vascular bundle necrosis, with a disease index of 77.8±6.4 and a mortality rate as high as 62.1% (Table 5 and...). Figure 2The detection of defensive enzyme activities showed that the POD, SOD and PAL enzyme activities (Table 6) of the screening group reached 362.5 U / g, 285.4 U / g and 12.8 μmol / g / h, respectively, 7 days after inoculation, which was more than 95% higher than that of the control group.

[0048] The 138 selected 225 / 225 type plants were self-pollinated in an isolation area to obtain 200 offspring plants. Genetic testing was used to screen for plants carrying the 225 / 225 genotype. Under the same disease stress, the disease index of the offspring population (Table 5) was 19.3±3.2, and the mortality rate was 2.1%, which was not significantly different from the parent population (p>0.05). Follow-up for two consecutive generations showed stable inheritance of disease resistance, with the disease index of the second generation remaining at 18.9±2.8.

[0049] Table 4: Genotype distribution of WM-08 locus in F2 population

[0050] genotype Number of plants Proportion(%) 225 / 225 138 24.6 225 / 227 282 50.4 227 / 227 140 25

[0051] Table 5: Comparison of disease resistance performance 21 days after vaccination

[0052] generations Disease index vascular bundle browning rate (%) Mortality rate (%) Parent generation 18.7±3.1 16.3±3.5 1.8 First generation 19.3±3.2 17.8±3.1 2.1 Second generation 18.9±2.8 16.9±2.7 1.9

[0053] Table 6: Table of defensive enzyme activities

[0054] Enzyme activity indicators Screening group Normal Group Increase POD(U / g FW) 362.5±28.7 185.3±22.4 95.60% SOD(U / g FW) 285.4±21.6 142.8±18.9 99.90% PAL (μmol / g FW / h) 12.8±1.2 6.3±0.9 103.20%

[0055] In summary, this invention enables precise and efficient breeding of disease-resistant watermelon plants based on the WM-08 molecular marker, significantly shortening the breeding cycle. The selected plants and their progeny maintain stable resistance in severely diseased areas, greatly reducing the damage caused by Fusarium wilt.

Claims

1. A microsatellite locus associated with disease resistance traits in watermelon, characterized in that, The nucleotide sequence of the microsatellite locus is as follows; GTACAAGTGCTGCGTACAAGTTCCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACAT(CT) n ATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTCTTCCCAACGAGCCCATTTTTCTTTTGATTTGGAAGACGGGCGTTGCGTTCGAAAG; wherein n is a natural number from 4 to 6.

2. The application of the microsatellite loci described in claim 1 as molecular markers in the selection of watermelon parents with resistance to Fusarium wilt.

3. A method for screening disease-resistant watermelon parents, characterized in that, The method described herein is to screen individuals whose microsatellite loci have been CT repeated 4 times as described in claim 1.

4. The method as described in claim 3, characterized in that, The method involves amplifying the nucleic acid sample of the watermelon plant to be tested by PCR, and then determining the genotype of the plant by gel electrophoresis of the PCR product.

5. The method as described in claim 4, characterized in that, The primer sequences used in the PCR amplification are SEQ ID NO:2 and SEQ ID NO:

3.

6. The method as described in claim 4, characterized in that, The gel electrophoresis typing was performed on plants with genotype 225 / 225.

7. The method as described in claim 6, characterized in that, The microsatellite locus sequence of the plant with genotype 225 / 225 is SEQ ID NO:1.

Citation Information

Patent Citations

  • SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof

    CN103146691A

  • Method for cultivating watermelon variety with high resistance to fusarium wilt

    CN110622852A

  • Method for Forming Thin Film, and Method and Apparatus for Processing Substrate

    KR1020230173606A

  • Combining fusarium 2 resistance gene (FON2) and red flesh in watermelon

    US20150101072A1