Lactobacillus acidophilus PIS4 capable of improving dysmenorrhea and application of lactobacillus acidophilus PIS4

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses lactobacillus acidophilus PIS4 capable of improving dysmenorrhea and application of the lactobacillus acidophilus PIS4. The lactobacillus acidophilus PIS4 is separated from genital tracts of healthy women, and is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.34554, and the preservation date is May 15, 2025. The lactobacillus acidophilus PIS4 is used for preparing the lactobacillus acidophilus PIS4. The lactobacillus acidophilus strain PIS4 provided by the invention is proved to be capable of inhibiting the gene expression of prostaglandin E synthase 2 (pges-2) and reducing the synthesis of prostaglandin E2 and prostaglandin F2alpha, and has effective relieving and improving effects on primary dysmenorrhea.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, and in particular to a lactobacillus acidophilus PIS4 capable of improving dysmenorrhea and its application. BACKGROUND

[0002] Dysmenorrhea, i.e. the pain symptoms occurring before or after menstruation or during the menstrual period, is a common gynecological problem in women of childbearing age, with a high incidence, which seriously affects the quality of life, work efficiency and physical and mental health of patients. Moderate to severe dysmenorrhea can lead to decreased activity, increased absenteeism, impaired sleep quality, and long-term recurrent episodes may be accompanied by emotional disorders such as anxiety and depression.

[0003] The first-line treatment for dysmenorrhea in clinical practice currently mainly includes non-steroidal anti-inflammatory drugs (NSAIDs) and hormone drugs (such as oral contraceptives). Although these drugs can relieve pain to some extent, there are still many limitations: NSAIDs are often accompanied by adverse reactions such as gastrointestinal irritation and kidney function damage, and the efficacy is not significant for some patients; hormone therapy is not suitable for women with contraindications such as thrombosis risk or recent fertility plans. Therefore, developing a new type of dysmenorrhea relief strategy that is safe, effective and easy for patients to accept has become an urgent need in clinical and market.

[0004] In recent years, probiotics have been considered as one of the new emerging solutions for improving chronic discomfort symptoms due to their good safety and potential effects on immune regulation and anti-inflammatory. However, the application of probiotics to the prevention and treatment of dysmenorrhea still faces significant challenges. The functions of existing commercially available probiotic strains are mainly focused on the regulation of intestinal health, and lack of specific effects on the pathological characteristics of dysmenorrhea (such as prostaglandin-mediated uterine smooth muscle spasm), making it difficult to meet the actual needs of patients with dysmenorrhea.

[0005] Although some studies have shown that certain lactobacillus acidophilus can improve intestinal function-related abdominal pain, dysmenorrhea and intestinal pain have essential differences in pathogenesis and clinical manifestations. Dysmenorrhea is mainly related to excessive synthesis and release of prostaglandins in the endometrium during menstruation, causing strong contraction of uterine smooth muscle, with clear pain location, and the main feature is periodic and spastic lower abdominal pain, which can radiate to the lumbosacral region, and is generally not accompanied by intestinal symptoms. Therefore, strains suitable for intestinal health may not be effective in intervening in dysmenorrhea.

[0006] In summary, there is still a lack of specific strains with clear efficacy and mechanism targeting the pathological characteristics of dysmenorrhea. Therefore, there is an urgent need in the field to provide a safe, effective and non-drug microbial intervention solution to fill the gap in current dysmenorrhea treatment strategies. SUMMARY

[0007] To address the problems existing in the prior art, the purpose of this invention is to provide a strain of Lactobacillus acidophilus PIS4 that can improve dysmenorrhea, offering a non-drug solution for female patients with dysmenorrhea.

[0008] To achieve the objectives of this invention, the technical solution is as follows: In a first aspect, the present invention provides a strain of Lactobacillus acidophilus ( Lactobacillus acidophilus PIS4, the Lactobacillus acidophilus ( Lactobacillus acidophilus PIS4 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34554 and deposit date of May 15, 2025.

[0009] In a second aspect, the present invention provides a composition containing the aforementioned Lactobacillus acidophilus PIS4.

[0010] Furthermore, the composition is a microbial preparation, and the viable count of Lactobacillus acidophilus PIS4 in the microbial preparation is not less than 1 × 10⁻⁶. 10 CFU / mL or 1×10 10 CFU / g.

[0011] Thirdly, the present invention provides a product containing the Lactobacillus acidophilus PIS4.

[0012] Furthermore, the product is a pharmaceutical, food, or health supplement. The product form includes, but is not limited to, tablets, powders, and liquid formulations.

[0013] Fourthly, the present invention provides the effect of the Lactobacillus acidophilus PIS4 in inhibiting prostaglandin E synthase 2 (… pges-2 Applications in gene expression.

[0014] Fifthly, the present invention provides the application of the Lactobacillus acidophilus PIS4 in reducing prostaglandin synthesis.

[0015] Furthermore, the prostaglandin is prostaglandin E2 and / or prostaglandin F2α.

[0016] In a sixth aspect, the present invention provides the use of the Lactobacillus acidophilus PIS4 in the preparation of pharmaceuticals, foods or health products that inhibit prostaglandin synthesis.

[0017] In a seventh aspect, the present invention provides the application of the Lactobacillus acidophilus PIS4 in the preparation of medicines, foods or health products for relieving dysmenorrhea.

[0018] The beneficial effects of this invention are as follows: This invention isolates and provides a strain of Lactobacillus acidophilus, PIS4, which has been shown in animal experiments to reduce the perception of severe and mild pain in Caenorhabditis elegans, reduce the expression of prostaglandin E synthase 2 gene, and reduce prostaglandin levels in rats.

[0019] Short-term and long-term population intervention trials have demonstrated that after taking the Lactobacillus acidophilus PIS4 probiotic powder provided by this invention, volunteers experienced a reduction in dysmenorrhea and reduced or discontinued the use of analgesics. This proves that Lactobacillus acidophilus PIS4 can provide a safe, effective, and easy-to-adhere-to non-drug treatment option for women suffering from dysmenorrhea, with significant application potential. Attached Figure Description

[0020] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 This is a single colony morphology diagram of Lactobacillus acidophilus PIS4.

[0023] Figure 2 Gram-stained microscopic image of Lactobacillus acidophilus PIS4.

[0024] Figure 3 The Caenorhabditis elegans in the control group and probiotic group of Example 3. pges-2 A comparison chart of gene expression levels. Detailed Implementation

[0025] To better understand the above-mentioned objectives, features, and advantages of the present invention, the present invention will be further described below.

[0026] Many specific details are set forth in the following description in order to provide a full understanding of the invention, but the invention may also be practiced in other ways different from those described herein; obviously, the embodiments in the specification are only some embodiments of the invention, and not all embodiments.

[0027] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0030] Example 1: Origin, isolation, and identification of Lactobacillus acidophilus PIS4

[0031] The Lactobacillus acidophilus PIS4 of this invention was isolated from the reproductive tract of a healthy woman and was deposited on May 15, 2025, at the China General Microbiological Culture Collection Center (address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 34554.

[0032] The isolation procedure was as follows: Vaginal secretions were collected from healthy women and enriched in MRS medium under anaerobic conditions at 37°C for 24 hours. The enriched culture was then diluted and spread onto MRS agar plates. Single colonies were picked and inoculated into liquid MRS medium for further incubation at 37°C under anaerobic conditions for 24 hours.

[0033] Among them, MRS medium is a well-known culture medium in the field of this technology. Its formula is as follows: per liter of medium, it contains 10.0 g of peptone, 8.0 g of beef meal, 4.0 g of yeast powder, 20.0 g of glucose, 2.0 g of dipotassium hydrogen phosphate, 2.0 g of diammonium hydrogen citrate, 5.0 g of sodium acetate, 0.2 g of magnesium sulfate, 0.04 g of manganese sulfate, 1.0 g of Tween 80, 1000 g of water, and a pH value of 5.5-6.0.

[0034] The isolated *Lactobacillus acidophilus* PIS4 was cultured at 37°C in anaerobic conditions on MRS medium. Its colony morphology consisted of light cream-colored, round, opaque colonies with a smooth, moist surface, slightly convex or cushion-like structure, and regular edges. Figure 1 ).

[0035] Gram staining was performed on Lactobacillus acidophilus PIS4 culture medium. Microscopic examination showed that the strain was Gram-positive, rod-shaped, single, paired, or in short chains, without flagella, without spores, and without motility. Figure 2 ).

[0036] Lactobacillus acidophilus PIS4 culture medium was used to amplify the bacterial 16S rRNA gene fragment using PCR technology. The sequencing sequence of the amplified product is shown in SEQ ID No. 1. The sequencing results were submitted to the NCBI database for online comparison, and the comparison result was Lactobacillus acidophilus (… Lactobacillus acidophilus The strain was named Lactobacillus acidophilus PIS4 ( Lactobacillus acidophilus PIS4).

[0037] Example 2: Lactobacillus acidophilus PIS4 modulates pain perception in Caenorhabditis elegans.

[0038] This embodiment uses the N2 strain of Caenorhabditis elegans to test the moderating effect of Lactobacillus acidophilus PIS4 on pain perception.

[0039] Strain culture: *Escherichia coli* OP50 was cultured in LB liquid medium, and *Lactobacillus acidophilus* PIS4 was cultured in MRS medium. After incubation at 37°C for 24 hours, the cultures were centrifuged, the supernatant was removed, and the cultures were resuspended in M9 medium until an OD600 absorbance of 30 was observed. The LB liquid medium formulation contained 10 g trypsin, 5 g yeast extract, and 5 g sodium chloride per liter, with a pH of 7.2.

[0040] Intervention groups: A mixed bacterial suspension (Lactobacillus acidophilus PIS4: Escherichia coli OP50 = 1:1) was added to NGM agar plates as the probiotic group; a control bacterial suspension (an equal volume of Escherichia coli OP50) was added to NGM agar plates as the control group. The NGM agar plate formulation was: 2.5 g / L tryptone, 3 g / L sodium chloride, 22 g / L agar, 25 g / L 1M phosphate buffer, 1 mmol / L calcium chloride, 1 mmol / L magnesium sulfate, and 5 μg / L cholesterol. pH 6.0.

[0041] Nematode culture: Synchronized L1-stage Caenorhabditis elegans were randomly and evenly inoculated onto probiotic and control plates and incubated at 20°C for 48 hours.

[0042] Pain perception test: After culture, two behavioral methods, intense pain perception and mild pain perception, were used to detect the behavioral perception of pain in *C. elegans*. Before testing, *C. elegans* were transferred to blank NGM agar plates and acclimatized at 20°C for 1 hour.

[0043] Intense pain sensation: Insert one end of a 2 cm long, 0.2 mm diameter platinum wire into a molten glass tube and fix it in place; press the other end into a flattened round shape. Use the prepared platinum wire needle to touch the hypopharyngeal region of *C. elegans* from top to bottom, and immediately record the response score of *C. elegans* after touch. Do not puncture the agar surface when touching downwards with the platinum wire needle. Test each nematode 3 times, with a 5-minute interval between each test. Test 20 nematodes per group.

[0044] Gentle pain response: Attach eyelashes horizontally to toothpicks using adhesive. Using the fixed eyelashes, gently touch the hypopharyngeal region of *C. elegans* from top to bottom, immediately recording the elegans' response score. Test each worm three times, with a 5-minute interval between tests. Test 20 worms per group.

[0045] The response of *Caenorhabditis elegans* was scored as follows: Level 1, the nematode reacts quickly and retreats a distance exceeding one times its body length; Level 2, the nematode reacts quickly and retreats a distance not exceeding one times its body length; Level 3, the nematode retreats slowly; Level 4, no response. The test results are shown in Table 1.

[0046] Table 1. Record of Pain Perception Test Results for Caenorhabditis elegans

[0047] Test results showed that Lactobacillus acidophilus PIS4 intervention reduced the perception of severe and mild pain in Caenorhabditis elegans.

[0048] Compared to the control group, when the nematodes in the probiotic group experienced severe pain, the proportion of those making a first-order response decreased from 95.00% to 83.33%, the proportion of those making a second-order response increased from 5.00% to 13.33%, and 3.33% of the nematodes made a third-order response of slow retreat.

[0049] Compared to the control group, when the nematodes in the probiotic group experienced mild pain, the proportion of those exhibiting a primary response decreased by 20%, the proportion exhibiting a secondary response increased by 8.33%, the proportion exhibiting a tertiary response increased by 8.34%, and 3.33% did not respond to mild pain.

[0050] Example 3: Lactobacillus acidophilus PIS4 inhibits the prostaglandin E synthase 2 gene of Caenorhabditis elegans ( pges-2 Regulation of expression Caenorhabditis elegans pges-2 The gene is a homolog of human prostaglandin E synthase 2 and is responsible for catalyzing the synthesis of prostaglandin E2.

[0051] *C. elegans* were collected from plates in the control and probiotic groups of Example 2. RNA was extracted using Trizol reagent, and then the mRNA was reverse transcribed into cDNA using a reverse transcription kit. Quantitative real-time PCR was used to analyze the two groups of *C. elegans*. pges-2 Gene expression level.

[0052] Quantitative pges-2 The primer sequences for the gene are: F: AGGCTTGTCGTGACTGGATG, R: GCATCCATTTTTCGCCACCA.

[0053] The primer sequences for the internal reference gene act are: F: CACGGTATCGTCACCAACTG, R: GCTTCAGTGAGGAGGACTGG.

[0054] The experimental results are shown in Figure 3 Compared with the control group, the probiotic group pges-2 Gene expression levels decreased by 42.77%. This indicates that intervention with Lactobacillus acidophilus PIS4 can reduce the synthesis of prostaglandin E2.

[0055] Example 4: Relief of primary dysmenorrhea in rats by Lactobacillus acidophilus PIS4 Eight-week-old female SD rats were randomly divided into three groups: normal group, model group, and probiotic group, with four rats in each group.

[0056] Rats in the probiotic group were orally administered Lactobacillus acidophilus PIS4 (1×10⁻⁶) 10 (CFU / kg / day) for three weeks. The normal group and the model group were administered an equal volume of physiological saline by gavage.

[0057] Two weeks after gavage, primary dysmenorrhea was induced in the model group and the probiotic group using drugs. The induction method was as follows: daily subcutaneous injection of estradiol benzoate (0.5 mg / kg), followed by intraperitoneal injection of oxytocin (25 IU / kg) one hour after estradiol benzoate administration on day 8. The number of writhing responses (abdominal contraction, retraction, trunk and hind limb extension) in rats was recorded within half an hour after oxytocin injection.

[0058] The rats were then euthanized, and their serum was collected and the levels of prostaglandin E2 and prostaglandin F2α were detected using an ELISA kit. The results are shown in Table 2.

[0059] Table 2 Results of rat primary dysmenorrhea relief experiment

[0060] After drug modeling, rats in the model group exhibited pain-related writhing responses, and serum prostaglandin E2 and F2α levels increased. Compared with the model group, the probiotic group showed a 47.95% decrease in the number of writhing responses, and a 22.08% and 31.05% decrease in prostaglandin E2 and F2α levels, respectively, indicating that Lactobacillus acidophilus PIS4 intervention can reduce prostaglandin levels in rats and has a significant effect on relieving dysmenorrhea.

[0061] Example 5: Human Trial of the Effect of Lactobacillus acidophilus PIS4 on Improving Dysmenorrhea To evaluate the effect of Lactobacillus acidophilus PIS4 on improving dysmenorrhea, a short-term probiotic intervention trial and a long-term probiotic intervention trial were conducted.

[0062] 1. Target audience The volunteers were women aged 18-40 years old who had a history of primary dysmenorrhea and needed to take pain medications such as nonsteroidal anti-inflammatory drugs regularly.

[0063] 2. Population intervention Production containing 1×10 10 CFU / g Lactobacillus acidophilus PIS4 probiotic powder, ready-to-eat sachets (2g / sachet).

[0064] Volunteers participating in the short-term probiotic intervention trial took one packet of ready-to-eat probiotic powder daily for one month.

[0065] Volunteers participating in the long-term probiotic intervention trial took one ready-to-eat probiotic powder sachet daily for two consecutive months.

[0066] 3. Assessment of the degree of pain improvement The numerical rating scale was used: 1 point, no change in pain; 2 points, pain reduced, reduce the dosage of analgesics or shorten the duration of pain; 3 points, pain significantly reduced, discontinue analgesics.

[0067] 4. Test Results (1) Results of short-term human intervention trial of probiotics Eleven volunteers completed the trial, taking probiotics continuously for one month and completing a questionnaire assessment. Four volunteers reported no change in pain (36%); five reported reduced pain, allowing them to reduce the dosage of analgesics or shorten the duration of pain (45%); and two reported significant pain reduction, discontinuing analgesics (18%). The percentage of volunteers who experienced effective improvement in dysmenorrhea (scoring 2 or 3 points) was 64%.

[0068] Follow-up was conducted on the participants after the intervention ended. In the next menstrual cycle after discontinuing probiotics, 5 participants reported no change in pain; 4 participants reported reduced pain, allowing them to reduce the dosage of analgesics or shorten the duration of pain; and 2 participants reported significant pain reduction and discontinued analgesics. Only 1 participant's score decreased from 2 to 1. The percentage of participants who experienced effective improvement in dysmenorrhea (scoring 2 or 3) was 55%.

[0069] Table 3. Pain assessment results of the short-term probiotic intervention trial (total participants: 11)

[0070] (2) Results of long-term human intervention trial of probiotics A total of 24 volunteers completed the trial, taking probiotics continuously for 2 months and completing a questionnaire assessment. After 2 months of probiotic use, 5 volunteers reported no change in pain (21%); 7 volunteers reported reduced pain, allowing them to reduce the dosage of analgesics or shorten the duration of pain (29%); and 12 volunteers reported significant pain reduction and discontinued analgesics (50%). The percentage of volunteers who reported effective improvement in dysmenorrhea (scoring 2 or 3) was 79%. Compared to a short-term intervention of 1 month, a long-term intervention of 2 months resulted in a higher percentage of participants experiencing significant pain reduction, thus increasing the effective improvement rate of dysmenorrhea.

[0071] Follow-up visits were conducted after the intervention. In the next menstrual cycle after discontinuing probiotics, 6 participants reported no change in pain; 8 participants reported reduced pain, allowing them to reduce the dosage of analgesics or shorten the duration of pain; and 10 participants reported significant pain reduction, allowing them to discontinue analgesics. The percentage of participants who showed effective improvement in dysmenorrhea (scoring 2 or 3 points) was 75%, which is still a higher percentage of effective improvement compared to the results of short-term interventions.

[0072] Table 4. Pain assessment results of the long-term probiotic intervention trial (total participants: 24)

[0073] The results of the short-term and long-term intervention trials show that, in terms of effectiveness, the effect of Lactobacillus acidophilus PIS4 probiotic powder in improving dysmenorrhea increases with the duration of use, reaching an effective rate of 79% in the 2-month intervention period. Regarding persistence, the effect of Lactobacillus acidophilus PIS4 probiotic powder does not disappear upon discontinuation; it can still effectively relieve and improve dysmenorrhea pain in the next menstrual cycle after stopping the intervention.

[0074] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments described herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Lactobacillus acidophilus ( Lactobacillus acidophilus PIS4, characterized in that, The Lactobacillus acidophilus ( Lactobacillus acidophilus PIS4 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34554 and deposit date of May 15, 2025.

2. A composition containing Lactobacillus acidophilus PIS4 as described in claim 1.

3. The composition according to claim 2, characterized in that, The composition is a microbial preparation, and the viable count of Lactobacillus acidophilus PIS4 in the microbial preparation is not less than 1×10⁻⁶. 10 CFU / mL or 1×10 10 CFU / g.

4. A product characterized in that, The product contains Lactobacillus acidophilus PIS4 as described in claim 1.

5. The product according to claim 4, characterized in that, The product in question is a pharmaceutical, food, or health supplement.

6. The Lactobacillus acidophilus PIS4 of claim 1 in inhibiting prostaglandin E synthase 2 (… pges-2 Applications in gene expression.

7. The use of Lactobacillus acidophilus PIS4 as described in claim 1 in reducing prostaglandin synthesis.

8. The application according to claim 7, characterized in that, The prostaglandin is prostaglandin E2 and / or prostaglandin F2α.

9. The use of Lactobacillus acidophilus PIS4 as described in claim 1 in the preparation of pharmaceuticals, food or health products that inhibit prostaglandin synthesis.

10. The use of Lactobacillus acidophilus PIS4 as described in claim 1 in the preparation of medicines, foods or health products for relieving dysmenorrhea.

Images