A recombinant Pichia pastoris strain, its construction method and application

By introducing the ACSec gene to construct a recombinant Pichia pastoris strain x-33-ACSec, the problem of low acetic acid utilization efficiency was solved, and the growth and product synthesis capabilities in a high-concentration acetic acid environment were improved, expanding its application in biomanufacturing.

CN121320407BActive Publication Date: 2026-06-30NANJING SHIQI BIOCHEMICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511903257.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-17
Publication Date
2026-06-30
Estimated Expiration
2045-12-17

Smart Images

  • Figure CN121320407B_ABST
    Figure CN121320407B_ABST
Patent Text Reader

Abstract

A recombinant Pichia pastoris strain, its construction method, and its applications belong to the field of microbial fermentation. The construction method is as follows: using pGAPZB as the plasmid backbone, a recombinant expression plasmid pGAPZB-ACSec containing the ACSec gene is constructed. The sequence of the ACSec gene is shown in SEQ ID No. 1. The recombinant expression plasmid is linearized and transformed into a Pichia pastoris host. Pichia pastoris strains capable of expressing the ACSec gene are screened. This invention improves the ability of Pichia pastoris to utilize acetic acid for growth and metabolism, demonstrating the application potential of Pichia pastoris in the fermentation production and synthesis of chemical products using acetic acid as a precursor using inexpensive carbon sources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation, specifically to a recombinant Pichia pastoris strain, its construction method, and its application. Background Technology

[0002] Single-cell protein (SCP), as a novel protein source, is becoming an ideal alternative to human diets and animal feed. SCP is produced by algal (approximately 60-70% protein), fungal (approximately 30-50% protein), and bacterial (approximately 50-80% protein) cells. The unique substrate utilization capabilities (such as carbon dioxide or methanol) and high growth rates of these microorganisms make SCP production more efficient and sustainable than traditional agriculture. To achieve carbon source sustainability and cost reduction, utilizing inexpensive or waste carbon sources has become an important research direction in industrial biotechnology. Unconventional carbon sources such as acetate, methanol, and syngas, as promising substrates for industrial biomanufacturing, can serve as potential raw materials for the production of SCP by different microbial strains.

[0003] For decades, microorganisms have been widely used as chassis cells in the production of various bulk and fine chemicals. Pichia pastoris, using methanol as a raw material to produce extracellular proteins (SCPs), has been widely applied in the industrial production of recombinant proteins. Traditional Pichia pastoris fermentation processes primarily rely on glucose, glycerol, or methanol as carbon and energy sources. However, the cost of glucose and glycerol fluctuates significantly, and natural Pichia pastoris suffers from a complex methanol metabolism pathway and the toxicity of intracellular formaldehyde, resulting in low methanol utilization, which is detrimental to the synthesis of the target product. These factors, to some extent, limit the economic viability and safety of its industrial applications.

[0004] Acetic acid (C2H4O2) is an organic acid, an important platform compound, and a widely available and inexpensive chemical raw material. In industry, it is mainly produced from syngas obtained from inexpensive chemical fuels, followed by the biocatalytic or chemical catalytic conversion of acetic acid, or by directly converting methane into acetic acid through chemical catalysis. It is also abundant in lignocellulose hydrolysate, syngas fermentation broth, and various industrial wastewaters, making it a highly promising alternative carbon source. In microorganisms, acetic acid can be catalytically converted into acetyl-CoA, which can serve as a precursor for the synthesis of various bulk and fine chemicals, showing great application potential. However, biological processes using acetic acid as a carbon source and precursor primarily utilize *E. coli* as the host, while yeast as the chassis cell is relatively rare. Wild-type *Pichia pastoris* generally has low acetic acid utilization efficiency. Therefore, there is an urgent need in this field to find a recombinant strain and a matching fermentation process that can significantly improve its acetic acid utilization efficiency, tolerance, and target product synthesis ability, in order to expand the application prospects of *Pichia pastoris* in low-cost biomanufacturing. Summary of the Invention

[0005] Technical problem to be solved: In view of the problems of limited acetic acid utilization and slow growth of Pichia pastoris in the existing technology, this invention proposes a recombinant Pichia pastoris strain, its construction method and application, to improve the growth and product synthesis ability of Pichia pastoris in an acetic acid-containing environment.

[0006] Technical solution: The first objective of this invention is to provide a method for constructing a recombinant Pichia pastoris strain, the steps of which are as follows:

[0007] Step 1: Using pGAPZB as the plasmid backbone, construct the recombinant expression plasmid pGAPZB-ACSec containing the ACSec gene. The sequence of the ACSec gene is shown in SEQ ID No. 1.

[0008] Step 2: Linearize the recombinant expression plasmid pGAPZB-ACSec and transform it into Pichia pastoris host;

[0009] Step 3: Screen for Pichia pastoris strains that can express the ACSec gene.

[0010] Preferably, in step one, when constructing the recombinant plasmid pGAPZB-ACSec containing the ACSec gene, primers ACSec-F and ACSec-R are used to amplify the ACSec gene. The sequence of ACSec-F is shown in SEQ ID No. 3, and the sequence of ACSec-R is shown in SEQ ID No. 4.

[0011] Preferably, in step one, when constructing the recombinant plasmid pGAPZB-ACSec containing the ACSec gene, the amplified fragment ACSec and the backbone plasmid pGAPZB are digested with restriction endonucleases Xho I and EcoRI, and then ligated overnight with T4 ligase after recovery.

[0012] Preferably, the Pichia pastoris host is Pichia pastoris x-33.

[0013] Preferably, the conversion method in step two is electroconversion.

[0014] The second objective of this invention is to provide a recombinant Pichia pastoris strain constructed based on the above-described method.

[0015] A third objective of this invention is to provide the application of the above-mentioned recombinant Pichia pastoris strain in the fermentation target product.

[0016] Preferably, the target product is biofuel, single-cell protein, or organic acid.

[0017] Preferably, the fermentation is carried out in a culture medium containing acetic acid.

[0018] Preferably, the concentration of acetic acid in the culture medium is 1-15 g / L.

[0019] Beneficial effects:

[0020] This invention successfully constructed a recombinant Pichia pastoris strain, x-33-ACSec, by introducing the exogenous ACSec gene into the original Pichia pastoris strain x-33. Experiments showed that this strain, compared to the original Pichia pastoris strain x-33, could still grow normally in media containing high concentrations of acetic acid (e.g., 15 g / L), exhibiting significantly improved acetic acid tolerance. This lays the foundation for the application of this strain in industrial bio-fermentation (such as the production of biofuels, single-cell proteins, and organic acids) using acetic acid as a carbon source or under acetic acid stress, and has significant industrial value. Attached Figure Description

[0021] Figure 1 This is the spectrum of the recombinant plasmid pGAPZB-ACSec.

[0022] Figure 2 The images show agarose gel electrophoresis patterns of the enzyme-digested plasmid pGAPZB and the PCR-amplified ACSec gene fragment. Lane 1 is the marker, lanes 2-3 are the pGAPZB plasmid, and lanes 4-5 are the ACSec gene fragment.

[0023] Figure 3 This is a graph showing the results of fermentation of strain x-33-ACSec and strain x-33 in a shake flask for 72 h.

[0024] Figure 4 The results are from the fermentation of strain X-33 in shake flasks at different acetic acid concentrations for 72 h. Detailed Implementation

[0025] The present invention will be further described below with reference to specific embodiments.

[0026] Unless otherwise specified, the experimental methods described in the embodiments of this specification are conventional methods; unless otherwise specified, the reagents or consumables described are commercially available.

[0027] In the examples provided in this specification, LB medium was used for the culture and screening of Escherichia coli. The formulation of LB medium is: yeast extract 5 g·L⁻¹ -1 Tryptone 10 g·L -1 NaCl 10 g·L -1 Add 20 g·L⁻¹ agar powder when preparing solid culture medium. -1 .

[0028] Yeast culture media include YPD, MD, and BMMY media.

[0029] YPD medium: yeast extract 10 g·L -1 Tryptone 20 g·L -1 20 g·L glucose -1 Add 20 g·L⁻¹ agar powder when preparing solid culture medium. -1 .

[0030] 10×MD liquid medium: 26.7 g MD powder was added to 100 mL of deionized water, dissolved by gentle heating, sterilized by filtration through a 0.22 μm filter, and stored at 4 ℃. Solid medium: 2 wt% agar.

[0031] BMMY liquid medium: 20 g / L peptone, 10 g / L yeast extract, 10% (v / v) 1 M potassium phosphate buffer (pH 6.0), sterilized at 121°C for 20 min and stored at room temperature. Before use, add 10% (v / v) 10×YNB, 2‰ (wt / v) biotin, and 0.5% (v / v) methanol.

[0032] Example 1 Construction and screening of recombinant Pichia pastoris strains

[0033] The specific steps are as follows:

[0034] Step 1: Construction of plasmid pGAPZB-ACSec;

[0035] 1.1 Design and synthesis of target gene sequences:

[0036] The ACSec sequence from GeneBank (GenBank: CAD6022819.1) was used to synthesize a codon-optimized gene sequence for Pichia pastoris, tailored to its codon bias. The specific sequence is as follows:

[0037] The nucleotide sequence encoding ACSec is as follows:

[0038]

[0039] The amino acid sequence of ACSec is as follows:

[0040] MSQIHKHTIPANIADRCLINPQQYEAMYQQSINAPDTFWGEQGKILDWIKPYQKVKNTSFAPGNVSIKWYEDGTLNLAANCLDRHLQENGDRTAIIWEGDDASQSKHISYKELHRDVCRFANTLLELGIKKGDVVAIYMPMVPEAAVAMLACARIGAVHSVIFGGFSPEAVAGRIIDSNSRLVITSDEGVRAGRSIPLKKNVDDALKNPNVTSVEHVVVLKRTGGKIDWQEGRDLWWHDLVEQASDQHQAEEMNAEDPLFILYTSGSTGKPKGVLHTTGGYLVYAALTFKYVFDYHPGDIYWCTADVGWVTGHSYLLYGPLACGATTLMFEGVPNWPTPARMAQVVDKHQVNILYTAPTAIRALMAEGDKAIEGTDRSSLRILGSVGEPINPEAWEWYWKKIGNEKCPVVDTWWQTETGGFMITPLPGATELKAGSATRPFFGVQPALVDNEGNPLEGATEGSLVITDSWPGQARTLFGDHERFEQTYFSTFKNMYFSGDGARRDEDGYYWITGRVDDVLNVSGHRLGTAEIESALVAHPKIAEAAVVGIPHNIKGQAIYAYVTLNHGEEPSPELYAEVRNWVRKEIGPLATPDVLHWTDSLPKTRSGKIMRRILRKIAAGDTSNLGDTSTLADPGVVEKLLEEKQAIAMPS (SEQ ID No.2).

[0041] 1.2 Construction of recombinant plasmid pGAPZB-ACSec:

[0042] The synthesized ACSec target gene sequence was amplified by PCR. The synthesized target gene plasmid was used as a template, and the primers were ACSec-F (SEQ ID No. 3: CCGGAATTCATGTCTCAAATACATAAACACAC) and ACSec-R (SEQ ID No. 4: CCGCTCGAGTCACGATGGCATGGCG). The fragment ACSec and the backbone plasmid pGAPZB (purchased from Thermo Fisher Scientific) were digested with restriction endonucleases Xho I and EcoRI. The plasmid backbone was subjected to nucleic acid electrophoresis, and after recovery, the linearized backbone and ACSec fragment were ligated overnight with T4 ligase to obtain the recombinant plasmid pGAPZB-ACSec.

[0043] The PCR amplification methods are shown in Table 1 below:

[0044] Table 1

[0045]

[0046] PCR reaction conditions: pre-deformation at 98℃ for 3 min, denaturation at 98℃ for 10 s, annealing at 55℃ for 5 s, extension at 72℃ for 2 min, 30 cycles, extension at 72℃ for 5 min, and finally hold at 12℃.

[0047] The specific enzyme digestion process is as follows:

[0048] Add the following ingredients sequentially according to the reaction system, as shown in Table 2 below:

[0049] Table 2

[0050]

[0051] The enzyme digestion system was placed in a 37°C water bath for at least 30 min. After digestion, gel electrophoresis was performed (120 V for 20 min). The gel containing the target DNA fragment was rapidly excised under UV light, and excess gel was removed as much as possible. Gel recovery was performed according to the Nanjing Novizan gel recovery kit. After gel recovery, the concentration was measured using an ultra-micro UV spectrophotometer to obtain the linearized vector and the target gene.

[0052] After recovery, ligation was performed overnight using T4 ligase, as detailed below:

[0053] Add according to the following system, see Table 3 below:

[0054] Table 3

[0055]

[0056] The molar ratio of plasmid backbone to fragment was between 1:3 and 1:10. After incubation at 37°C for 30 min, the ligation product (pGAPZB-ACSec) was transformed into E. coli TOP10 (purchased from Sangon Biotech). The method was as follows: the above ligation product (pGAPZB-ACSec) was mixed with 100 μL of E. coli TOP10 competent cells, placed on ice for 25 min, then heat-shocked at 42°C for 1.5 min, and then placed on ice to cool for 1-2 min. 1 mL of LB medium was added, and the cells were cultured at 37°C and 220 rpm for 1 h with shaking. 100 μL of the culture was then plated on LB medium plates containing Zeocin resistance (concentration of 100 μg / mL) and cultured at 37°C overnight. Positive transformants containing pGAPZB-ACSec were obtained and identified by salI restriction enzyme digestion. Gel electrophoresis showed a 1 kb band. Sequencing by Sangon Biotech confirmed the presence of the recombinant plasmid pGAPZB-ACSec. The pGAPZB-ACSec recombinant plasmid pattern can be found in the image below. Figure 1 See the gel electrophoresis patterns of pGAPZB digestion and ACSec amplification by PCR. Figure 2 .

[0057] Step 2: Construction of recombinant Pichia pastoris strain x-33-ACSec;

[0058] The recombinant plasmid pGAPZB-ACSec was linearized by Xba I restriction enzyme digestion to obtain a purified linear DNA fragment (linearized DNA), which was then transformed into Pichia pastoris x-33 (purchased from Kanglang Biotechnology Co., Ltd.) by electroporation. The Pichia pastoris x-33 glycerol strain was activated by streaking on YPD plates for 2-3 days until clear colonies were visible. Single colonies were inoculated into 5 mL of YPD liquid medium and cultured overnight at 30°C. A culture with OD600 = 0.1-0.2 was inoculated into 100 mL of YPD liquid medium and cultured at 30°C until OD600 = 1.0-1.5. The cultured strain was aliquoted into two pre-sterilized and pre-chilled 50 mL centrifuge tubes, centrifuged at 4000 rpm for 5 min at 4°C, and the supernatant was discarded. The bacterial pellet was resuspended in 30 mL of pre-chilled sterile water; centrifuged at 4000 rpm for 5 min at 4°C, and the supernatant was discarded (repeated twice). The pellet was then resuspended in 25 mL of pre-chilled 1... The bacterial cell pellet was resuspended in 1 M sorbitol solution and incubated with shaking at 30°C for 5 min. The pellet was then centrifuged at 4000 rpm for 5 min at 4°C, and the supernatant was discarded. 10 mL of pre-chilled 1 M sorbitol was added, and the bacterial cells were gently resuspended. The pellet was centrifuged at 5000 rpm for 5 min at 4°C, and the supernatant was gently discarded. A 100 μL or 200 μL pipette was used to carefully aspirate and discard any remaining liquid around the bacterial cells. The bacterial cell pellet was resuspended in 200 μL of pre-chilled 1 M sorbitol solution. 80 μL of the bacterial suspension was aliquoted into 1.5 mL EP tubes and kept on ice. 80 μL of the previously prepared cell suspension was taken, and 1–10 µg of linearized DNA was added. Then, an appropriate amount of TE buffer was added to bring the total volume to 100 μL, and the mixture was gently mixed. The mixture was then transferred to different 0.2 cm (pre-chilled) electroporation cuvettes and kept on ice for 5 min. Electroporation was performed at 1.5 kV, 25 µF, 200 Ω, and a pulse duration of 5 ms. Immediately after electroporation, the electroporation vessel was transferred to a clean bench, and 1 mL of ice-cold sorbitol (1 M) was quickly added. The mixture was carefully pipetted and then all the liquid was aspirated and transferred to a clean, sterile 1.5 mL EP tube. The tube was incubated at 30°C for 1.5–2 h. After centrifugation at 4000 rpm for 1 min, 600 μL of supernatant was discarded, and 150–200 μL of the supernatant was evenly spread onto MD selection plates. The plates were inverted and incubated at 30°C for 2–3 days, after which the growth of transformants was observed. Transformants were picked and cultured in 5 mL of YPD liquid at 30°C for 16 h. The genome of the recombinant strain was extracted. Using the genome as a template, PCR was performed to verify whether the target gene was integrated into the genome of Pichia pastoris (verification primers ACSec-F and ACSec-R). The appearance of a 2 kb target band on electrophoresis indicated correct integration, and the recombinant Pichia pastoris strain x-33-ACSec was obtained.

[0059] Example 2 Acetic acid tolerance test of recombinant Pichia pastoris strain

[0060] The specific steps for testing the acetic acid tolerance of the recombinant Pichia pastoris strain x-33-ACSec prepared in Example 1 in a 250 mL shake flask are as follows:

[0061] Single colonies of the recombinant Pichia pastoris strain x-33-ACSec were selected and cultured in YPD for 24-48 h until the OD600 reached 2.0. One mL of the bacterial culture was added to 50 mL of fermentation medium BMMY containing different concentrations of acetic acid (0, 5, 10, 15 g / L), and cultured at 30℃ with shaking at 180 rpm. The OD600 of the culture was measured every 6 h, and a growth curve was plotted.

[0062] The results are as follows Figure 3 The results showed that the recombinant Pichia pastoris strain x-33-ACSec could maintain its growth rate in a medium containing 5-15 g / L acetic acid, and the OD600 reached 20 after 72 h of culture. However, the growth rate of Pichia pastoris decreased to some extent with increasing acetic acid concentration.

[0063] Meanwhile, the original Pichia pastoris strain x-33 was used as a control for simultaneous fermentation testing.

[0064] The results are as follows Figure 4 The results showed that strain X-33 exhibited a slightly decreased growth rate at 5 g / L acetic acid compared to 0 g / L acetic acid, but still maintained normal growth. Growth was inhibited at 10-15 g / L acetic acid, and essentially ceased at 15 g / L.

[0065] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a recombinant Pichia pastoris strain, characterized in that, The steps are as follows: Step 1: Using pGAPZB as the plasmid backbone, construct the recombinant expression plasmid pGAPZB-ACSec containing the ACSec gene. The sequence of the ACSec gene is shown in SEQ ID No.

1. When constructing the recombinant plasmid pGAPZB-ACSec containing the ACSec gene, the ACSec gene is amplified using primers ACSec-F and ACSec-R. The sequence of ACSec-F is shown in SEQ ID No. 3, and the sequence of ACSec-R is shown in SEQ ID No.

4. The amplified fragment ACSec and the backbone plasmid pGAPZB are digested with restriction endonucleases Xho I and EcoRI, and then ligated overnight with T4 ligase. Step 2: Linearize the recombinant expression plasmid pGAPZB-ACSec and transform it into Pichia pastoris host; Step 3: Screen for Pichia pastoris strains that can express the ACSec gene.

2. The method for constructing a recombinant Pichia pastoris strain according to claim 1, characterized in that, The Pichia pastoris host is Pichia pastoris x-33.

3. The method for constructing a recombinant Pichia pastoris strain according to claim 1, characterized in that, The conversion method in step two is electroconversion.

4. The recombinant Pichia pastoris strain constructed by the method of any one of claims 1-3.

5. The application of the recombinant Pichia pastoris strain according to claim 4 in improving acetic acid tolerance.

6. The application according to claim 5, characterized in that, The application of improving acetic acid tolerance is carried out in a culture medium containing acetic acid.

7. The application according to claim 6, characterized in that, The concentration of acetic acid in the culture medium is 1-15 g / L.