Pure culture medium and culture system for ammoxidation archaea strain
By optimizing the culture medium and culture system, the problem of pure AOA culture was solved, and the separation and purification of AOA were achieved. The ammonia oxidation rate was improved, and the problems of slow AOA growth and difficulty in pure culture were solved, providing technical support for wastewater and solid waste treatment.
Patent Information
- Application Number
- CN202511416286.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-01-16
AI Technical Summary
In the existing technology, ammonia-oxidizing archaea (AOA) are autotrophic archaea that grow slowly and are difficult to culture in pure form. No effective pure culture system has been established globally, which makes it difficult to fully understand and apply their physiological functions and biochemical characteristics.
By optimizing the culture medium formulation and culture system, including the adjustment of trace elements and antibiotics, and combining different soil types and environmental conditions, a culture medium and culture system for the isolation and purification of AOA were established. Using containers such as serum bottles, the aeration rate, temperature and pH conditions were optimized to achieve the isolation and purification of AOA.
Thirteen highly efficient AOA pure culture strains were successfully obtained, which improved the ammonia oxidation rate, effectively eliminated bacterial contamination, filled the technical gap of AOA pure culture at home and abroad, and provided a technical foundation for sewage and solid waste treatment.
Smart Images

Figure CN121343799A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of agricultural, industrial and mining, domestic sewage and solid waste treatment technology, as well as green agricultural nitrogen fertilizer management technology, specifically relating to an improved culture medium and a method for expanding the culture of ammonia-oxidizing archaea. Background Technology
[0002] In wastewater treatment, ammonia oxidation, dominated by ammonia-oxidizing bacteria, determines whether nitrogen pollution can be removed efficiently, with low energy consumption, and stably. It also indirectly affects the degradation of micropollutants, system energy consumption, and ecological safety, making it a core and rate-limiting step in wastewater treatment. It is not only the 'starting point' for wastewater denitrification but also a crucial factor determining process efficiency, energy consumption levels, micropollutant removal effectiveness, and system stability. Furthermore, in solid waste treatment, ammonia-oxidizing bacteria convert the large amounts of ammonia nitrogen generated during solid waste treatment into nitrite through ammonia oxidation, laying the foundation for efficient and low-energy denitrification, greenhouse gas emission reduction, and resource recovery. This is a core step in the solid waste treatment process. In green agriculture, ammonia-oxidizing bacteria participate in the nitrogen cycle in the soil, promoting the conversion of ammonia nitrogen to nitrate nitrogen. Researching the nitrogen conversion mechanism of ammonia-oxidizing bacteria and its application in agricultural production helps reduce fertilizer use, lowers nitrogen loss and environmental pollution risks in agricultural production, and is of great significance for achieving sustainable agricultural development and ecological environmental protection. Therefore, enriching and culturing ammonia-oxidizing bacteria to enhance the activity and reaction rate of ammonia oxidation is of great significance to multiple fields such as wastewater and solid waste treatment and green agriculture.
[0003] Ammonia-oxidizing bacteria include ammonia-oxidizing bacteria, complete ammonia-oxidizing bacteria, and ammonia-oxidizing archaea (AOA). Currently, purification and large-scale culture techniques for ammonia-oxidizing bacteria have been established. However, globally, a mature system for the isolation, purification, and large-scale culture of soil AOA is lacking. This is primarily because AOA are autotrophic archaea that use ammonia as a substrate, have demanding nutritional requirements, and grow slowly. Currently, our understanding of AOA in wastewater treatment and soil ecosystems mainly relies on the amplification of functional genes. However, simply relying on molecular biology to amplify single genes and sequencing methods cannot reveal the complete genome and physiological functions of AOA. There is an urgent need to understand the physiological and biochemical characteristics of AOA through laboratory culture and isolation to clarify its functions and apply them to ecological environment management. Therefore, establishing a rationally formulated soil AOA culture medium and its culture system to promote AOA growth and obtain AOA cultured strains is of paramount importance.
[0004] Based on the above analysis, the existing technology has the following problems and defects: AOA is an autotrophic archaea, which is demanding, grows slowly, and is difficult to culture into pure culture. A pure culture system for AOA in soil has not yet been established. Summary of the Invention
[0005] To address the problems existing in the prior art, this invention provides a culture medium for rapid purification of AOA from different sources and establishes a soil AOA scale-up culture system.
[0006] Implementation of the invention:
[0007] 1. Based on the fundamental theories of ammonia-oxidizing autotrophic bacteria and archaea culture, and referring to relevant literature, a culture medium formula was first established and applied to the enrichment culture of AOA in low-temperature soils and desert oligotrophic soils of different types of grasslands, such as alpine meadow (AM), swamp meadow (SM), alpine steppe (AS), and desert steppe (DS). The composition of AOA enrichment and pure culture medium was then improved based on the results of the culture experiments.
[0008] 2. While optimizing the culture medium, optimize the culture volume, container material, aeration conditions, temperature, pH and substrate concentration to establish a culture system.
[0009] To achieve this invention, the culture medium for AOA includes major elements and trace components, and the solvent for the culture medium is ultrapure water.
[0010] The main elements of the culture medium include 0.1 g / L NaCl, 0.4 g / L MgCl2·6H2O, 0.1 g / L CaCl2·2H2O, 0.2 g / L KH2PO4, and 0.5 g / L KCl, with ultrapure water as the solvent.
[0011] In 1L of culture medium, the trace element components consist of 1mL of trace element chelate solution, including 1mL of FeNaEDTA solution, 1mL of vitamin solution, 2mL of NaHCO3 solution, 1mL of antibiotic solution, and 500uL of NH4Cl solution.
[0012] Specifically, 1L of trace element chelate solution contains 8mL of concentrated hydrochloric acid, 30mg H3BO3, 100mg MnCl2·4H2O, 190mg CoCl2·6H2O, 24mg NiCl2·2H2O, 2mg CuCl2·2H2O, 144mg ZnSO4·7H2O, 36mg Na2MoO4·2H2O, and 987mL of distilled water as solvent.
[0013] The FeNaEDTA solution was prepared by dissolving 0.253g of FeNaEDTA powder in 100mL of ultrapure water, sterilized by autoclaving, and then stored at 4℃.
[0014] 1L of vitamin solution contains 0.02g vitamin H (Biotin), 0.02g folic acid, 0.1g vitamin B6, 0.05g vitamin B1, 0.05g vitamin B2 (riboflavin), 0.05g niacin, 0.05g DL pantothenic acid, 0.05g para-aminobenzoic acid, 2.00g choline chloride, and 0.01g vitamin B12, in 1000mL of ultrapure water. After preparation, adjust the pH to 7.0 with saturated KOH solution. The vitamin solution should not be autoclaved; store refrigerated before use and filter sterilize before use.
[0015] The culture medium contains trace elements, and the filter used for filtration and sterilization is a 0.22 μM microporous membrane filter.
[0016] The NaHCO3 solution was prepared by dissolving 8.4g of NaHCO3 solid in 100mL of ultrapure water, and the NH4Cl solution was prepared by dissolving 5.35g of NH4Cl solid in 100mL of ultrapure water. After preparation, the solution was filtered through a 0.22µM microporous membrane for sterilization and stored at 4°C.
[0017] The antibiotic solution was prepared by mixing three antibiotics at a ratio of 1:1:1: using 0.1 g / mL of streptomycin, penicillin, and actinomycin ketone. After preparation, it was stored in a refrigerator at 4°C.
[0018] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows:
[0019] Addressing the issues of slow growth, difficulty in pure culture, and the lack of a globally established pure culture system for AOA (autotrophic archaea and fastidious bacteria), this invention, based on the theoretical requirements for the growth of archaea and fastidious bacteria, establishes a culture medium formula for the isolation and purification of AOA, particularly AOA derived from soil, through the regulation of trace elements and antibiotics. Examples demonstrate its role in separating and purifying AOA, thus overcoming the shortcomings of previous inventions that could only isolate and enrich AOA in aquatic ecosystems (sludge, rivers, oceans), and improving the ammonia oxidation rate.
[0020] This invention also establishes, for the first time in China, a technical system for pure AOA culture by improving the aeration rate, temperature, volume, and container material of the culture system, resulting in pure AOA cultures (Figure). The culture method of this invention can be implemented in serum bottles, plant culture flasks, and Erlenmeyer flasks, exhibiting strong versatility. It overcomes the inconvenience of previous AOA cultures, which mostly required fermenters / culture reactors, and is of great significance for small-scale cultures under ordinary laboratory conditions.
[0021] The above system effectively solved the technical problem of culturing pure AOA strains. Through the cultivation of AOA in different types of soil habitats on the Qinghai-Tibet Plateau, 13 pure AOA strains with high efficiency in ammonia nitrogen conversion were verified and obtained.
[0022] (1) The expected benefits and commercial value of the technical solution of this invention after transformation are as follows:
[0023] This invention provides feasible operational guidance for the purification and culture of ammonia-oxidizing archaea in the fields of wastewater treatment and solid waste treatment, as well as for the enrichment and purification of ammonia-oxidizing archaea in the laboratory, and has significant commercial value.
[0024] (2) The technical solution of this invention fills a technical gap in the industry both domestically and internationally:
[0025] The vitamin components added to the culture medium of this invention effectively shorten the AOA enrichment time and increase its ammonia oxidation rate.
[0026] The culture system established in this invention fills the technical gap in the pure culture of AOA strains both domestically and internationally.
[0027] (3) The technical solution of the present invention solves a technical problem that people have long wanted to solve but have never been able to solve successfully:
[0028] Current inventions have failed to eliminate contamination from ammonia-oxidizing bacteria (AOB) and other bacteria in enriched cultures, resulting in cultures that are complexes of archaea and bacteria. The method of this invention, however, can enrich ammonia-oxidizing archaea while simultaneously adjusting the culture temperature, pH, and adding antibiotics to obtain enriched cultures containing only archaea, effectively eliminating bacterial contamination.
[0029] Therefore, the results of this invention have solved the technical problem of pure culture of AOA, and established a technical foundation for the theoretical research of ammonia-oxidizing archaea and the efficient removal of ammonia nitrogen from wastewater. Attached Figure Description
[0030] Figure 1 This is a flowchart of the improved culture medium and expanded culture method for ammonia-oxidizing archaea provided in the embodiments of the present invention.
[0031] Figure 2 The nitrite accumulation curves provided in Examples 2-6 of this invention reflect the accumulation of nitrite, a product of ammonia oxidation, under culture temperatures of 16℃, 23℃, 30℃, 37℃, and 45℃.
[0032] Figure 3 The graphs show the ammonia oxidation rate of AOA at culture temperatures of 16℃, 23℃, 30℃, 37℃, and 45℃, as provided in Examples 2-6 of this invention.
[0033] Figure 4 The nitrite accumulation curves provided in Examples 7-12 of this invention reflect the accumulation of nitrite, a product of ammonia oxidation, under the action of AOA at pH = 4, 5, 6, 7, 8, and 9.
[0034] Figure 5 This is a graph showing the ammonia oxidation rate of AOA at pH = 4, 5, 6, 7, 8, and 9, provided in Examples 7-12 of this invention.
[0035] Figure 6 The nitrite accumulation curves provided in Examples 13-18 of this invention reflect the accumulation of nitrite, the ammonia oxidation product of AOA, at substrate concentrations of 1mM, 3mM, 5mM, 10mM, 20mM, and 50mM.
[0036] Figure 7 This is a graph showing the ammonia oxidation rate of AOA at substrate concentrations of 1 mM, 3 mM, 5 mM, 10 mM, 20 mM, and 50 mM, provided in Examples 13-18 of this invention.
[0037] Figure 8 This is an embodiment of the present invention, showing the 16S rDNA PCR amplification results of an ammonia-oxidizing archaea enrichment culture. It reflects that only ammonia-oxidizing archaea are enriched and no bacterial products are found after using this culture system. Detailed Implementation
[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0039] The culture medium for the ammonia-oxidizing archaea of the present invention includes a basic culture medium and additional components, wherein the solvent of the liquid culture medium is ultrapure water.
[0040] The basic culture medium provided in this embodiment of the invention includes 0.1 g / L NaCl, 0.4 g / L MgCl2·6H2O, 0.1 g / L CaCl2·2H2O, 0.2 g / L KH2PO4, and 0.5 g / L KCl, with ultrapure water as the solvent.
[0041] In each liter of culture medium provided in this embodiment of the invention, the additional components are 1 mL of trace element chelate solution, 1 mL of FeNaEDTA solution, 1 mL of vitamin solution, 2 mL of NaHCO3 solution, 1 mL of antibiotic solution, and 500 μL of NH4Cl solution.
[0042] The 1L trace element chelate solution provided in this embodiment of the invention contains: 8mL concentrated hydrochloric acid, 30mg H3BO3, 100mg MnCl2·4H2O, 190mg CoCl2·6H2O, 24mg NiCl2·2H2O, 2mg CuCl2·2H2O, 144mg ZnSO4·7H2O, 36mg Na2MoO4·2H2O, and 987mL distilled water as solvent.
[0043] The FeNaEDTA solution provided in this embodiment of the invention is prepared by dissolving 0.253g of FeNaEDTA powder in 100mL of ultrapure water, sterilizing by autoclaving, and then storing at 4°C.
[0044] The 1L vitamin solution provided in this embodiment of the invention contains 0.02g vitamin H (biotin), 0.02g folic acid, 0.1g vitamin B6, 0.05g vitamin B1, 0.05g vitamin B2 (riboflavin), 0.05g niacin, 0.05g DL pantothenic acid, 0.05g para-aminobenzoic acid, 2.00g choline chloride, and 0.01g vitamin B12, with 1000mL ultrapure water as the solvent. After preparation, the pH is adjusted to pH=7.0 with saturated KOH solution. The vitamin solution should not be autoclaved and should be refrigerated before use. When using, it should be filtered through a 0.22μM microporous membrane for sterilization.
[0045] The filter used for filtration and sterilization of culture medium additives provided in this embodiment of the invention is a 0.22 μM microporous membrane filter.
[0046] The culture medium additives provided in this embodiment of the invention are characterized in that the NaHCO3 solution is prepared by dissolving 8.4g of NaHCO3 solid in 100mL of ultrapure water, and the NH4Cl solution is prepared by dissolving 5.35g of NHCl solid in 100mL of ultrapure water; after preparation, the solution is filtered through a 0.22uM microporous membrane for sterilization and stored in a refrigerator at 4°C.
[0047] The culture medium additive provided in this embodiment of the invention is characterized in that the antibiotic solution is prepared by mixing three antibiotics at a concentration of 0.1 g / mL: streptomycin, penicillin, and actinomycin ketone in a 1:1:1 ratio; after preparation, it is refrigerated and stored at 4°C.
[0048] like Figure 1 As shown, the method for expanding the culture of ammonia-oxidizing archaea provided in this embodiment of the invention includes:
[0049] S1: Soil samples were taken for primary culture of ammonia-oxidizing archaea. The growth rate of archaea was measured at intervals using liquid culture medium to obtain primary archaea cultures.
[0050] S2: After confirming that 80% of the ammonia nitrogen has been converted, subculture is carried out; in the third generation culture, the temperature is adjusted and antibiotics are added;
[0051] The detailed steps of S1 are as follows: Soil samples are selected for primary AOA enrichment culture; each soil sample is replicated in triplicate, with each culture inoculated with 1g of soil and 20mL of the liquid culture medium in a 100mL serum bottle. These three parallel primary cultures are incubated at 32℃. In all cultures, an antibiotic solution prepared with streptomycin, penicillin, and actinomycin is used as the default antibiotic to inhibit bacteria. During the culture process, the serum bottle is manually shaken for 1 minute every two days to resuspend the lower precipitate in the liquid culture medium. NH4 is measured every week. + -N and NO 2- The concentration of -N and 16S rDNA were quantified by real-time PCR; ammonia nitrogen was measured by salicylic acid-sodium hypochlorite spectrophotometry, and nitrite nitrogen was measured by N-(1-naphthyl)-ethylenediamine spectrophotometry.
[0052] Specific implementation of the present invention:
[0053] Example 1: Enrichment of AOA in different soil habitats on the Qinghai-Tibet Plateau
[0054] Primary enrichment cultures of AOA were conducted using soil samples from alpine meadow (AM), swamp meadow (SM), alpine steppe (AS), and desert steppe (DS) on the Qinghai-Tibet Plateau. Three biological replicates were prepared for each soil sample and cultured in 100 mL serum bottles. The serum bottles were made of borosilicate glass with an inner diameter of 11 mm and an outer diameter of 20 mm. The bottles were sealed with eight layers of nylon gauze, sterilized twice by autoclaving, instead of caps. The eight layers of gauze effectively prevented the entry of external bacteria while allowing aeration, thus ensuring pure culture. Soil samples were sieved through a 2 mm sieve, and 1 g of soil sample was carefully weighed and poured into the serum bottle at an angle, taking care not to allow soil to adhere to the bottle walls. 20 mL of AOA basal culture medium was added to a serum bottle, and the mixture was shaken thoroughly to ensure even distribution of the soil sample. These three biological replicates of the primary culture system were incubated at 32°C with 0.5 mM NH4Cl as the ammonia oxidation substrate and 2 mM NaHCO3 as the sole carbon source. 0.1 g / mL streptomycin was used to inhibit bacterial growth and screen archaea during the primary culture. Every two days, the serum bottle was manually shaken for 1 minute to resuspend the precipitate in the liquid culture medium. Because archaea growth was slow and OD values did not change significantly, the activity of the ammonia oxidation reaction was indirectly quantified by measuring the consumption of ammonium nitrogen from the substrate and the production of nitrite nitrogen. Ammonia nitrogen was measured using the salicylic acid-sodium hypochlorite spectrophotometric method, and nitrite nitrogen was measured using the N-(1-naphthyl)-ethylenediamine spectrophotometric method.
[0055] Once the ammonia nitrogen consumption reaches 80%, add 1 mL of bacterial culture and 20 mL of liquid culture medium to a new serum bottle. Adjust the culture temperature to 20°C and adjust the antibiotic to a 1:1:1 ratio of streptomycin, penicillin, and actinomycin ketone. Perform 2-n generations of culture. After subculturing, wash the serum bottle with 1% hydrochloric acid to remove residual bacteria.
[0056] Based on Example 1 above, Examples 2-6 were carried out. Figure 2 , Figure 3 Examples 2-6 each provide an AOA culture method, with a total culture period of 60 days.
[0057] The difference between the above embodiments and Embodiment 1 lies in the culture temperature during subculturing, as shown below:
[0058] In Example 2, the subculture temperature was adjusted to 16°C.
[0059] In Example 3, the subculture temperature was adjusted to 23°C.
[0060] In Example 4, the subculture temperature was adjusted to 30°C.
[0061] In Example 5, the subculture temperature was adjusted to 37°C.
[0062] In Example 6, the subculture temperature was adjusted to 45°C.
[0063] Based on Example 1 above, Examples 7-12 were carried out. Figure 4 , Figure 5 Examples 7-12 provide a culture medium and a culture method for AOA, with a total culture period of 60 days.
[0064] The difference between the above embodiments and Embodiment 1 is that the pH of the culture medium is different, and the specific pH values are shown below:
[0065] In Example 7, the pH of the subculture was adjusted to pH=4.
[0066] In Example 8, the pH of the subculture was adjusted to pH=5.
[0067] In Example 9, the pH of the subculture was adjusted to pH=6.
[0068] In Example 10, the pH of the subculture was adjusted to pH=7.
[0069] In Example 11, the pH of the subculture was adjusted to pH=8.
[0070] In Example 12, the pH of the subculture was adjusted to pH=9.
[0071] Based on Example 1 above, Examples 13-18 were carried out. Figure 6 , Figure 7 Examples 13-18 provide a culture medium and a culture method for AOA, with a total culture period of 60 days.
[0072] The difference between the above embodiments and Embodiment 1 is that the substrate for the ammonia oxidation reaction (NH4) + Different substrate concentrations are used, and the specific substrate concentrations are shown below:
[0073] In Example 13, the substrate concentration (NH4) + Adjusted to 1mM.
[0074] In Example 14, the substrate concentration (NH4) + Adjusted to 3mM.
[0075] In Example 15, the substrate concentration (NH4) + Adjusted to 5mM.
[0076] In Example 16, the substrate concentration (NH4)+ Adjusted to 10mM.
[0077] In Example 17, the substrate concentration (NH4) + Adjusted to 20mM.
[0078] In Example 18, the substrate concentration (NH4) + Adjusted to 50mM.
[0079] In summary, the optimal growth conditions for soil AOA are a temperature of 37 degrees Celsius, a pH of 7.0, and a substrate concentration between 0.5 mM and 1 mM.
[0080] I. Specific application areas or related products of this invention.
[0081] This invention can be specifically applied to microbial treatment processes for agricultural, industrial, mining, and domestic sewage and solid waste, and is particularly suitable for microbial treatment processes for high-nitrogen sewage and solid waste. Examples 1 to 18 shown above also demonstrate specific applications in different types of grassland soils in alpine ecosystems.
[0082] II. Evidence related to the technical effects obtained by the embodiments of the present invention.
[0083] Example: PCR amplification of 16S rDNA from enriched ammonia-oxidizing archaea cultures to determine whether they were pure cultures of ammonia-oxidizing archaea.
[0084] Soil samples from marsh meadow (SM) and desertified steppe (DS) were used for enrichment culture of ammonia-oxidizing archaea. The cultures were then subjected to PCR amplification using universal primers for 16S rDNA of both archaea and bacteria. Primer information is as follows:
[0085] Bacterial 16S primer:
[0086] 27F 5′-AGAGTTTGATCCTGGCTCAG-3′
[0087] 1492R 5′-TACGGCTACCTTGTTACGACTT-3′
[0088] Archaea 16S primer:
[0089] 519F 5′-CAGCCGCCGCGGTAA-3′
[0090] 915R 5′-GTGCTCCCCGCCAATTCCT-3′
[0091] After amplification, agarose gel electrophoresis was performed. From left to right, each well represents: marker, archaeal positive control, negative control, bacterial positive control, archaeal 16S rDNA amplification product of SM enrichment, archaeal 16S rDNA amplification product of DS enrichment, bacterial 16S rDNA amplification product of SM enrichment, and bacterial 16S rDNA amplification product of DS enrichment.
[0092] Electrophoretic bands such as Figure 8 As shown.
[0093] Therefore, it can be seen that there are no bacterial products in the archaeal enrichment cultures produced by this culturing method.
[0094] AOA16s rDNA sequence:
[0095] #OL343688AOA-AS:
[0096] CTAATGGTCTGGCTTAGACGCACTACACACTATCTATTCATAGTTGTAGTTGCTGTAAATAGTACATTATTGACAATCAACGCAGGAGACTACATATTCTATACTGATTGGGCGTGGACCTCATTCGTAGTATTCTCAATATCCCAATCAACTATGCT TGTAGTTGGTGCAATCTATTACATGCTATTCACCGGTGTACCAGGGACTGCAACATATTACGCAACAATCATGACTATCTATACATTCGTAGCCAAAGGAGCTTGGTTTGCGCTAGGATATCCATTAGACTTCATTGCCGTACCTGTTTGGATAACCTTC AGCTATGCTGTTAGATTTGACATATTGGGCAACAAGAAGGAATAAACATGCTGCCATTATAATTGGCGGAACATTGGTTGGACTTTCACTGCCAATATTTAATATGATCAATCTACTGCTGGTCAGAGATCCTCTAGAGATGGCATTCAAATATCCTCG TCCGACATTGCCTCCATACATGACACCAATTGAGCCTCAGGTCGGTAAGTTCTACAATAGTCCCGTAGCGCTAGGATCGGGAGCTGGAGCTGTGCTAAGTGTTCCAATAGCTGCACTAGGTGCAAAACTCAATACATGGACATACAGATGGATGGCCGC
[0097] #OL343682AOA-AM
[0098] ATGGTCTGGCTTAGACGCACTACACACTATCTATTCATAGTTGTAGTTGCTGTAAATAGTACATTATTGACAATCAACGCAGGAGACTACATATTCTATACAGATTGGGCATGGACATCATTTGTTGTATTCTCAGTATCCCAATCAACAATGCTTGTAGTGGGAGCAATCTATTACATGCTATTCACCGGTGTACCAGGGACTGCAACATATTATGCAACAATCATGACTATCTATACATGGGTAGCCAAAGGAGCATGGTTTGCACTAGGATATCCATACGACTTCATCGTAACTCCAGTTTGGATACCTTCAGCAATGCTGTTAGATTTGACATATTGGGCAACAAGAAGGAATAAACATGCTGCCATTATAATTGGCGGAACATTGGTTGGACTTTCATTGCCAATATTCAACATGATAAATCTACTGCTGGTCAGAGACCCTCTAGAGATGGCATTCAAGTATCCTCGTCCAACATTGCCTCCATACATGACACCAATTGAGCCTCAGGTCGGTAAATTCTACAATAGTCCCGTGGCGCTAGGATCCGGGGCGGGAGCTGTACTGAGCGTTCCAATCGCTGCATTGGGCGCAAAACTAAATACTTGGACATACAGATGGATGGCCGCTTGGTCAAAGTGGGA
[0099] #OL343690 AOA-DS
[0100] TACAACTCACTATTTGTTCATAGTTGTTGTTGCAGTAAATAGTACGTTGCTTACAATCAACGCAGGAGATTATATCTTCTATACTGACTGGGCATGGACATCATTCGTCGTATTCTCGATTTCCCAATCCACAATGCTCGTGGTAGGAGCTATATACTATATGTTGTTTACTGGTGTTCCTGGCACAGCTACATATTATGCAACTATTATGACGATTTATACATGGATTGCCAAAGGAGCATGGTTCGCATTGGGATACCCGTACGATTTTGTCGTGGTACCAGTTTGGATACCCTCTGCTATGTTGTTGGATTTGGCGTACTGGGCAACAAGAAGAAACAAACACGCGGCAATATTAATTGGTGGTGTATTGGTAGGAATGTCACTCCCACTATTTAATATGATTAACTTATTGTTGGTTGCTGACCCATTGGAAATGGCATTCAAATATCCTAGGCCCACGTTACCACCATACATGACTCCAATTGAACCACAGGTAGGAAAGTTCTATAACAGTCCTGTTGCCTTAGGAGCAGGAGCTGGAGCGGTGCTTTGTGTACCTATAGCGGCGTTGGGCGCAAAACCGAATACTT
[0101] #OL343686 AOA-SM2
[0102] GTAATGGTCTGGCTTAGACGCACAACACACTACTTATTCATAGTAGTAGTTGCTGTTAACAGCACCTTACTTACTATCAATGCAGGAGACTACATTTTCTACTCTGATTGGGCTTGGACATCATTCGTAGTATTCTCAATATCACAATCAACTATGCT TGTGGTAGGTGCGATATACTATATGTTGTTCACAGGTGTTCCGGGAACAGCTACGTATTACGCGACAATCATGACAATTTACACTTGGGTGGCAAAAGGTGCATGGTTTGCGTTGGGATATCCTTACGACTTCGTTGTAACACCAGTTTGGATAACCTTC GGCTATGCTCTTGGATCTCACCTATTGGGCCACAAGAAGAAATAAACACGCAGCGATAATAATTGGTGGAACATTGGTCGGACTTTCATTGCCGGTCTTCAACATGATCAATCTGTTGTTAGTGAGAGATCCATTGGAGATGGCATTCAAGTATCCGC GGCCTACATTGCCTCCGTATATGACGCCCATAGAGCCTCAGGTCGGAAAGTTCTACAACAGTCCCGTAGCATTAGGTTCAGGTGCTGGAGCAGTACTTAGTGTACCAATTGCTGCATTGGGAGCAAAGCTAAACACGTGGACATACAGATGGATGGCCG
[0103] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A culture medium for ammonia-oxidizing archaea, characterized in that, The culture medium of the ammonia-oxidizing archaea comprises a basic freshwater culture medium and additional components, and the solvent of the liquid culture medium is ultrapure water.
2. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 1, characterized in that, The basic freshwater culture medium comprises 0.1 g / L of NaCl, 0.4 g / L of MgCl2·6H2O, 0.1 g / L of CaCl2·2H2O, 0.2 g / L of KH2PO4, 0.5 g / L of KCl, and the solvent is ultrapure water.
3. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 1, wherein, The additional components are 1 mL of trace element chelating solution, 1 mL of FeNaEDTA solution, 1 mL of vitamin solution, 2 mL of NaHCO3 solution, 1 mL of antibiotic solution, and 500 uL of NH4Cl solution per liter of culture solution.
4. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 3, characterized in that, 1L of the trace element chelating solution comprises 8 mL of concentrated hydrochloric acid, 30 mg of H3BO3, 100 mg of MnCl2·4H2O, 190 mg of CoCl2·6H2O, 24 mg of NiCl2·2H2O, 2 mg of CuCl2·2H2O, 144 mg of ZnSO4·7H2O, and 36 mg of Na2MoO4·2H2O, and the solvent is 987 mL of distilled water.
5. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 3, wherein, The FeNaEDTA solution is prepared by dissolving 0.253 g of FeNaEDTA powder in 100 mL of ultrapure water, and is stored at 4°C after high-pressure steam sterilization.
6. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 3, wherein, 1L of the vitamin solution comprises 0.02 g of vitamin H (biotin), 0.02 g of folic acid, 0.1 g of vitamin B6, 0.05 g of vitamin B1, 0.05 g of vitamin B2 (riboflavin), 0.05 g of nicotinic acid, 0.05 g of DL pantothenic acid, 0.05 g of p-aminobenzoic acid, 2.00 g of choline chloride, and 0.01 g of vitamin B12, and the solvent is 1000 mL of ultrapure water; after preparation, the pH is adjusted to pH=7.0 with a saturated KOH solution; the vitamin solution cannot be high-pressure steam sterilized, and is stored in a refrigerator before use and is filtered to remove bacteria during use.
7. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 3, wherein, The filter used for filtering and removing bacteria of the additional components of the culture medium is a microporous filter membrane.
8. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 3, wherein, The additional components of the culture medium are characterized in that the NaHCO3 solution is prepared by dissolving 8.4 g of NaHCO3 solid in 100 mL of ultrapure water, and the NH4Cl solution is prepared by dissolving 5.35 g of NH4Cl solid in 100 mL of ultrapure water; after preparation, the bacteria are removed by microporous filter membrane filtration, and the solutions are stored in a refrigerator at 4°C.
9. The culture medium of the ammonia-oxidizing crenarchaeota according to claim 3, wherein, The additional components of the culture medium are characterized in that the antibiotic solution is prepared by mixing 0.1 g / mL of three antibiotics: streptomycin, penicillin, and actidione, in a ratio of 1:1:1; and the solution is stored in a refrigerator at 4°C after preparation.
10. A method for the large-scale cultivation of anammox bacteria in a culture medium for anammox bacteria as claimed in any one of claims 1-9, characterized in that The method for expanding the culture of the ammonia-oxidizing archaea comprises: S1: taking a soil sample for primary culture of ammonia-oxidizing archaea, measuring the growth rate of archaea at intervals using a liquid culture medium, and obtaining a primary archaea culture; S2: after confirming that 80% of ammonia nitrogen is degraded, performing subculture; adjusting the temperature and adding antibiotics in the third generation of culture; The detailed steps of S1 are as follows: selecting soil samples for initial enrichment culture of AOA; 3 repeats are carried out for each soil, 1g of soil and 20ml of liquid culture based on serum bottles are inoculated, the 3 parallel initial cultures are placed in a 32℃ environment for culture; streptomycin is used as a default antibiotic for selecting archaea in all cultures, the serum bottles are manually shaken for 1min every two days during the culture process, so that the lower precipitate is resuspended in the liquid culture medium, the concentrations of NH4-N and NO2-N, and the quantification of 16s rDNA are measured every week; the measurement of ammonia nitrogen adopts salicylic acid-sodium hypochlorite spectrophotometry, and the measurement of nitrite nitrogen adopts N-(1-naphthyl)-ethylenediamine spectrophotometry.