Roegneria ciliata PmRc1 gene, protein coded by roegneria ciliata PmRc1 gene and application of roegneria
By applying the PmRc1 gene of *Gnaphalium affine* and its recombinant expression vector to wheat, the problem of wheat powdery mildew resistance loss was solved, realizing a genetic engineering method to enhance wheat powdery mildew resistance and avoiding environmental pollution from chemical control.
Patent Information
- Application Number
- CN202511798332.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-01-16
AI Technical Summary
Existing technologies cannot effectively utilize the powdery mildew resistance gene of *Gnaphalium affine*, a close relative of common wheat, leading to the loss of wheat powdery mildew resistance. Chemical control also poses environmental pollution problems.
We provide the PmRc1 gene of *Gnaphalium affine*, its encoded protein, and a recombinant expression vector. We enhance wheat resistance to powdery mildew by gene silencing or overexpression. We use the pBI220 vector to express the PmRc1 gene in wheat to improve resistance.
It enhances wheat's resistance to powdery mildew, provides an environmentally friendly genetic engineering approach, avoids the environmental pollution caused by chemical control, and has important breeding significance.
Smart Images

Figure CN121344015A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering and discloses a PmRc1 gene of *Gnaphalium affine*, the protein it encodes, and its applications. Background Technology
[0002] Common wheat (Triticum aestivum L, 2n=6x=42, AABBDD) is a major global food crop and my country's third largest food crop after rice and corn. Ensuring wheat yield and quality is crucial for the country's stable development. Wheat powdery mildew is an airborne fungal disease caused by Blumeria graminis f. sp. tritici (Bgt). It is widespread globally, characterized by its wide distribution, rapid spread, and high incidence. The disease can occur throughout the wheat's growth cycle and can affect all above-ground parts of the plant, primarily leaves and leaf sheaths. It can lead to 15-30% yield loss, severely impacting wheat yield and quality. While powdery mildew can be controlled with fungicides, chemical control inevitably increases manpower and material resources and can cause environmental pollution and other ecological problems. Therefore, discovering disease-resistant genes and cultivating disease-resistant varieties are effective measures for controlling wheat powdery mildew. Meanwhile, wheat powdery mildew exhibits rapid virulence variation and numerous physiological races, leading to intense competition between the host and the pathogen. Long-term, large-scale use of a single resistance source accelerates the variation of the pathogen's physiological races, resulting in the loss of resistance genes. Continuously discovering, researching, and utilizing effective resistance resources, and cultivating new varieties with aggregated resistance genes, is the most economical and effective way to control powdery mildew.
[0003] Common wheat's closely related species have retained a large number of superior genes such as stress resistance, high yield, and high quality during long-term evolution and natural selection. These genes are important resources for improving common wheat varieties. Therefore, studying and utilizing disease-resistant genes from closely related species is an important way to improve wheat disease resistance. *Roegneria ciliaris* (Trin.) Nevski, 2n = 4x = 28, ScScYcYc, is a tetraploid closely related species to common wheat and belongs to the tertiary gene pool. It possesses excellent traits of high resistance to powdery mildew, and it is expected that functional genes for powdery mildew resistance can be obtained from it. This is of great significance for breeding new disease-resistant wheat varieties and can provide an important theoretical and material basis for wheat powdery mildew control and powdery mildew-resistant wheat breeding. Summary of the Invention
[0004] The purpose of this invention is to provide a candidate gene for the wheat powdery mildew resistance gene PmRc1.
[0005] Another object of the present invention is to provide the application of this gene.
[0006] The objective of this invention can be achieved through the following technical solutions:
[0007] The powdery mildew resistance gene PmRc1 provided by this invention is derived from the small-fragment translocation line TT-7 created from tetraploid *Gnaphalium affine* and common wheat. Its nucleotide sequence is SEQ ID NO.1 and its amino acid sequence is SEQ ID NO.2.
[0008] The amino acid sequence of the protein encoded by the PmRc1 gene of *Gnaphalium affine* is shown in SEQ ID NO.2.
[0009] A recombinant expression vector containing the PmRc1 gene of *Gnaphalium affine*.
[0010] Preferably, the PmRc1 gene of *Gnaphalium affine* is inserted between the BamHI and SacI restriction sites of the pBI220 vector to obtain the recombinant expression vector.
[0011] The application of the PmRc1 gene of *Gnaphalium affine* in improving plant resistance to powdery mildew.
[0012] Preferably, the plant is wheat.
[0013] The application of the recombinant expression vector in improving plant resistance to powdery mildew.
[0014] Preferably, the plant is wheat.
[0015] The application of the PmRc1 gene of *Gnaphalium affine* and the recombinant expression vector in the breeding of wheat varieties resistant to powdery mildew.
[0016] A plant breeding method for increasing the activity and / or content of the protein described in a target plant, thereby enhancing the target plant's resistance to powdery mildew.
[0017] Beneficial effects
[0018] This invention provides a candidate gene, PmRc1, derived from the powdery mildew resistance gene *Gnaphalium affine*. Silencing this gene in resistant materials enhances susceptibility, while overexpression improves resistance to powdery mildew. This invention is of significant importance for wheat powdery mildew resistance breeding. Attached Figure Description
[0019] Figure 1 The translocation line TT-7 (containing PmRc1, R) showed significant resistance to powdery mildew compared to its sympathogenic parent (Nanjing Agricultural University 0686, S).
[0020] Figure 2 Cloning of the powdery mildew resistance gene PmRc1 and its expression characteristics induced by powdery mildew fungi.
[0021] A: The PmRc1 gene structure consists of an N-terminal transmembrane domain (TM), a protein kinase domain, and a C-terminal von Willebrand factor A (vWA) domain. B: Real-time quantitative RT-PCR analysis of PmRc1 gene expression in leaves induced by powdery mildew at the seedling and mature stages; X-axis: 0h, 8h, 24h, and 48h represent different time points in the translocation line TT-7 (containing PmRc1) leaves induced by powdery mildew, respectively; Y-axis: relative expression level of PmRc1 gene before and after powdery mildew induction.
[0022] Figure 3 Verify the function of PmRc1 using gene silencing induced by barley stripe mosaic virus;
[0023] A: Phenotypes after PmRc1 silencing, from left to right: translocation lineage TT-7, BMSV:PDS, BMSV:γ, BMSV:PmRc1-V1, BMSV:PmRc1-V2, and Nanjing Agricultural University 0686. B: Relative expression levels of PmRc1 after transient VIGS.
[0024] Figure 4 The effect of transient overexpression of PmRc1 on the haustorium index of Yangmai 158. A: Construction process of the pBI220-PmRc1 vector; B: Changes in haustorium index after overexpression of pBI220-PmRc1 vector in young leaves of Yangmai 158. Detailed Implementation
[0025] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0026] The powdery mildew fungus used in this study is wheat powdery mildew race E26. It is described in the literature "Zhu YF, Li YB, Fei F, et al. E3 ubiquitin ligase gene CMPG1–V from Haynaldia villosa L. contributes to powdery mildew resistance in common wheat (Triticum aestivum L.)[J]. The Plant Journal, 2015, 48(1):154-168."
[0027] The TT-7 in this study is described in "Cheng, M., Zhang, H., Zhang, Y. et al. Cytological mapping of a powdery mildew resistance locus PmRc1 based on wheat-Roegneria ciliaris structural rearrangement library. Theor Appl Genet 137, 276 (2024). https: / / doi.org / 10.1007 / s00122-024-04768-w".
[0028] The gene silencing technique induced by barley stripe mosaic virus is described in the literature “Yuan C, Li C, Yan L, et al. A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots [J]. PLoS One, 2011,10(6):e26468”.
[0029] The single-cell transient expression technique and haustorium index are described in the literature “Patrick S, Jana P, Olaf A, et al. A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat[J]. Molecular Plant - Microbe Interactions,1999,12(8):647-654”.
[0030] Example 1: Identification of resistance of translocation line T1SS-1AS·1AL (TT-7) to powdery mildew.
[0031] Powdery mildew resistance was assessed using the E26 race of powdery mildew on resistant material TT-7 and susceptible material Nannong 0686 at both the seedling and mature stages. Powdery mildew incidence was observed 7 days after inoculation. Results showed that three replicates at both stages consistently demonstrated that TT-7 exhibited significant powdery mildew resistance compared to Nannong 0686, proving that the translocation line TT-7 (including PmRc1) possesses resistance to powdery mildew throughout its entire growth period. Figure 1 ).
[0032] Example 2 Cloning of the powdery mildew resistance gene PmRc1 and its expression characteristics induced by powdery mildew fungi.
[0033] Primers P1 (GTGGTCGTGTTAGAATCTGC, SEQ ID NO.3) and P2 (GCAGCGATCAATAGCACATAA, SEQ ID NO.4) were designed to clone the full length of PmRc1. Using cDNA induced by powdery mildew from *Gnaphalium affine* as a template, the full length of PmRc1 was cloned using primers P1 and P2. Sequencing revealed that the full-length cDNA of PmRc1 was 2601 bp, encoding 866 amino acids. Its nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2. Protein sequence analysis revealed that PmRc1 contains a transmembrane (TM) domain, a kinase domain, and a vWA (Von Willebrand factor A) domain at its C-terminus. Figure 2 A).
[0034] The cloning method described above is as follows:
[0035] After inoculating the translocation line TT-7 with powdery mildew at the seedling and mature stages, inoculated leaves were collected at 0h, 8h, 24h, and 48h, respectively. After flash freezing in liquid nitrogen, RNA induced by powdery mildew was extracted from the TT-7 leaves using TRIZOL (Invitrogen). cDNA was then synthesized using the Novozymes HiScript III 1st Strand cDNA Synthesis Kit (Vazyme). Specific steps: Mix 1 μg RNA template and 6 μl RNase-free ddH2O thoroughly, then incubate at 65℃ for 5 min; incubate on ice for 2 min; add 2 μl 5×g DNA Wiper Mix via pipette and mix well, then incubate at 42℃ for 2-3 min; add 2 μl 5×g DNA Wiper Mix, 2 μl 10×RT Mix, 2 μl HiScript III enzyme Mix, 1 μl Oligo (dT) 20VN, and 5 μl RNase-free ddH2O via pipette and mix well, then incubate at 37℃ for 45 min and 85℃ for 5 sec. After completion, store at -80℃. Perform polymerase chain reaction (PCR) for sequence amplification and PCR product detection. PCR reaction system (10 μL): DNA (100-200 ng / μL) 1.5 μL, forward and reverse primers (10 μmol / μL) 0.2 μL each, ddH2O 3.1 μL, 2× Green Taq Mix Buffer 5 μL, total 10 μL. PCR reaction program: 95.0℃ denaturation for 5 min; 95.0℃ denaturation for 20 s, 56-60℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 32 cycles; 72℃ extension for 5 min; store at 10℃. PCR reaction was performed in an MJ Research PTC-225 thermal cycler. PCR products were analyzed and identified by agarose gel electrophoresis or polyacrylamide gel electrophoresis.
[0036] To investigate the expression pattern of the PmRc1 candidate gene, qPCR analysis was performed on powdery mildew-induced samples using primers P3 (GAAGCATACTGTGAGCAAGT, SEQ ID NO.5) and P4 (ACTGATATCCGCACTAG GAC, SEQ ID NO.6). PCR amplification was performed on a Roche Light Cycler 480 qPCR instrument. A 20µl PCR reaction mixture contained 2µl cDNA, 10µl 2×SYBR EX Taq™ (TakaRa), and 0.4µl primers P1 (10µM) and P2 (10µM). Amplification parameters were: 95℃ for 5 min, followed by 41 cycles of 95℃ for 10 s, 60℃ for 30 s, and 72℃ for 15 s. After the reaction, the relative expression level was calculated: the relative expression level of the target gene at different time points after treatment compared to the untreated sample was calculated based on the obtained CT values. -△△CT Where, △△CT=(C T.Target -C T.Tublin ) Time x -(C T.Target -C T.Tublin ) Time 0 Time x represents any time point, and Time 0 represents the untreated point. The results showed that the expression level of PmRc1 in wheat leaves reached its peak 24 hours after induction by powdery mildew. qPCR results indicated that PmRc1 may positively regulate wheat powdery mildew resistance. Figure 2 B)
[0037] Example 3: Verification of the function of PmRc1 using barley stripe mosaic virus-induced gene silence (BSMV-induced gene silence, VIGS) experiment.
[0038] The wheat VIGS system utilizes the replication and transcription of barley stripe mosaic virus (BSMV) carrying a target fragment within wheat to induce gene silencing through the degradation or epigenetic modification of homologous gene mRNA. Two pairs of specific primers, P5 (ATGGAGAAGAGCTTGTTGCT, SEQ ID NO.7) and P6 (ATCGTCTCATCTTCGTTGTC, SEQ ID NO.8); and P7 (CGAATGTGATGGACTAGACT, SEQ ID NO.9) and P8 (ATCCAAGTGTTCCTATAGGAC, SEQ ID NO.10), were designed to specifically amplify a 200bp fragment specific to PmRc1. The target fragment was then inserted into the ApaI restriction site of BSMV-γ to construct the BSMV-γ-V1 and BSMV-γ-V2 vectors, respectively. BSMV-α, BSMV-β, BSMV-γ, BSMV-PDS, BSMV-γ-V1, and BSMV-γ-V2 were transformed into Agrobacterium EHA105 and recombined in Tobacco Benzoinus leaves after 3-4 weeks. After recombination, these compounds were rubbed onto two-leaf stage resistant material TT-7. When plants coated with BSMV-PDS showed photobleaching, the silencing efficiency of plants coated with BSMV-γ-V1 and BSMV-γ-V2 was tested using PmRc1-specific qRT-PCR primers P6 and P7, and then inoculated with powdery mildew. Plants coated with BSMV-γ served as a negative control. The experiment was repeated four times. The results showed that compared with the negative resistant control BSMV-γ, all silenced plants were susceptible to the disease, verifying that PmRc1 positively regulates powdery mildew resistance. Figure 3 ).
[0039] The steps for determining the efficiency of silence are as follows:
[0040] (1) RNA was reverse transcribed into short cDNA fragments using the Novozymes short fragment reverse transcription HiScript RT SuperMix for qPCR kit. The reverse transcription system consisted of 1 μl template RNA, 4 μl 4×gDNA wiper Mix, and 11 μl RNase-free ddH2O. After mixing thoroughly, the mixture was incubated at 42℃ for 2 min and then on ice for 2 min. 5×Hiscript qRT SuperMix was then added, mixed thoroughly, and incubated at 37℃ for 15 min and then at 85℃ for 5 sec. After the reverse transcription was completed, the mixture was stored at -20℃.
[0041] (2) The expression level of PmRc1 in the treated samples was identified by referring to the AceQ qPCR SYBR Green Master Mix (without ROX) kit for Novizan reverse transcription.
[0042] The qRT-PCR system was as follows: 5 μl 2×AceQ®qPCRSYBR®GreenMasterMix, 0.2 μl Primer-F / R (10 μM), 1 μl cDNA, and ddH2O to a final volume of 10 μl. After preparation, the qRT-PCR was performed on a Roche 480 real-time quantitative PCR instrument, with three replicates per experiment. The program was as follows: pre-denaturation: 95℃ for 5 min; amplification program, 40 cycles: 95℃ for 10 s, 60℃ for 30 s; extension: 72℃ for 5 min; 10℃ for 3 min, 40 cycles. Data processing: Based on the CT values obtained from qRT-PCR, using TaActin as an internal reference gene, the expression levels of different samples relative to the control were calculated. -△△CT Where △△CT = (CT) Target -CT Actin ).
[0043] Example 4: Verification of PmRc1 function using single-cell transient expression technology
[0044] To verify the disease resistance function of PmRc1, the full-length PmRc1 was amplified using recombinant primers P9: TGGAGAGAACACGGGGGATCCATGGTGATGGTCGCCTTGTC (SEQ ID NO.11) and P10: AACGTCGTATGGGTAAGGCCTTTAGCCCGACCTACCTGGCT (SEQ ID NO.12), with a length of 2643 bp (SEQ ID NO.13). This amplified PmRc1 was then inserted between the BamHI and SacI restriction sites of pBI220 (described in the literature "Zhu YF, Li YB, Fei F, et al. E3 ubiquitin ligase gene CMPG1–V from Haynaldiavillosa L. contributes to powdery mildew resistance in common wheat (Triticumaestivum L.)[J]. The Plant Journal, 2015, 48(1):154-168.") to obtain the overexpression vector pBI220-PmRc1. Figure 4A). The formation of haustoria in powdery mildew is fundamental for plant cells to absorb nutrients for growth and reproduction, and is often used as an important indicator of resistance to powdery mildew. Using gene gun-mediated single-cell transient expression technology, pBI220-PmRc1 and pWMB220-GUS were co-expressed in the young leaves of the susceptible material Yangmai 158. Using Yangmai 158 co-expressed with pBI220 and pWMB220-GUS as a negative control, it was found that: when GUS was expressed alone (empty control), the haustoria index (HI) of Yangmai 158 was 64.59%; when GUS and pBI220-PmRc1 were co-transformed, the haustoria index (HI) of Yangmai 158 was 33.14%. Figure 4 B) This indicates that transient overexpression of PmRc1 can inhibit the formation of the accumulator to some extent.
[0045] The above technologies can be achieved through the following methods:
[0046] 1. Construction of the overexpression vector pBI220-PmRc1
[0047] Using a cloning plasmid containing the full length of PmRc1 as a template, PCR amplification was performed using recombinant primers P9 and P10. The pBI220 empty vector was digested with BamHI and SacI restriction enzymes. The linearized vector and the amplified target fragment were purified and recovered. Using the Novavirenz ClonExpress II One Step Cloning Kit, the following mixture was prepared: X μL linearized vector, Y μL insert fragment, 2 μL 5×CE II Buffer, 1 μL Exnase II, and ddH2O added to a final volume of 10 μL (X = [0.02 × vector base pairs] ng, Y = [0.04 × fragment base pairs] ng). After thorough mixing, the mixture was incubated at 37°C for 30 min. The transformation and sequencing methods are described in Example 4, gene cloning method.
[0048] 2. Overexpression of PmRc1 in young leaves of Yangmai 158 using single-cell transient expression technology.
[0049] Single-cell transient expression technology: The mixed expression vector was thoroughly mixed with gold powder and then bombarded with epidermal cells of fresh leaves of Yangmai 158 at the two-leaf stage using a PDS1000 / He gene gun transformation system. The bombardment conditions were as follows: a ruptureable membrane with a diameter of 1.0 cm and a pressure of 900 psi was used, and the vacuum level during bombardment was 27 inches. The steps are as follows:
[0050] (1) Preparation of gold powder: Weigh 30 mg of gold powder into a 1.5 mL Eppendorf tube; add 70% alcohol, vortex for 5 min, and let stand for 15 min to allow the gold powder to precipitate completely; centrifuge for 5 sec and discard the supernatant; repeat the above step 3 times. Add 1 mL of water, vortex for 1 min, let stand for 1 min, centrifuge for 2 sec and discard the supernatant; add 50% glycerol and vortex thoroughly until homogeneous, and store at -20℃.
[0051] (2) Bullet preparation: After removing the gold powder from -20℃, vortex for 5 min; pipette the gold powder into a 1.5 mL Eppendorf tube at a rate of 2 µL / gun; add the plasmid at a rate of 1 µg / gun; while vortexing, add 50 µL of 2.5 M CaCl2 to the Eppendorf tube, then add 20 µL of 0.1 M spermine, vortex for 3 min; let stand for 1 min, centrifuge for 2 sec, and discard the supernatant; add 140 µL of 70% ethanol, vortex thoroughly, centrifuge for 2 sec, and discard the supernatant; add 140 µL of 100% ethanol, vortex thoroughly, centrifuge for 2 sec, and discard the supernatant; add 15 µL of 100% ethanol, vortex thoroughly, and prepare for use.
[0052] (3) Bombardment: After fully vortexing the wrapped bullets again, evenly coat them onto the macrocarriers and let them air dry; install the rupture membrane, and wet the rupture membrane with anhydrous ethanol before installation; place the macrocarriers on the first layer, place the culture medium with Yangmai 158 leaves on the second layer, and then vacuum to 28 inches; turn on the switch to bombard.
[0053] 3. Staining of powdery mildew haustoria and statistical analysis of haustoria index
[0054] A lower haustorium index indicates stronger resistance to powdery mildew. The haustorium index is the proportion of cells forming haustoria out of the total interacting cells. The staining of haustoria and the statistical analysis of the haustorium index in this study can be performed following these steps:
[0055] Leaves bombarded with gene gun were cultured in the dark for 4-6 h and then inoculated with wheat powdery mildew. About 42 h after inoculation, the leaves were immersed in staining solution and then placed in a 37℃ incubator for 12-24 h for GUS staining. The presence or absence of haustoria was observed in cells infected with powdery mildew spores and expressing the GUS reporter gene under a microscope, and the haustoria index was counted.
Claims
1. A Roegneria kamoji PmRcl gene, characterized in that, The nucleotide sequence is shown as SEQ ID NO.
1.
2. The protein encoded by the Roegneria kamoji PmRcl gene according to claim 1, characterized by, The amino acid sequence is shown as SEQ ID NO.
2.
3. A recombinant expression vector containing the PmRc1 gene of Roegneria filiformis according to claim 1.
4. The recombinant expression vector of claim 3, wherein, The PmRc1 gene of Roegneria filiformis according to claim 1 is inserted into the BamHI and SacI enzyme cutting sites of the pBI220 vector to obtain the recombinant expression vector.
5. The PmRc1 gene of Roegneria filiformis according to claim 1 is used to improve the resistance of plants to powdery mildew.
6. Use according to claim 5, characterized in that, The plant is wheat.
7. The recombinant expression vector according to claim 3 or 4 is used to improve the resistance of plants to powdery mildew.
8. Use according to claim 7, characterized in that, The plant is wheat.
9. The PmRc1 gene of Roegneria filiformis according to claim 1 or the recombinant expression vector according to claim 3 or 4 is used to breed wheat varieties with resistance to powdery mildew.
10. A method of breeding plants, characterized in that, The activity and / or content of the protein according to claim 2 in the target plant is increased, so that the resistance of the target plant to powdery mildew is enhanced.