Method for realizing wheat haploid induction through function knockout of wheat phospholipase gene TaPLD3
By knocking out the wheat phospholipase gene TaPLD3, a homozygous triple mutant line TaPLD3-KO was created using CRISPR/Cas9 gene editing technology. This solved the problem of low haploid induction efficiency in wheat, realized an efficient haploid induction method, and improved breeding efficiency and speed.
Patent Information
- Application Number
- CN202511753622.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-26
- Publication Date
- 2026-01-16
AI Technical Summary
Existing wheat haploid induction technology is inefficient, and the haploid induction efficiency varies among different wheat genotypes, which limits breeding efficiency and speed.
By knocking out the wheat phospholipase gene TaPLD3, a homozygous triple mutant line TaPLD3-KO was created using CRISPR/Cas9 gene editing technology. Gene editing was then achieved through a BSMV virus delivery system. Combined with next-generation sequencing and genetic screening, an efficient haploid induction method was obtained.
It significantly improved the efficiency of wheat haploid induction, shortened the breeding cycle, increased breeding efficiency, and accelerated the pace of wheat breeding improvement.
Smart Images

Figure CN121344066A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics and breeding, specifically involving the application of the TaPLD3 gene in wheat in inducing haploids in common wheat. Background Technology
[0002] Common wheat (Triticum aestivum L, 2n=6x=42, AABBDD) is one of the world's most widely cultivated food crops, providing food for approximately 20% of the world's population. Innovations in wheat breeding technology are crucial for ensuring food security. Traditional wheat breeding relies on multiple generations of self-pollination or backcrossing to achieve phenotypic homozygosity and fixation, a lengthy and inefficient process typically requiring 6-8 years. Haploid breeding technology can generate homozygous double haploid (DH) populations containing different genotype combinations within two generations, thus shortening the breeding cycle to 2-3 years and significantly improving breeding efficiency. Traditional methods for inducing wheat haploids include distant hybridization with maize pollen or wheat anther culture. Achieving hybridization between wheat and maize requires simultaneous growth of both crops, a process highly dependent on greenhouses except in specific regions, resulting in high energy consumption. Wheat anther culture, on the other hand, suffers from limitations such as strong genotype dependence, complex operation, and unstable success rates. In recent years, the discovery and application of haploid-induced genes, especially the successful utilization of the ZmMTL (MATRILINEAL) gene derived from maize and its homologs in wheat, have provided a revolutionary solution to this bottleneck and demonstrated great application value.
[0003] Haploid-inducing genes are a class of genes that play a crucial role in the normal pairing or integrity of chromosomes during gamete formation, development, and fusion. By mutating or knocking out these genes, the genome of one gamete can be eliminated during zygote formation, resulting in a haploid. Taking the maize ZmMTL gene as an example, its encoded phospholipase is essential for sperm cells to maintain chromosome integrity. When ZmMTL function is lost, sperm carrying the mutated gene can still fertilize an egg, but their genome will be selectively eliminated during subsequent embryonic development. Ultimately, the resulting embryo contains only the maternal chromosome set, thus developing into a maternal haploid. Subsequently, treatment with chemical agents such as colchicine can double the chromosomes of the haploid cells, yielding homozygous fertile DH plants. The discovery and application of haploid-induced genes such as MTL, DMP, PLD3, POD65, and CENH3 have not only reduced the application cost of double haploid breeding technology and expanded its application scope, but also promoted the development of emerging breeding technologies such as haploid-induced gene editing (HI-Editing), laying a technological foundation for future biological breeding.
[0004] Although haploid inducible genes have broad application prospects in crop haploid breeding, their application in wheat still faces challenges. For example, mutations in the same haploid inducible gene can result in different haploid induction efficiencies in different wheat genotypes. Therefore, it is necessary to further search for inducible genes with higher induction rates and greater universality, or to improve haploid induction efficiency through combinations of mutants of different haploid inducible genes. For example, simultaneously knocking out ZmDMP while editing ZmMTL / ZmPLA1 / ZmNLD could be considered. [7] Genes can significantly improve the haploid induction efficiency of maize. Currently, among the haploid induction-related genes discovered, only MTL and CENH3 have been proven applicable to wheat haploid induction, hindering the development of efficient wheat haploid induction lines. Therefore, identifying and utilizing wheat haploid induction genes and creating different haploid induction lines are of great significance for improving wheat haploid induction efficiency and accelerating wheat germplasm improvement. Summary of the Invention
[0005] The purpose of this invention is to address the aforementioned shortcomings of existing technologies by providing the application of wheat haploid induction genes.
[0006] Another objective of this invention is to provide a gene editing target, editing vector, and application of the wheat phospholipase gene TaPLD3.
[0007] Another object of the present invention is to provide a method for inducing wheat haploids.
[0008] The objective of this invention can be achieved through the following technical solutions:
[0009] The application of a knockout of the phospholipase gene TaPLD3 in common wheat in the creation of three subgenome triple mutants of the wheat TaPLD3 gene (A, B, and D) and / or the induction of wheat haploids, wherein the sequences of the phospholipase gene TaPLD3 in the three subgenomes (A, B, and D) are shown in SEQ ID NO. 1-3, and the encoded protein sequences are shown in SEQ ID NO. 4-6, respectively.
[0010] The gene editing target for knocking out the phospholipase gene TaPLD3 in common wheat has the sequence shown in SEQ ID NO.7.
[0011] The application of the gene editing target described herein in the creation of three subgenomic triple mutants of wheat TaPLD3 gene A, B, and D and / or the induction of wheat haploids.
[0012] A gene editing vector for knocking out the phospholipase gene TaPLD3 in common wheat contains sgRNA targeting the conserved regions of the three subgenomic homologous genes A, B, and D of the TaPLD3 gene, wherein the target sequence of the sgRNA is the gene editing target.
[0013] The application of the gene editing vector in creating three subgenomic triple mutants of wheat TaPLD3 gene A, B, and D and / or inducing wheat haploids.
[0014] A method for inducing haploidy in wheat includes the following steps:
[0015] (1) Using the gene editing vector described in claim 4, the three subgenomic homologous genes A, B, and D of the TaPLD3 gene in wheat were knocked out by gene editing technology to obtain the homozygous triple mutant line TaPLD3-KO.
[0016] (2) The homozygous three-mutant line TaPLD3-KO was used as the male parent and crossed with the target wheat variety;
[0017] (3) Screen haploid plants from hybrid offspring.
[0018] Preferably, in step (1), the TaPLD3 gene is edited by the BSMV virus delivery system. Specifically, the gene editing vector is transcribed in vitro and then infects transgenic wheat expressing Cas9 protein. After two generations of genetic screening and molecular identification, a homozygous triple mutant line TaPLD3-KO is obtained.
[0019] The preferred primers for screening the homozygous triple mutant line TaPLD3-KO are:
[0020] TaPLD3T1NeF: AAAAATGGTGAGCAACAGCT;
[0021] TaPLD3T1NeR:GGAGCTTGACGTGGATCTTG.
[0022] Preferably, the target wheat variety is Xumai 19129.
[0023] Preferably, in step (3), haploid plants are screened by a combination of chromosome counting and Cas9 marker identification. The Cas9 marker detection primers are:
[0024] zCas9-233F: ATCGGCATTCCATCAAGAAG;
[0025] zCas9-423R:CTCCAGCCTGTGGAAGAAAG.
[0026] Beneficial effects:
[0027] This invention has discovered a new haploid induction gene, TaPLD3, in common wheat. Knocking out this gene can improve the efficiency of wheat haploid induction, thereby improving wheat double haploid breeding technology and accelerating the speed of wheat breeding improvement. Attached Figure Description
[0028] Figure 1 Gene structure diagrams of homologous genes in the three subgenomes A, B, and D of the wheat TaPLD3 gene, and the genotype of the homozygous triple mutant line TaPLD3-KO.
[0029] Figure 2 Phenotypic diagrams of haploid plants and normal plants induced by the homozygous triple mutant line TaPLD3-KO, as well as corresponding chromosome DAPI staining diagrams.
[0030] Figure 3 Cas9 marker identification in haploid plants of Xumai 19129 induced by the homozygous triple mutant line TaPLD3-KO and normal ploidy hybrid lines. Detailed Implementation
[0031] Example 1: Creation of a homozygous triple mutant line TaPLD3-KO based on CRISPR / Cas9 gene editing technology.
[0032] (1) Gene editing targets were designed and vectors were constructed based on the homolog of the maize haploid inducible gene ZmPLD3 in common wheat, TaPLD3.
[0033] Based on the comparison of the maize haploid-induced gene ZmPLD3 (PHOSPHOLIPASE D3) with the reference genome sequences of Chinese spring wheat varieties published by the IWGSC (International Wheat Genome Sequencing Consortium) and the Fielder reference genome, high homology was found in the A, B, and D subgenomes of the TaPLD3 gene. Further analysis was conducted on the conserved nucleotide sequences of the three copies in the Fielder genome within the TaPLD3 gene coding region (…). Figure 1 A CRISPR / Cas9 target was designed and named TaPLD3T1. The target sequence is GGAGGGGATCGAGGACACGG (SEQ ID NO.7), and the target PAM sequence is TGG.
[0034] (2) The BSMV virus delivery system creates the TaPLD3 mutant.
[0035] To achieve TaPLD3 gene editing, this invention utilizes a previously reported method for inducing wheat gene editing using barley stripe mosaic virus.
[13] A sgRNA sequence targeting the conserved region of the TaPLD3 gene was inserted into a BSMVγ vector. After in vitro transcription, the vector was used to infect transgenic wheat plants expressing Cas9 protein using a friction inoculation method. Utilizing the systemic diffusion characteristics of the BSMV virus, simultaneous triple-copy editing of the TaPLD3 gene was achieved in three subgenomes (A, B, and D). TaPLD3 mutants were screened from the progeny plants of the inoculated wheat. The transgenic plants expressing Cas9 protein were transgenic lines introduced into the pBUE411 empty vector (a plasmid for plant genome editing and gene regulation based on CRISPR / Cas published by Addgene, number #62200) in a wheat Fielder background. This vector uses the Ubiqutin promoter to drive Cas9 protein expression and the sgRNA transcription is guided by the Pol III promoter.
[0036] sgRNA: GGAGGGGATCGAGGACACGG gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
[0037] The specific steps for in vitro transcription and inoculation of the virus are as follows:
[0038] The α, β, and γ viral RNA fractions were transcribed in vitro using pBSMVα, pBSMVβ, and pBSMVγ plasmids linearized with MluI, SpeI, and MluI enzymes, respectively. The pBSMVγPDS plasmid and all plasmids expressing the BSMV γ fraction carrying sgRNA were linearized with BssHII. The pBSMVγPDS plasmid was used as a positive control to knock down the phytoene dehydrogenase gene (PDS), causing bleaching of plant leaves. In vitro transcription was performed in 20 μL systems using the HiScribe™ T7 High Yield RNA Synthesis Kit, following the manufacturer's Capped RNA Synthesis protocol. An m7G(5′)ppp(5′)GRNA capping analog was used at a 4:1 ratio to GTP. After RNA synthesis is complete, the quality and concentration of RNA transcripts are assessed by agarose gel electrophoresis (usually between 2–2.5 μg / μL).
[0039] Inoculate the second leaf of two-leaf stage wheat seedlings with FES buffer, BSMV (α, β, and γ), BSMV-PDS (α, β, and γ-PDS), or BSMV-sgRNAs (α, β, and γ-sgRNA). The inoculation mixture per plant contains 60 μL of FES buffer and 2.5 μL each of the α, β, and γ BSMV fractions. The FES buffer contains 7.51 g / L glycine, 10.45 g / L dipotassium hydrogen phosphate, 10 g / L sodium pyrophosphate decahydrate, 10 g / L bentonite, and 10 g / L diatomaceous earth. Wearing clean nitrile gloves, inoculate the second leaf (from base to tip) by rubbing. Repeat this process three times per plant, adding 20 μL of the mixture each time. Immediately after inoculation, cover the plant with a plastic bag to retain moisture, and remove the bag 5–7 days post-inoculation. Each experiment included three control groups: FES buffer, wild-type BSMV, and BSMV-PDS. Viral infection symptoms typically appeared 7–10 days post-inoculation, while the PDS knockdown phenotype appeared 12–15 days post-inoculation.
[0040] (3) The TaPLD3 gene homozygous triple mutant line TaPLD3-KO was obtained by second-generation sequencing screening.
[0041] After successfully creating the mutant, next-generation sequencing (NGS) was used to confirm the mutation type. Genomic DNA was extracted and sequenced from the progeny of the docking plants to analyze the mutation status of the TaPLD3 gene in three subgenomes. By comparing with the wild-type gene sequence, the specific mutation sites and mutation types of the TaPLD3 gene in the mutant were determined. After two generations of genetic screening and molecular identification, the homozygous triple mutant line TaPLD3-KO was successfully obtained. The detection primers are as follows:
[0042] TaPLD3T1NeF: AAAAATGGTGAGCAACAGCT
[0043] TaPLD3T1NeR:GGAGCTTGACGTGGATCTTG
[0044] Example 2: Verification of the haploid induction rate (HIR) of the homozygous triple mutant line TaPLD3-KO
[0045] (1) HIR induction efficiency of self-pollination haploid in the homozygous triple mutant line TaPLD3-KO
[0046] By examining the chromosome number of the self-pollinated progeny of the homozygous triple mutant line TaPLD3-KO through root cutting, haploid plants were screened. No wheat with 21 chromosomes was found among the 168 self-pollinated progeny.
[0047] (2) HIR induction efficiency of cross-pollination haploid in the homozygous triple mutant line TaPLD3-KO
[0048] The homozygous triple mutant line TaPLD3-KO was crossed with Xumai 19129. The hybrids were identified by root cutting to observe chromosome number and screen for haploid plants. One haploid plant with 21 chromosomes was selected from the offspring of the TaPLD3-KO / Xumai 19129 cross. Figure 2 (Table 1).
[0049] Table 1. Identification of haploid induction efficiency of self-pollination of the homozygous tri-mutant line TaPLD3-KO and haploid induction efficiency of cross-pollination after hybridization of the homozygous tri-mutant line TaPLD3-KO and Xumai 19129.
[0050]
[0051] Example 3: Identification of haploid plants using Cas9 markers
[0052] Since Xumai 19129 does not contain Cas9 protein, while the TaPLD3-KO line contains Cas9 plasmid DNA, the haploids induced by the TaPLD3-KO line in Xumai 19129 show that the Cas9 plasmid DNA disappears along with the induced chromosome, leaving only the maternal chromosome. Using Cas9 detection primers zCas9-233F and zCas9-423R, Cas9 markers were amplified by PCR in the hybrid offspring of the homozygous triple mutant line TaPLD3-KO and Xumai 19129 from Example 2. Cas9 marker-positive results indicate normal ploidy in wheat, while Cas9 marker-negative results suggest haploid wheat. Figure 3 ).
[0053] zCas9-233F:ATCGGGCATTCCATCAAGAAG
[0054] zCas9-423R: CTCCAGCCTGTGGAAGAAAG
[0055] [1]Zhang N, Qi X, Wu L, et al. Accelerating wheat breeding by haploidinduction[J]. The Crop Journal, 2025: S2214514125001072.
[0056] [2]Guan X, Peng J, Fu D. Technology for Production of Wheat DoubledHaploid via Maize Pollen Induction—Updated Review[J]. Agronomy, 2024, 14(2):375.
[0057] [3]Niazian M, Shariatpanahi M E. In vitro-based doubled haploidproduction: recent improvements[J]. Euphytica, 2020, 216(5): 69.
[0058] [4]Kelliher T, Starr D, Richbourg L, et al. MATRILINEAL, a sperm-specific phospholipase, triggers maize haploid induction[J]. Nature, 2017,542(7639): 105-109.
[0059] [5]Liu C, Zhong Y, Qi X, et al. Extension of the in vivo haploidinduction system from diploid maize to hexaploid wheat[J]. PlantBiotechnology Journal, 2020, 18(2): 316-318.
[0060] [6]Liu C, Li X, Meng D, et al. A 4-bp Insertion at ZmPLA1 Encoding aPutative Phospholipase A Generates Haploid Induction in Maize[J]. MolecularPlant, 2017, 10(3): 520-522.
[0061] [7]Zhong Y, Liu C, Qi X, et al. Mutation of ZmDMP enhances haploidinduction in maize[J]. Nature Plants, 2019, 5(6): 575-580.
[0062] [8]Li Y, Lin Z, Yue Y, et al. Loss-of-function alleles of ZmPLD3cause haploid induction in maize[J]. Nature Plants, 2021, 7(12): 1579-1588.
[0063] [9]Jiang C, Sun J, Li R, et al. A reactive oxygen species burstcauses haploid induction in maize[J]. Molecular Plant, 2022, 15(6): 943-955.
[0064]
[10] Lv J, Yu K, Wei J, et al. Generation of paternal haploids inwheat by genome editing of the centromeric histone CENH3[J]. NatureBiotechnology, 2020, 38(12): 1397-1401.
[0065]
[11] Kelliher T, Starr D, Su X, et al. One-step genome editing ofelite crop germplasm during haploid induction[J]. Nature Biotechnology, 2019,37(3): 287-292.
[0066]
[12] Qi X, Guo S, Zhong Y, et al. Establishment of an efficienthaploid identification system by engineering anthocyanin accumulation in thewheat embryo[J]. Plant Communications, 2023, 4(3): 100568.
[0067]
[13] Wang W, Yu Z, He F, et al. Multiplexed promoter and gene editingin wheat using a virus‐based guide RNA delivery system[J]. PlantBiotechnology Journal, 2022, 20(12): 2332-2341.
[0068] SEQ ID NO.1:
[0069]
[0070] SEQ ID NO.2:
[0071]
[0072] SEQ ID NO.3:
[0073]
[0074] SEQ ID NO.4:
[0075] MARILLHGTLHVTVFEGEGITNNSRPSSQAPQFLRKLVEGIEDTVGVGKGASKLYATVGLGKARIGRTRTLNDESSTPRWFESFHIYCAHLASDVLFTIKGSSTIGAAVVGTGYLPVRDIYGGDEVERWLPLCDDRRNPVEGGGKIHVKLQYFDISKDRAWGRGIRSGKNPGVPYTFFSQRQGCKVTLYQDAHIPDGFIPRIPLDDGRCYEPHRCWEDIFAAISNAKHLIYITGWSVYTEIALLRDANRPKPAGGGVTLGELLKKKAGEGVRVLMLVWDDRTSVGVLKKDGLMATHDEETMNYFQDTDVHCVLCPRDPDDSGSFVQDLQISTMFTHHQKTIIVDHDMPQSGGGRRRRILSFVGGLDLCDGRYDTPFHSLFGTLDGPHHDDFHQPNFATAAIAKGGPREPWHDIHCRLEGPVAWDVLYNFEQRWRKQGGKDLLVQLRDLADDIIPPSPVMHAEDREAWNVQLFRSIDGGAAFGFPDNPEDAAKAGLVSGKDQIIDRSIQDAYICAIRRAKSFIYIENQYFLGSSYCWKPDGIDPDDVGALHLLPKELSMKVVSKIEAGERFTVYVVVPMWPEGIPASGSVQAILDWQRRTMEMMYSDIAQAIQAKGIDAKPKDYLTFFCLGNREAKKPGEYQPPEPAEPDSDYLKAQQNRRFMIYVHTKMMIVDDEYIIVGSANINQRSMDGARDSEIAMGGYQPGHLATSRPARGQVHGFRMALWYEHLGMMDDAFQRPESLDCVHKVNAMAERYWDLYAADGPERDLPGHLLTYPVSVTGDGSVTQLPGVEFFPDTEARILGAKSDYLPPILTT
[0076] SEQ ID NO.5:
[0077] MARILLHGTLHVTVFEGEGITNNSRPSSQAPQFLRKLVEGIEDTVGVGKGASKLYATIGLGKARIGRTRTLTDESSTPRWFESFHIYCAHLASDVLFTIKGSSTIGASVVGTGYLPVRDIYGGDEVERWLPLCDDSRNPVEGGGKIHVKLQYFDISKDRAWGHGIRSGKNPGVPYTFFSQRQGCKVTLYQDAHIPDGFIPRIPLDDGRCYEPHRCWEDIFAAISNAKHLIYITGWSVYTEIALLRDANRPKPAGGGVTLGELLKKKAGEGVRVLMLVWDDRTSVGVLKKDGLMATHDEETMNYFQDTDVHCVLCPRDPDDSGSFVQDLQISTMFTHHQKTVIVDHDMPQSGGGRRRRILSFVGGLDLCDGRYDTPFHPLFGTLDGPHHDDFHQPNFATAAIAKGGPREPWHDIHCRLEGPVAWDVLYNFEQRWRKQGGKDLLVQLRDLADDIIPPSPVMHAEDREAWNVQLFRSIDGGAAFGFPDNPEDAAKAGLVSGKDQIIDRSIQDAYICAIRRAKSFIYIENQYFLGSSYCWKPDGINPDDVGALHLLPKELSMKVVSKIEAGERFTVYVVVPMWPEGIPASGSVQAILDWQRRTMEMMYTDIAQAIEAKGIDAKPKDYLTFFCLGNREAKKSGEYQPPEQAEPDSDYLKAQQNRRFMIYVHTKMMIVDDEYIIVGSANINQRSMDGARDSEIAMGGYQPGHLATSRPARGQVHGFRMALWYEHLGMVDEAFQRPESLECVHKVNAMAERYWDLYAGDGPERDLPGHLLTYPVSVTGDGAVTQLPGMEFFPDTSARILGAKSDYLPPILTT
[0078] SEQ ID NO.6:
[0079] MARILLHGTLHVTVFEGEGITNNSRPSSQAPQFLRKLVEGIEDTVGVGKGASKLYATVGLGKARIGRTRTLNDESSTPRWFESFHIYCAHLATDVLFTIKGSSTIGASVVGTGYLPVRDIYGGDEVERWLPLCDDSRNPVEGGGKIHVKLQYFDISKDRAWGRGIRSGKNPGVPYTFFSQRQGCKVTLYQDAHIPDGFIPRIPLDDGRCYEPHRCWEDIFAAISNAKHLIYITGWSVYTEIALLRDANRPKPAGGGVTLGELLKKKAGEGVRVLMLVWDDRTSVGVLKKDGLMATHDEETMNYFQDTDVHCVLCPRDPDDSGSFVQDLQISTMFTHHQKTVIVDHDMPQSGGGRRRRILSFVGGLDLCDGRYDTPFHPLFGTLDGPHHDDFHQPNFATAAIAKGGPREPWHDIHCRLEGPVAWDVLYNFEQRWRKQGGKDLLVQLRDLADDIIPPSPVMHAEDREAWNVQLFRSIDGGAAFGFPDNPEDAAKAGLVSGKDQIIDRSIQDAYICAIRRAKSFIYIENQYFLGSSYCWKRDGIDPDDVGALHLLPKELSMKVVSKIEAGERFTVYVVVPMWPEGIPASGSVQAILDWQRRTMEMMYSDIAQAIQAKGIDAKPKDYLTFFCLGNREAKKSGEYEPPEQAEPDSDYLKAQQNRRFMIYVHTKMMIVDDEYIIVGSANINQRSMDGARDSEIAMGGYQPGHLATSRPARGQVHGFRMALWYEHLGMMDEAFQRPESLECVHKVNAMAERYWDLYAADGPERDLPGHLLTYPVSVTGDGSVTQLPGVEFFPDTEARILGGKSDYLPPILTT
[0080] SEQ ID NO.7:
[0081] GGAGGGGATCGAGGACACGG
Claims
1. A knockout phospholipase gene in common wheat TaPLD3 In the creation of wheat TaPLD3 The application of three sub-genome triple mutant and / or induction of haploid wheat, said phospholipase gene TaPLD3 in The sequences in the three sub-genomes A, B, and D are shown in SEQ ID NO. 1-3, respectively.
2. Used to knock out phospholipase genes in common wheat TaPLD3 Gene editing targets, characterized by, The sequence is shown as SEQ ID NO.
7.
3. The gene editing target of claim 2 in creating wheat TaPLD3 Application of three subgenomic triple mutants of genes A, B, D and / or inducing haploids in wheat.
4. A gene editing vector for knocking out a phospholipase gene in common wheat TaPLD3 characterized by, The sgRNA targets the conserved regions of the A, B and D subgenomic homologous genes of the TaPLD3 gene.
5. The gene editing vector of claim 4 for creating wheat TaPLD3 Application of three subgenomic triple mutant of genes A, B, D and / or inducing haploid in wheat.
6. A method for inducing haploidy in wheat, characterized by, The method comprises the following steps: (1) using the gene editing vector of claim 4 to knockout the A, B and D subgenomic homologous genes of the TaPLD3 gene in wheat by gene editing technology, to obtain a homozygous triple mutant strain TaPLD3-KO; (2) using the homozygous triple mutant strain TaPLD3-KO as a male parent to cross with a target wheat variety; (3) screening haploid plants from the hybrid offspring.
7. The method of claim 6, wherein, In step (1), the editing of the TaPLD3 gene is achieved by a BSMV virus delivery system, specifically, the gene editing vector of claim 4 is transcribed in vitro and then used to infect transgenic wheat expressing Cas9 protein, and a homozygous triple mutant strain TaPLD3-KO is obtained through two generations of genetic screening and molecular identification.
8. The method of claim 6, wherein, The detection primers for screening the homozygous triple mutant strain TaPLD3-KO are: TaPLD3T1NeF: AAAAATGGTGAGCAACAGCT; TaPLD3T1NeR: GGAGCTTGACGTGGATCTTG. The target wheat variety is Xu Mai 19129.
9. The method of claim 6, wherein, In step (3), haploid plants are screened by combining chromosome counting and Cas9 marker identification, and the Cas9 marker detection primers are: zCas9-233F: ATCGGCATTCCATCAAGAAG; zCas9-423R: CTCCAGCCTGTGGAAGAAAG.
10. The method of claim 6, wherein,