Method for synergistically improving yield and protein content of wheat in multiple environments by dual gene editing
By using the CRISPR/Cas9 system to perform dual gene editing on the wheat genome, the problem of the negative correlation between yield and protein content in wheat breeding was solved, and the synergistic improvement of multiple traits under different planting environments was achieved, especially maintaining stable high yield and quality under low nitrogen conditions.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-06-23
Smart Images

Figure CN121344071B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering, and in particular to a method for synergistically improving multiple traits of wheat grain yield, protein content, and flour sedimentation value under different planting environments through dual gene editing. Background Technology
[0002] With the continuous growth of the global population and the increasing demand for healthy diets, the demand for high-quality plant protein has increased dramatically. Wheat (Triticum aestivum L.), as a major food crop in my country and globally, has made improving its yield and quality a primary goal in wheat breeding, directly impacting human food security. Wheat possesses unique processing qualities, primarily determined by the protein stored in its seeds. High yield and quality of wheat play a crucial role in ensuring national food security and improving people's living standards. Therefore, yield and grain protein content are key target traits in wheat breeding and production, but these two traits are usually negatively correlated. To simultaneously increase yield and grain protein content, large amounts of nitrogen fertilizer are typically applied in production. Increased nitrogen fertilizer application significantly increases wheat planting costs and leads to serious environmental pollution. Moreover, once grain protein content and yield reach a certain level, further increases in nitrogen fertilizer application no longer have a positive effect.
[0003] Improving wheat quality through traditional breeding methods that regulate grain protein content is time-consuming and prone to errors. In contrast, the CRISPR / Cas9 system allows for precise and efficient site-directed mutations of target genes, thereby improving desired traits. The emergence of gene editing technologies such as CRISPR / Cas9 has provided unprecedented tools for the precise and efficient improvement of crop traits. Unlike transgenic technology, gene editing can "fine-tune" the crop's own genes without introducing foreign genes, thus accelerating its application. Plant protein synthesis is a highly complex network; editing a single gene may have limited effects or bring unknown side effects (such as yield reduction). Future development will require more complex multi-gene editing systems.
[0004] In summary, in wheat breeding, there is often a negative correlation between high yield and high quality (such as high protein and excellent processing quality) in terms of genetics and physiology, making it difficult to improve them synergistically. This is especially true under low nitrogen stress environments, such as infertile soils or environments with reduced nitrogen fertilizer application. There is an urgent need to develop new technologies to improve wheat yield, protein content, sedimentation value and other traits under different planting environments. Summary of the Invention
[0005] Based on the existing problems of limited single-gene improvement effects in wheat gene editing technology, the contradiction between yield and protein content, and poor adaptability of yield and protein content improvement to low-nitrogen environments, the technical problem to be solved by this invention is to provide a method for synergistically improving multiple traits of wheat through dual-gene editing in different planting environments, so as to achieve synergistic improvement of processing quality such as wheat yield, grain protein content, and flour sedimentation value, especially maintaining stable effects in low-nitrogen environments.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.
[0007] This invention includes a method for improving wheat yield and quality traits under different planting environments. By co-editing one or more groups of genes in the wheat genome, multiple traits such as wheat grain yield, protein content, and sedimentation value can be improved simultaneously under different planting environments.
[0008] As a preferred embodiment of the present invention, the different planting environments include at least a low-nitrogen planting environment and / or a normal nitrogen-application planting environment.
[0009] As a preferred embodiment of the present invention, the wheat yield and quality traits include at least the following traits:
[0010] Protein content of wheat grains;
[0011] Sedimentation value of wheat flour;
[0012] Wheat grain yield;
[0013] Any one of the indicators listed above or any combination of the indicators listed above;
[0014] All of the indicators listed above.
[0015] As a preferred technical solution of the present invention, by co-editing the genes shown in SEQ ID NO.1 and / or SEQ ID NO.2 in the wheat genome, multiple traits of wheat yield and quality can be improved simultaneously under different planting environments.
[0016] As a preferred embodiment of the present invention, the specific method for co-editing the genes shown in SEQ ID NO. 1 and / or SEQ ID NO. 2 in the wheat genome is selected from:
[0017] Simultaneously knock out the genes shown in SEQ ID NO. 1 and / or SEQ ID NO. 2; or:
[0018] Simultaneously reduce the expression levels of the genes shown in SEQ ID NO. 1 and / or SEQ ID NO. 2; or:
[0019] The genes shown in SEQ ID NO. 1 and / or SEQ ID NO. 2 were co-edited using a combination of gene engineering methods, including knockout and expression suppression.
[0020] As a preferred embodiment of the present invention, when co-editing the genes shown in SEQ ID NO. 1 and / or SEQ ID NO. 2 in wheat, the corresponding gene loci on the three sets of homologous chromosomes of the wheat genome, namely subgenome A, subgenome B and subgenome D, are simultaneously co-edited.
[0021] As a preferred technical solution of the present invention, a CRISPR / Cas9 system is used to design specific gRNAs targeting the subgenomic sites of genes A, B, and D shown in SEQ ID NO.1 and / or SEQ ID NO.2. A dual gene editing vector is constructed by tRNA-mediated gRNA tandem technology, and homozygous dual gene mutants are screened after transformation of wheat callus tissue.
[0022] Methods to improve the overall quality and yield of wheat in nitrogen-deficient areas include genetically modifying wheat using the methods described above.
[0023] On the other hand, the present invention also includes gRNA primer pairs constructed by the above method, comprising the following two sets:
[0024] The gRNA primer pairs corresponding to SEQ ID NO.1 are: SEQ ID NO.3 and SEQ ID NO.4; specifically: SEQ ID NO.3-sgRNA-F:5'-CTTGCGTGTACGACTCCATGTACA-3'; SEQ ID NO.4-sgRNA-R:5'-AAACTGTACATGGAGTCGTACACG-3';
[0025] The gRNA primer pairs corresponding to SEQ ID NO.2 are: SEQ ID NO.5 and SEQ ID NO.6; specifically: SEQ ID NO.5-sgRNA-F: 5'-CACCCCCCGGCATCTTCCGCTCGC-3'; SEQ ID NO.6-sgRNA-R: 5'-GTGGGCGAGCGGAAGATGCCGGGG-3';
[0026] On the other hand, the present invention also includes a dual gene editing vector constructed by the above method.
[0027] On the other hand, the present invention also includes the above-described method for constructing a dual gene editing vector, the method comprising the following steps:
[0028] A. Preparation of gRNA tandem fragments: Based on the binary expression vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-PolyA-CaMV term, primers were designed and overlap PCR technology was used to amplify the dual gene tandem fragments.
[0029] B. Vector construction: The amplified dual gRNA tandem fragment was ligated with the enzyme-digested vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-PolyA-CaMV term using homologous recombinase to obtain the dual gene knockout vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-tRNA-gRNA1-tRNA-gRNA2-tRNA-PolyA-CaMV term.
[0030] Finally, the present invention also includes transgenic wheat plants constructed by the above method and their offspring.
[0031] The beneficial effects of adopting the above technical solution are as follows: by inhibiting the expression and / or activity of two groups of genes and their proteins in wheat, the present invention simultaneously improves wheat grain yield, seed protein content and wheat flour processing quality, and the effect remains stable under low nitrogen environment. The test results showed that: ① Simultaneous knockout of both genes significantly increased the protein content in wheat seeds. Under normal nitrogen application and low nitrogen conditions, the protein content of the knockout mutants was on average 34.30% and 32.87% higher than that of the wild-type control, respectively. Under normal nitrogen application, the protein content was 22.37% and 35.63% higher than that of the TaANT knockout mutant and the TaLOB single knockout mutant, respectively, and 21.07% and 29.19% higher, respectively, under low nitrogen conditions. ② The sedimentation value of wheat flour from the simultaneous knockout mutants was on average 32.05% and 37.63% higher than that of the recipient variety under normal and low nitrogen levels, respectively. ③ Simultaneously, the simultaneous knockout mutants significantly increased wheat grain yield. Under normal and low nitrogen conditions, the grain yield of the knockout mutants was on average 12.04% and 13.65% higher than that of the wild-type control, respectively. —It is particularly noteworthy that even under reduced nitrogen fertilizer application, the simultaneous knockout mutants still significantly increased wheat yield and seed protein content.
[0032] In summary, this invention has significant advantages such as a significant dual-gene synergistic effect (significant improvement compared to single-gene editing), synergistic improvement of multiple traits (yield-protein-processing quality), strong adaptability to low nitrogen, and high gene editing efficiency with low screening cost, and has good application prospects. Attached Figure Description
[0033] Figure 1This is a schematic diagram showing the sequencing results of TaANT-7A, 7B, 7D genes and TaLOB-2A, 2B, 2D genes in the T3 generation mutant lines.
[0034] Figure 2 This is a schematic diagram of the grain yield phenotypic traits of wheat mutants with TaANT and TaLOB genes knocked out simultaneously under different nitrogen supply levels in the T3 generation.
[0035] Figure 3 This diagram illustrates the protein content of wheat grains from the T3 generation, including the TaANT and TaLOB genes, as well as mutants with both TaANT and TaLOB genes knocked out, under different nitrogen supply levels.
[0036] Figure 4 Schematic diagram of sedimentation values of T3 generation wheat with TaANT and TaLOB genes, as well as mutants with simultaneous knockout of TaANT and TaLOB genes, under different nitrogen supply levels. Detailed Implementation
[0037] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are commercially available products and can be directly obtained through market purchase.
[0038] It should be understood that, when used in this application specification and the appended claims, the term "comprising" indicates the presence of the described features, integrals, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or a collection thereof.
[0039] It should also be understood that the term “and / or” as used in this application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.
[0040] As used in this application specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrase "if determined" or "if detected [the described condition or event]" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once detected [the described condition or event]," or "in response to detection [the described condition or event]."
[0041] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.
[0042] References to "one embodiment" or "some embodiments" as described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.
[0043] Example 1: Construction of single-gene knockout vectors for wheat TaANT and TaLOB genes
[0044] The nucleotide sequences of wheat homologs ANT and LOB were retrieved from the EnsemblPlants database (http: / / plants.ensembl.org / Triticum aestivum / Info / Index), as shown in SEQ ID NO.1 (TaANT-7A 1479bp) and SEQ ID NO.2 (TaLOB-2A 924bp), and these candidate genes were cloned from the recipient material Jimai 325. Simultaneous knockout target sites for A, B, and LOB were designed for each of the three genomes. The specific target sequences are as follows:
[0045] TaANT target gene knockout target sequence 5'- CGTGTACGACTCCATGTACA TGG -3' (SEQ ID NO. 7); (underline indicates PAM sequence), used as primer pairs for constructing gRNA:
[0046] ANT-sgRNA-F: 5'- CTTG CGTGTACGACTCCATGTACA-3' (SEQ ID NO. 3);
[0047] ANT-sgRNA-R: 5'- AAAC TGTACATGGAGTCGTACACG-3' (SEQ ID NO. 4);
[0048] TaLOB target gene knockout target sequence CCG CCCCGGCATCTTCCGCTCGC -3' (SEQ ID NO.8); (underlined indicates PAM sequence), primer pair used to construct gRNA:
[0049] LOB-sgRNA-F: 5'- CACC CCCCGGCATCTTCCGCTCGC-3' (SEQ ID NO.5);
[0050] LOB-sgRNA-R: 5'- GTGG GCGAGCGGAAGATGCCGGGG-3' (SEQ ID NO. 6);
[0051] The primer pairs ANT-sgRNA-F and ANT-sgRNA-R, and LOB-sgRNA-F and LOB-sgRNA-R, were annealed to form double-stranded DNA with sticky ends. These double-stranded DNAs were then ligated into the pTaU6-sgRNA vector digested with BpiI. After transformation into DH5α, colony PCR was performed on single-clone plaques using the M13F and gRNA-R primers. The amplified product was approximately 400 bp. Single-clone plaques that were positive for colony PCR were sequenced. For plaques with correct sequencing, the colonies were shaken, and plasmids were extracted. Specifically, the DNA fragments 5'-CGTGTACGACTCCATGTACA-3' (SEQ ID NO. 9) and 5'-CCCCGGCATCTTCCGCTCGC-3' (SEQ ID NO. 10) were inserted in the forward direction at the BpiI restriction site of the pTaU6-sgRNA plasmid to obtain pTaU6-gRNA. ANT and pTaU6-gRNA LOB Recombinant plasmid.
[0052] In wheat cells, when the pJIT163-Ubi-Cas9 vector and pTaU6-gRNA plasmid are present simultaneously, the pTaU6-gRNA plasmid expresses gRNA. The gRNA guides the Cas9 protein to cut in the target sequence region, creating a double-strand break. During the spontaneous repair of this break by the cell, a large number of mutations (including insertions, deletions, etc., which can inactivate gene function) are introduced.
[0053] Example 2: Construction of a wheat TaANT+TaLOB dual gene knockout vector
[0054] The binary expression vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-PolyA-CaMV used was provided by the Institute of Genetics and Developmental Biology.
[0055] Basic tRNA and TracrRNA-tRNA fragments were obtained using overlap PCR. Using primers tRNA-F1, tRNA-F2, and tRNA-R (Table 1), basic tRNA fragments were obtained. In the first round of PCR, using tracrRNA as a template, amplification was performed using primers TraRNA-F / tRNA-TracrRNA-MT-R2 (Table 1) to obtain tracrRNA fragments with tRNA adapters. In the second round of PCR, using the PCR product tRNA fragment as a template, amplification was performed using primers TracrRNA-MT-tRNA-F3 / tRNA-wR (Table 1) to obtain tRNA fragments with tracrRNA adapters. In the third round of PCR, a mixture of the first round PCR product tracrRNA fragment and the second round tRNA fragment at a 1:1 molar ratio was used as a template, and amplification was performed using primers TraRNA-F / tRNA-wR to obtain the basic TracrRNA-tRNA fragment.
[0056] The tRNA-gRNA1(TaANT)-tRNA-gRNA2(TaLOB)-tRNA fragment was obtained using overlap PCR. In the first round of PCR, the tRNA fragment was used as a template and amplified using primers 9-TaU6-tRNA-F / 9-TaANT-tRNA-R (Table 1) to obtain the tRNA fragment carrying the TaANT gene target sequence. Using the TracrRNA+tRNA fragment as a template, amplification was performed using primers 9-TaANT-TrRNA-F / 9-TaLOB-tRNA-R and 9-TaLOB-TrRNA-F / PolyA-Hind-tRNA-R (Table 1) to obtain the gRNA1(TaANT)-tRNA and gRNA2(TaLOB)-tRNA fragments with adapters, respectively. The second round of PCR used a mixture of the first round PCR product containing the tRNA fragment carrying the TaANT gene target sequence, gRNA1 (TaANT)-tRNA, and gRNA2 (TaLOB)-tRNA fragments in a molar ratio of 1:1:1 as a template. The mixture was then amplified using primers TaU6-w-F0 / Poly-t-R0 (Table 1) to obtain the tRNA-gRNA1 (TaANT)-tRNA-gRNA2 (TaLOB)-tRNA fragment.
[0057] The fragment was ligated with the HindIII (NEB, Beijing, China) digested vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-PolyA-CaMV term using homologous recombinase (TransGold, Beijing, China) to obtain the TaANT+TaLOB dual gene knockout vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-tRNA-gRNA1(TaANT)-tRNA-gRNA2(TaLOB)-tRNA-PolyA-CaMV term.
[0058] Example 3: Obtaining Transgenic Wheat
[0059] The pJIT163-Ubi-Cas9 vector plasmid was combined with the TaANT gene knockout vector plasmid pTaU6-gRNA. ANT pJIT163-Ubi-Cas9 vector plasmid and TaLOB gene knockout vector plasmid pTaU6-gRNA LOB The TaANT and TaLOB double knockout vector plasmids were introduced into the wheat variety Jimai 325 via gene gun-mediated transformation. The editing status of the regenerated plants was identified by genome-specific amplification and sequencing of the transgenic plants.
[0060] Whether the target gene has been edited needs to be determined by sequencing. Specific primers for the A, B, and D genomes of TaANT and TaLOB proteins were designed (as shown in Table 1). PCR amplification was performed on transgenic wheat using these specific primers to further determine the specific locations of the mutations on the A, B, and D genomes, and then verified by sequencing. In the T0 generation, transgenic plants with site-directed mutations in the wheat TaANT and TaLOB genes were obtained.
[0061] Table 1. List of primers used in this invention
[0062]
[0063]
[0064] T0 generation transgenic plants were self-crossed twice to obtain T2 generation plants, including plants with site-directed mutations in both the TaLOB-2B and TaLOB-2D genes (lob-bd), and plants with site-directed mutations in all three genes (lob-abd). Transgenic plants with site-directed mutations in the wheat TaANT gene were obtained, including plants with site-directed mutations in the TaANT-7A, TaANT-7B, and TaANT-7D genes (ant-30, ant-61); and homozygous knockout mutants with site-directed editing of both the TaANT and TaLOB genes (ant-lob-3, ant-lob-7). Sequencing results for different types of mutations are shown in [link to documentation]. Figure 1 .
[0065] Example 4: Phenotypic Observation
[0066] Seeds of the T2 generation homozygous mutant and the wild-type control Jimai 325 (WT) were sown in the field. Two nitrogen fertilizer supply levels were set up: low nitrogen (6 kg N / mu) and normal nitrogen (15 kg N / mu). All other growth and harvest conditions were normal. At wheat harvest, yield, grain protein, and wet gluten content of flour were measured and analyzed. Each material had four replicates. The results are as follows: Figure 2 Under different nitrogen application levels, the triple mutants ant-30 and ant-61, with mutations at different sites in the A, B, and D genomes of the TaANT gene, showed an average yield increase of 8.40% compared to the wild-type control under low nitrogen conditions and an average yield increase of 6.64% under normal nitrogen application levels. The mutant lines lob-bd and lob-abd, with mutations at different sites in the B, D, A, B, and D genomes of the TaLOB gene, showed yield increases of 9.14% and 12.06% and 8.04% and 10.71% compared to the wild-type control under low and normal nitrogen levels, respectively. The double knockout mutant lines ant-lob-3 and ant-lob-7, with simultaneous mutations in the A, B, and D genomes of both TaANT and TaLOB proteins, showed average yield increases of 13.09% and 12.04% compared to the wild-type control under low and normal nitrogen conditions, respectively, and average yield increases of 4.59% and 5.07% compared to the TaANT gene knockout mutant lines. However, there was no significant difference in grain yield between the TaLOB gene knockout mutant lines and the wild-type control under the two nitrogen levels.
[0067] The total protein content in mature seeds of the above-mentioned T3 generation TaANT and TaLOB gene mutants, as well as the gene-edited homozygous mutant lines with simultaneous knockout of TaANT and TaLOB genes and the wild-type control Jimai 325, was determined using a near-infrared spectroscopy (Borton DA7200). The results showed that under low nitrogen levels, the grain protein content of the mutant lines ant-lob-3 and ant-lob-7 with simultaneous knockout of TaANT and TaLOB proteins was increased by 31.65% and 34.08% respectively compared to the wild-type control, by an average of 19.96% and 22.18% compared to the triple-mutant lines of the TaANT gene, and by an average of 30.20% and 28.18% compared to the mutant lines lob-bd and lob-abd of the TaLOB gene. The TaANT gene knockout mutant showed a 9.23% and 9.78% increase in seed protein content compared to the wild-type control under normal and low nitrogen application conditions, respectively; the TaLOB gene knockout mutant showed a -0.98% and 2.85% increase in seed protein content compared to the wild-type control under normal and low nitrogen application conditions, respectively. These results indicate that simultaneously knocking out the TaANT and TaLOB genes in wheat can significantly increase the total protein content in the grain.
[0068] Wheat sedimentation value is a comprehensive indicator reflecting the protein content and quality of wheat. The magnitude of the sedimentation value indirectly reflects the overall protein, gluten content, and dough rheological characteristics of wheat. In breeding, screening wheat varieties with higher or lower sedimentation values can specifically improve wheat quality and enhance food processing quality. The sedimentation value of flour from mature seeds of the above-mentioned T3 generation TaANT and TaLOB genes, as well as homozygous mutant lines with double knockout of TaANT and TaLOB genes, and the wild-type control Jimai 325, was determined using the GB / T 21119—2007 (Wheat Sedimentation Index Determination Method - Zeleny Test). The results showed that under low nitrogen levels, the sedimentation values of the TaANT and TaLOB double knockout mutant lines ant-lob-3 and ant-lob-7 were 37.23% and 38.03% higher than the wild-type control, respectively, and an average of 32.4% higher than the triple-molecular-weight mutant lines of the TaANT gene. The sedimentation values of TaANT and TaLOB gene double knockout mutants, ant-lob-3 and ant-lob-7, were 4% and 29.20% higher than the wild-type control, respectively, representing an average increase of 36.54% and 34.43% compared to the TaLOB gene mutant lines lob-bd and lob-abd. Under normal nitrogen application levels, the sedimentation values of TaANT and TaLOB gene double knockout mutant lines ant-lob-3 and ant-lob-7 were 34.10% and 30.00% higher than the wild-type control, respectively, representing an average increase of 22.93% and 19.17% compared to the TaANT gene triple knockout mutant lines, and an average increase of 29.73% and 25.76% compared to the TaLOB gene mutant lines lob-bd and lob-abd. Under normal and low nitrogen application conditions, the sedimentation values of TaANT gene knockout mutants were 9.99% and 10.36% higher than the wild-type control, respectively; under normal and low nitrogen application conditions, the sedimentation values of TaLOB gene knockout mutants were 3.38% and 6.07% higher than the wild-type control, respectively. The above results indicate that the double knockout mutant lines of the TaANT and TaLOB genes can synergistically balance the negative correlation between yield and grain protein content. Under conditions of increased and decreased nitrogen fertilizer application, they can achieve stable or even increased yields, while significantly improving the protein content of wheat seeds.
[0069] As demonstrated in the above embodiments, this invention simultaneously edits the A, B, and D subgenomic sites of two characteristic genes in wheat using the CRISPR / Cas9 system, constructs a tRNA-mediated dual gRNA tandem vector to achieve synchronous editing, and obtains homozygous mutants. Under normal and low nitrogen conditions, these mutants show significant improvements in grain protein content, flour sedimentation value, and yield, breaking through the bottleneck of the negative correlation between wheat yield and protein content. This achieves synergistic improvement in yield, nutritional quality, and processing quality, providing an efficient and practical new technological direction for breeding high-quality and high-yield wheat, and possesses fundamental and important application value.
[0070] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.
[0071] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.
Claims
1. A method for improving wheat yield and quality traits under different planting environments, characterized by: The different planting environments are low-nitrogen planting environment and normal nitrogen application planting environment; The wheat yield and quality traits are the following: protein content of wheat grains, sedimentation value of wheat flour, and wheat grain yield. By co-editing the genes shown in SEQ ID NO.1 and SEQ ID NO.2 in the wheat genome, it is possible to simultaneously improve wheat yield and quality traits under different planting environments; the specific method of co-editing is as follows: Using the CRISPR / Cas9 system, specific sgRNAs targeting subgenomic sites A, B, and D of genes shown in SEQ ID NO.1 and SEQ ID NO.2 were designed. A dual-gene editing vector was constructed using tRNA-mediated sgRNA tandem technology, and homozygous dual-gene mutants were screened after transformation into wheat callus tissue. The constructed sgRNA primer pairs include the following two sets: SEQ ID NO.3-sgRNA-F:5'-CTTGCGTGTACGACTCCATGTACA-3'; SEQ ID NO.4-sgRNA-R:5'-AAACTGTACATGGAGTCGTACACG-3'; as well as: SEQ ID NO.5-sgRNA-F:5'-CACCCCCCGGCATCTTCCGCTCGC-3'; SEQ ID NO. 6-sgRNA-R: 5'-GTGGGCGAGCGGAAGATGCCGGGG-3'.
2. The sgRNA primer pair constructed according to claim 1 comprises the following two sets: SEQ ID NO.3-sgRNA-F:5'-CTTGCGTGTACGACTCCATGTACA-3'; SEQ ID NO.4-sgRNA-R:5'-AAACTGTACATGGAGTCGTACACG-3'; as well as: SEQ ID NO.5-sgRNA-F:5'-CACCCCCCGGCATCTTCCGCTCGC-3'; SEQ ID NO. 6-sgRNA-R: 5'-GTGGGCGAGCGGAAGATGCCGGGG-3'.
3. The dual gene editing vector constructed according to claim 1.
4. The method for constructing a dual gene editing vector according to claim 3, characterized in that: The method includes the following steps: A. Preparation of gRNA tandem fragments: Based on the binary expression vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-PolyA-CaMV term, primers were designed and overlap PCR technology was used to amplify the dual gene tandem fragments. B. Vector construction: The amplified dual gRNA tandem fragment was ligated with the enzyme-digested vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-PolyA-CaMV term using homologous recombinase to obtain the dual gene knockout vector pJIT163-Ubi-NLS-Cas9-NLS-E9-TaU6-tRNA-gRNA1-tRNA-gRNA2-tRNA-PolyA-CaMV term.
5. The transgenic wheat plant constructed by the method of claim 1.
Citation Information
Patent Citations
Crop nitrogen utilization efficiency and grain yield collaborative improvement method based on gene editing technology
CN114990151A