Application of products that detect molecular markers in anthelmintics in anthelmintics identification

By designing specific primer pairs for PCR reaction, Plantago asiatica can be rapidly identified, solving the problem that traditional Chinese medicine identification methods struggle to distinguish Plantago asiatica from closely related species and counterfeit products, simplifying the operation process and reducing costs.

CN121344233BActive Publication Date: 2026-06-30江西省 中国科学院庐山植物园
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
江西省 中国科学院庐山植物园
Filing Date
2025-10-17
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Traditional methods for identifying Chinese medicinal materials rely on experience and judgment, making it difficult to accurately distinguish Plantago asiatica from its closely related species and counterfeits. Furthermore, existing DNA identification technology is susceptible to contamination and is complex to operate, increasing costs.

Method used

Design specific primer pairs (shown in SEQ ID NO.2 to SEQ ID NO.3) to perform PCR reaction. If a band with a size of 97 appears as shown in SEQ ID NO.1, it is identified as Plantago asiatica.

Benefits of technology

The method enables the extraction of specific primer pairs for PCR reaction, and if a band with a size of 97 bp as shown in SEQ ID NO.1 appears, it can be identified as Plantago asiatica.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344233B_ABST
    Figure CN121344233B_ABST
Patent Text Reader

Abstract

This invention relates to the field of identification technology for traditional Chinese medicine, specifically disclosing the application of products detecting molecular markers in Plantago asiatica for the identification of Plantago asiatica, as shown in SEQ ID NO.1. The molecular marker shown in SEQ ID NO.1 provided by this invention serves as a specific sequence molecule for Plantago asiatica, and the presence or absence of this specific sequence molecule in the plant can be used to identify whether a plant is Plantago asiatica.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of identification technology of traditional Chinese medicine, specifically to the application of products that detect molecular markers in Plantago asiatica in the identification of Plantago asiatica. Background Technology

[0002] Traditional methods for identifying Chinese medicinal herbs rely heavily on the experience and subjective judgment of the appraisers, such as visual inspection, water testing, fire testing, smelling, and tasting. These methods demand a high level of professional competence from the appraisers. However, this approach is highly subjective, making identification extremely difficult when dealing with closely related species and easily confused varieties, and the training of personnel is also very lengthy.

[0003] DNA identification technology for traditional Chinese medicine relies on the specificity of species DNA to identify medicinal materials, offering stability and specificity far exceeding traditional methods. ITS2 is the most widely used core sequence. ITS2 is a non-coding sequence between the 5.8S and 28S nucleotides in rDNA, with a length of 200-300 bp. Due to its rapid evolution, intraspecific conservation, ease of amplification and sequencing, and the availability of numerous universal primers, it has become an ideal marker. The identification process involves extracting DNA from the medicinal material, amplifying ITS2 using universal primers via PCR, sequencing, and comparing it with a standard sequence. Species are determined through similarity and phylogenetic analysis. This technology can distinguish closely related species from counterfeits, is applicable to various samples, and has been included in the Chinese Pharmacopoeia. It can identify counterfeit traditional Chinese medicines, control raw materials for prepared Chinese medicines, assist in the investigation of wild medicinal materials, and provide molecular evidence for the standardization of traditional Chinese medicine. It plays a crucial role in ensuring quality and combating counterfeits.

[0004] front of the car ( Plantago asiatica As a commonly used medicinal material in the Chinese Pharmacopoeia, the quality and efficacy of Plantago asiatica directly affect the safety and effectiveness of clinical use. However, Plantago asiatica and its closely related species and adulterants are highly similar in morphology, especially after processing, making accurate differentiation difficult using traditional morphological identification methods alone. Confusion between Plantago asiatica and its closely related species and adulterants may not only affect the efficacy of the medicine but may even lead to adverse reactions due to differences in components, posing potential risks to patients' health.

[0005] Currently, the ITS2 sequence is the universal sequence for Plantago asiatica DNA identification. However, it is easily contaminated by DNA from other species, and its sequence differs from closely related species by only a few bases. This limitation places high demands on laboratory personnel, and the Plantago asiatica ITS2 sequence requires further differentiation through sequencing or cumbersome single-base discrimination techniques, increasing the complexity and cost of DNA identification experiments. Therefore, it is necessary to explore a new approach for identifying Plantago asiatica medicinal herbs. Summary of the Invention

[0006] To develop a new method for identifying Plantago asiatica, this invention provides the application of products that detect Plantago asiatica molecular markers in the identification of Plantago asiatica. The molecular marker shown in SEQ ID NO.1 provided by this invention serves as a specific sequence molecule for Plantago asiatica, and the presence or absence of this specific sequence molecule in the plant can be used to identify whether a plant is Plantago asiatica.

[0007] This invention provides the application of products that detect molecular markers in the identification of carnivores, the molecular markers being shown in SEQ ID NO.1.

[0008] The molecular marker shown in SEQ ID NO.1 provided by this invention serves as a specific sequence molecule for Plantago asiatica. The presence of this specific sequence molecule in the plant can identify whether it is Plantago asiatica. If the plant DNA contains the specific sequence molecule shown in SEQ ID NO.1, with a size of 97 bp, it can be identified as Plantago asiatica.

[0009] Furthermore, the product is a reagent or kit for detecting vegetative molecular markers.

[0010] Furthermore, the reagent or kit includes the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3.

[0011] Furthermore, the kit also includes Q5 PCR enzyme, dNTPs, and ddH2O.

[0012] Furthermore, the product used to detect molecular markers on the front of the vehicle is used to detect molecular markers on the front of the vehicle ( Plantago asiatica ), front of the large vehicle ( Plantago major L.), Andrographis paniculata ( Andrographis paniculata (Burm. f.)Wall.ex Nees inWallich), Sophora flavescens ( Descurainia sophia (L.) Webb ex Prantl) and Isatis indigotica ( Isatis tinctoria L.) identified the front of the car ( Plantago asiatica ).

[0013] The present invention also provides a product for detecting vegetative molecular markers, the product comprising the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3.

[0014] This invention designs specific primer molecules (SEQ ID NO.2 to SEQ ID NO.3) for the specific sequence molecule of Plantago asiatica shown in SEQ ID NO.1, and achieves the purpose of identifying Plantago asiatica by detecting whether the specific sequence molecule of Plantago asiatica is present in plant DNA.

[0015] The present invention also provides a method for identifying the front of a vehicle, comprising the following steps:

[0016] DNA was extracted from the leaves of plants that resemble Plantago asiatica in appearance and used as a template. PCR reaction was performed using the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3. The PCR products were detected by gel electrophoresis. If a band with a sequence as shown in SEQ ID NO.1 and a size of 97 bp appeared, it was identified as Plantago asiatica.

[0017] Furthermore, the PCR reaction system was 20 μL: 4 μL of 5×Q5 Buffer, 0.2 μL of Q5 PCR enzyme, 0.4 μL of 10 mM dNTP, 0.5 μL of upstream primer, 0.5 μL of downstream primer, 1 μL of DNA template, and 13.4 μL of ddH2O.

[0018] Furthermore, the PCR reaction program was as follows: 98 °C for 1 min; 98 °C for 10 s, 58 °C for 20 s, 72 °C for 20 s, 40 cycles; 72 °C for 10 min.

[0019] The present invention also provides a method for identifying the front of a vehicle, comprising the following steps:

[0020] Using the DNA from the plant leaves to be tested as a template, qPCR was performed using the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3. If a signal was successfully detected, the plant was identified as Plantago asiatica.

[0021] This invention uses a simple real-time quantitative PCR (QPCR) reaction to directly observe positive samples from the front of the plant through a threshold.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] The molecular marker shown in SEQ ID NO.1 provided by this invention serves as a specific sequence molecule for Plantago asiatica. The presence of this specific sequence molecule in the plant can identify whether it is Plantago asiatica. If the plant DNA contains the specific sequence molecule shown in SEQ ID NO.1, with a size of 97 bp, it can be identified as Plantago asiatica.

[0024] This invention also designs primer pairs (SEQ ID NO.2-SEQ ID NO.3) for specific detection of the molecular marker shown in SEQ ID NO.1. Using these primer pairs, PCR and gel electrophoresis can be employed for detection. If the amplified product is a 97 bp band, it is identified as Plantago asiatica. These primer pairs can also be used for the identification of Plantago asiatica DNA as a traditional Chinese medicine via qPCR. If a signal is successfully detected, it is identified as Plantago asiatica. This approach avoids complex experimental procedures such as sequencing and database comparison, reducing experimental costs. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a detection diagram of specific primers for Plantago asiatica DNA identification; in the diagram, M is a 2000 bp DNA marker, and lanes 1, 2, 3, 4 and 5 represent DNA samples from Plantago asiatica, Plantago asiatica var. sarcodactylis, Andrographis paniculata, Artemisia annua, and Isatis tinctoria leaves, respectively.

[0027] Figure 2 The images show the qPCR results for Plantago asiatica, Plantago asiatica var. chinensis, Andrographis paniculata, Dioscorea nipponica, and Isatis indigotica; each species has 3 replicates, and the numbers 1, 2, and 3 in the upper right corner indicate 3 replicates for Plantago asiatica identification (exceeding the baseline threshold).

[0028] Figure 3 for Figure 2 The peak diagram of DNA fragment melting curves from three detected front-end samples.

[0029] Figure 4 qPCR test results for front-end samples from 16 market sources and 3 easily confused samples;

[0030] In the figure, A represents the material appearance of 16 front vehicle samples and 3 easily confused samples;

[0031] B represents the qPCR test results of 16 front-end samples and 3 easily confused samples. Detailed Implementation

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0033] This invention obtains Plantago asiatica genomic DNA information through high-throughput sequencing. By comparing and analyzing the sequence with a database, a DNA sequence with significant species specificity was discovered, which can serve as a specific molecular marker for the molecular identification of traditional Chinese medicine. Using this sequence, we designed specific PCR primers and can rapidly identify Plantago asiatica DNA through a simple real-time quantitative PCR (QPCR) reaction without further sequencing. This effectively solves the problem of complex identification procedures for Plantago asiatica and significantly reduces costs compared to technologies such as TaqMan.

[0034] Example 1: A molecular marker for identifying Plantago asiatica and its application.

[0035] I. Obtaining Molecular Markers

[0036] 1. Genome-specific DNA sequence analysis of Plantago asiatica

[0037] Genomic DNA was extracted from *Plantago asiatica* and sent to Beijing Novogene Technology Co., Ltd. for DNA library construction to obtain high-throughput sequencing information. The NCBI NT database (https: / / ftp.ncbi.nlm.nih.gov / blast / db / ) was downloaded, and BLAST was used to compare the high-throughput sequencing information with the NT database to screen for specific *Plantago asiatica* DNA fragments, using an E value > 1e... -5 A threshold is used for initial screening. Sequences that have passed this initial screening are then further compared with those from the front of the vehicle (…). Plantago major The genome of *Plantago asiatica* (NCBI accession number JAIFAC000000000) was further compared, and *Plantago asiatica*-specific DNA fragments were screened using the view function of Samtools software. Finally, manual screening was performed using IGV software.

[0038] Filter to obtain a section of the front of the car ( Plantago asiatica The genome-specific DNA sequence is shown in SEQ ID NO.1.

[0039] SEQ ID NO.1:

[0040] Gacgtaagtagtcaaaaagtaatgaacgaaactgacgaaatatttaaattcaacaccaagctatataaaaataaccctcaaatcctaaatcactggc.

[0041] A sequence similarity search (using the BLAST function) using the NCBI database (https: / / www.ncbi.nlm.nih.gov) showed that no highly similar sequences from other species were found. Therefore, this sequence can serve as a molecular marker for Plantago asiatica identification.

[0042] 2. Primer design

[0043] The upstream primer shown in SEQ ID NO. 2 and the downstream primer shown in SEQ ID NO. 3 were designed based on the DNA sequence described in SEQ ID NO. 1.

[0044] SEQ ID NO.2: GACGTAAGTAGTCAAAAAGT;

[0045] SEQ ID NO. 3: GCCAGTGATTTAGGATTTG.

[0046] II. Application of Molecular Markers in the Identification of Plantago asiatica and its Close Relatives

[0047] 1. Experimental materials

[0048] Plant variety: Plantain ( Plantago asiatica ), front of the large vehicle ( Plantago major L.), Andrographis paniculata ( Andrographis paniculata (Burm. f.)Wall.ex Nees in Wallich), *Potentilla chinensis* ( Descurainia sophia (L.) Webb ex Prantl) and Isatis indigotica ( Isatis tinctoria L.).

[0049] Reagent kit: TIANGEN Plant Genomic DNA Extraction Kit (DP305).

[0050] 2. Primer specificity detection

[0051] DNA was extracted from the leaves of the aforementioned plant varieties according to the method described in the instructions of the TIANGEN Plant Genomic DNA Extraction Kit (DP305).

[0052] Using DNA from the leaves of Plantago asiatica, Plantago asiatica var. chinensis, Andrographis paniculata, Dipsacus asperoides, and Isatis tinctoria as templates, PCR reactions were performed using the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.

[0053] The PCR reaction system consisted of 20 μL: 4 μL of 5×Q5 Buffer, 0.2 μL of Q5 PCR enzyme, 0.4 μL of 10 mM dNTP, 0.5 μL of upstream primer, 0.5 μL of downstream primer, 1 μL of DNA template, and 13.4 μL of ddH2O.

[0054] Q5 enzyme: DNA polymerase from NEB, catalog number M0491S; this Q5 enzyme comes with a 5X Q5 enzyme buffer. dNTP: A product of NEB, catalog number N0447S, at a concentration of 10 mM.

[0055] The PCR reaction program was as follows: 98 °C for 1 min; 98 °C for 10 s, 58 °C for 20 s, 72 °C for 20 s, 40 cycles; 72 °C for 10 min.

[0056] The above PCR products were detected by gel electrophoresis, and the results are as follows: Figure 1 As shown, this specific primer can only detect the plantago-aquatica DNA-specific band (97 bp), while DNA from other species shows a negative reaction. This indicates that SEQ ID NO.2–SEQ ID NO.3 are specific for plantago-aquatica.

[0057] 3. Detection using real-time fluorescent PCR (qPCR)

[0058] Using DNA from the leaves of Plantago asiatica, Plantago asiatica var. chinensis, Andrographis paniculata, Dioscorea nipponica, and Isatis tinctoria as templates, three replicates were set up for each group, and qPCR reactions were performed using the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.

[0059] The qPCR reaction system was 10 μL: 5 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.2 μL of upstream primer, 0.2 μL of downstream primer, 1 μL of DNA template, and 3.6 μL of ddH2O.

[0060] ChamQ Universal SYBR qPCR Master Mix is ​​a product of Novizan, with product number Q711-03.

[0061] The qPCR reaction program was as follows: 95 ℃ pre-denaturation for 30 s; 95 ℃ for 5 s, 60 ℃ for 30 s, 40 cycles; 65 ℃ for 15 s, 95 ℃ for 15 s. Melting curve analysis was performed after the PCR reaction.

[0062] The result is from Figure 2 The results showed that only the area in front of the vehicle (3 samples) successfully detected a signal, while the others failed to pass the threshold detection. Furthermore, from... Figure 3 The melting curve results show that the melting peak of this primer pair is quite specific. These data indicate that the primer pair designed in this experiment has significant specificity for the identification of Plantago asiatica DNA and can be quickly detected by fluorescence quantitative methods.

[0063] 4. QPCR testing of plant samples from market sources and easily confused samples.

[0064] Sixteen samples of plantain (plantain leaves) were purchased from the market, and three easily confused Chinese herbal medicines were randomly purchased, namely, Eupatorium fortunei (…). Eupatorium fortunei Turcz.), thistle ( Cirsium setosum (Willd.) MB.), Houttuynia cordata ( Houttuynia cordata Leaves of *Plantago asiatica* were examined. DNA was extracted from these samples according to the instructions of the TIANGEN Plant Genomic DNA Kit (DP305). DNA was extracted from 16 *Plantago asiatica* samples and 3 easily confused samples using primers designed for this experiment. qPCR detection was performed using the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.

[0065] The qPCR reaction system was 10 μL: 5 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.2 μL of upstream primer, 0.2 μL of downstream primer, 1 μL of DNA template, and 3.6 μL of ddH2O.

[0066] The qPCR reaction program was as follows: 95 ℃ pre-denaturation for 30 s; 95 ℃ for 5 s, 60 ℃ for 30 s, 40 cycles; 65 ℃ for 15 s, 95 ℃ for 15 s. Melting curve analysis was performed after the PCR reaction.

[0067] from Figure 4 The results showed that all tested front samples were detectable with high consistency, reaching a detection threshold of approximately 24-26 cycles. However, the three adulterants failed to pass the threshold detection. The experimental results demonstrate that the specific primers and qPCR reaction system used in this experiment can be used for rapid DNA detection of commercially available front samples.

[0068] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0069] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of products detecting phytoprey molecular markers in the identification of phytoprey, characterized in that, The molecular marker is shown in SEQ ID NO.1; the product for detecting the prefrontal molecular marker includes the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.

3.

2. The application of the product for detecting pre-plant molecular markers according to claim 1 in the identification of pre-plant, characterized in that, The product is a reagent or kit for detecting vegetative molecular markers.

3. The application of the product for detecting pre-plant molecular markers according to claim 2 in the identification of pre-plant, characterized in that, The kit also includes Q5 PCR enzyme, dNTPs, and ddH2O.

4. The application of the product for detecting pre-plant molecular markers according to claim 3 in the identification of pre-plant, characterized in that, The product used to detect molecular markers on the front of the vehicle is used to detect molecular markers on the front of the vehicle ( Plantago asiatica ), front of the large vehicle ( Plantago major L.), Andrographis paniculata ( Andrographis paniculata (Burm. f.)Wall.ex Nees in Wallich), *Potentilla chinensis* ( Descurainiasophia (L.) Webb ex Prantl) and Isatis indigotica ( Isatistinctoria L.) identified the front of the car ( Plantagoasiatica ).

5. A product for detecting molecular markers on the front of a vehicle, characterized in that, The products for detecting pre-vehicle molecular markers include primer pairs shown in SEQ ID NO.2 to SEQ ID NO.

3.

6. A method for identifying the front of a vehicle, characterized in that, Includes the following steps: Using the DNA from the plant leaf to be tested as a template, a PCR reaction was performed using the primer pairs shown in SEQ ID NO.2 to SEQ ID NO.3 of claim 1. The PCR products were then detected by gel electrophoresis. If a band of 97 bp appeared, the plant was identified as Plantago asiatica.

7. The method for identifying carpenter's nose according to claim 6, characterized in that, The PCR reaction system consisted of 20 μL: 4 μL of 5×Q5 Buffer, 0.2 μL of Q5 PCR enzyme, 0.4 μL of 10 mM dNTP, 0.5 μL of primers shown in SEQ ID NO.2, 0.5 μL of primers shown in SEQ ID NO.3, 1 μL of DNA template, and 13.4 μL of ddH2O.

8. The method for identifying car fronts according to claim 6, characterized in that, The PCR reaction program was as follows: 98 °C for 1 min; 98 °C for 10 s, 58 °C for 20 s, 72 °C for 20 s, 40 cycles; 72 °C for 10 min.

9. A method for identifying the front of a vehicle, characterized in that, Includes the following steps: Using the DNA from the plant leaf to be tested as a template, qPCR is performed using the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3 of claim 1. If a signal can be successfully detected, it is identified as Plantago asiatica.

Citation Information

Patent Citations

  • Primer and probe for identifying semen plantaginis or plantago-based antigen, application of primer and probe and identification method

    CN119955969A