VTE high-risk individual screening multi-gene panel kit and application thereof
By integrating a multi-gene panel kit with 18 VTE-related gene loci and a machine learning model, the problems of insufficient genetic risk interpretation and low detection sensitivity in existing technologies have been solved, enabling efficient and accurate VTE risk prediction and personalized screening.
Patent Information
- Application Number
- CN202511950271.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-23
- Publication Date
- 2026-01-20
AI Technical Summary
Current VTE genetic thrombotic susceptibility screening only detects a limited number of gene loci, which cannot explain the genetic risk of a large number of VTE patients. It also lacks risk stratification assessment function, has insufficient detection sensitivity, and cannot integrate gene testing results with clinical risk factors for individualized risk prediction.
A multi-gene panel kit for screening individuals at high risk of VTE was developed, integrating 18 gene loci closely related to VTE. Multiplex PCR amplification and magnetic bead nucleic acid extraction technology were used, combined with a machine learning risk scoring model, to achieve comprehensive assessment and individualized risk stratification.
It covers approximately 40% of the genetic risk of VTE, reduces testing time by 80%, lowers costs by 60%, increases sensitivity to 1%, and achieves a predictive accuracy of 90%, making it suitable for preventive screening of various high-risk groups.
Smart Images

Figure CN121362832A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular diagnostics, in particular to a multi-gene panel kit for screening individuals at high risk of venous thromboembolism and its application in the preparation of VTE risk prediction products. BACKGROUND
[0002] Venous thromboembolism (VTE) is a common cardiovascular disease, including deep vein thrombosis (DVT) and pulmonary embolism (PE). Known genetic thrombophilia includes factor V Leiden mutation, prothrombin G20210A variation, and deficiencies in antithrombin, protein C, and protein S.
[0003] According to PubMed literature reports (Suchon P et al., Assessment of a next generation sequencing gene panel strategy in 133 patients with negative thrombophilia screening, Journal of Thrombosis and Haemostasis, 2024), 28-gene panel was used for next-generation sequencing of 133 VTE patients with negative traditional thrombophilia screening, and 35% of the patients could detect pathogenic or potentially pathogenic variations, indicating that the existing technology has missed diagnosis problems. According to Expert Review of Proteomics (Johansson E et al., Shaping the future of precision medicine: plasma proteomics to uncover insights in thrombosis, 2025), plasma proteomics can capture the comprehensive effects of environmental, genetic and epigenetic factors on thrombosis risk, suggesting that multi-omics joint detection is the future development direction.
[0004] Chinese invention patent CN202010550364.2 discloses a probe set and kit for blood tumor and lymphoma gene detection, which designs probe sequences for capturing ARID2, BRCA2 and other blood tumor related gene regions. However, this invention is aimed at blood tumor rather than VTE risk assessment, and the covered genes have limited correlation with VTE. CN117305457A discloses a blood tumor multi-gene detection kit, which uses probe hybridization capture technology to detect acute myeloid leukemia, myeloproliferative tumor and other blood tumor related genes, but its technical solution is also not applicable to VTE risk prediction.
[0005] Currently, the VTE genetic thrombophilia screening commonly used in clinical practice only detects two sites, coagulation factor V Leiden (F5 rs6025) and prothrombin G20210A (F2 rs1799963), which has the following technical defects: first, the number of detection sites is limited, which can only explain about 10%-20% of the genetic risk of VTE, and the genetic causes of a large number of VTE patients cannot be determined; second, there is a lack of newly discovered VTE related gene sites, such as the ABO blood group gene rs2519093 site, which has been confirmed to have a population attributable risk that exceeds the sum of F5 Leiden and F2 G20210A (Thrombosis Research, 2024, DOI: 10.1016 / j.thromres.2024.109104); third, the existing screening scheme lacks risk stratification assessment function and cannot integrate gene detection results with clinical risk factors for individualized risk prediction; fourth, the detection sensitivity is insufficient, and the detection capability for low-abundance mutations is limited. Therefore, it is urgent to develop a high-efficiency detection kit that covers more VTE related gene sites and has risk stratification assessment function. SUMMARY
[0006] In view of the above deficiencies in the prior art, the purpose of the present application is to provide a VTE high-risk individual screening multi-gene panel kit and its application, which integrates 18 key gene sites closely related to VTE occurrence, constructs a comprehensive evaluation system covering coagulation system, anticoagulation system, fibrinolysis system and vascular endothelial function, and combines machine learning risk scoring model to realize precise screening and individualized risk stratification of VTE high-risk individuals.
[0007] The first aspect of the present application provides a VTE high-risk individual screening multi-gene panel kit, comprising a blood sample nucleic acid extraction assembly, a multi-gene site primer group, a high-fidelity DNA polymerase, a dNTPs mixture, a PCR reaction buffer, and a positive quality control. The multi-gene site primer group is used to amplify 18 gene sites related to venous thromboembolism, including the coagulation factor V gene rs6025 site, the prothrombin F2 gene rs1799963 site, the antithrombin SERPINC1 gene rs2227589 site, the protein C PROC gene rs1799809 site, the protein S PROS1 gene rs6122 site, the coagulation factor XI F11 gene rs2289252 site, the ABO blood group gene rs2519093 site, the plasminogen activator inhibitor PAI-1 gene rs1799889 site, the methylenetetrahydrofolate reductase MTHFR gene rs1801133 site, the tissue factor pathway inhibitor TFPI gene rs8176592 site, the coagulation factor XIII F13A1 gene rs5985 site, the thrombin modulating protein THBD gene rs1042579 site, the endothelial protein C receptor PROCR gene rs867186 site, the fibrinogen beta chain FGB gene rs1800790 site, the coagulation factor VIII F8 gene rs1800291 site, the von Willebrand factor VWF gene rs1063856 site, the kallikrein B1 KLKB1 gene rs3733402 site, and the P-selectin SELP gene rs6136 site.
[0008] Further, the blood sample nucleic acid extraction assembly comprises a cell lysis solution, a proteinase K solution, a magnetic bead suspension, a washing solution, and an elution solution. The cell lysis solution contains guanidine hydrochloride 4-6 mol / L, Tris-HCl buffer pH 8.0 at a concentration of 20-50 mmol / L, disodium ethylenediaminetetraacetate 10-20 mmol / L, and non-ionic surfactant Triton X-100 at a volume fraction of 0.5%-2%. The proteinase K solution has a concentration of 10-20 mg / mL, with glycerol as a stabilizer at a volume fraction of 40%-60%. The magnetic bead suspension has carboxyl functional groups on the surface of the magnetic beads, a particle size of 0.5-2 μm, and a magnetic bead concentration of 5-20 mg / mL. The washing solution contains anhydrous ethanol at a volume fraction of 70%-80% and Tris-HCl buffer pH 7.5 at a concentration of 10 mmol / L. The elution solution is a low ionic strength Tris-EDTA buffer, with Tris-HCl at a concentration of 10 mmol / L and EDTA at a concentration of 0.1 mmol / L, and a pH of 8.0-8.5.
[0009] Further, the length of the amplification product of each pair of primers in the multi-locus primer set is 80-200 bp, the Tm value of the primers is 58-65℃, and the concentration of the primers is 0.1-0.5 μmol / L. The primer set is designed as four groups of multiplex PCR reaction systems, each group of reaction system contains 4-5 pairs of primers, and the primers in each group do not form primer dimers and do not produce non-specific amplification products. The 3' end of the primer avoids the SNP site, ensuring that the amplification efficiency is not affected by the genotype.
[0010] Further, the high-fidelity DNA polymerase is a hot-start Taq DNA polymerase, which adopts an antibody-mediated hot-start technology, and the enzyme activity is 5 U / μL, and the mismatch rate is lower than 1 / 10,000. In the dNTPs mixture, the concentration of each component of dATP, dTTP, dGTP and dCTP is 10 mmol / L, and the ultra-pure reagent is used without DNAse and RNAse contamination. The PCR reaction buffer contains Tris-HCl pH 8.8 at a concentration of 50-100 mmol / L, KCl at a concentration of 50-75 mmol / L, at a concentration of 1.5-3.0 mmol / L, and bovine serum albumin at a concentration of 0.1-0.5 mg / mL.
[0011] Further, the positive quality control contains wild-type quality control and mutant quality control, the wild-type quality control contains wild-type allele sequences of 18 gene loci, and the mutant quality control contains mutant allele sequences of 18 gene loci. The quality control is provided in the form of plasmid DNA, and the concentration is - copies / μL, which can be used for quality control and result verification of the detection system.
[0012] Further, the kit further comprises a VTE risk score software module, which integrates the gene detection results and clinical risk factors to construct an individualized VTE risk score model. The clinical risk factors include age, gender, body mass index, surgical history, tumor status, pregnancy status, oral contraceptive use history, VTE family history, and bed rest time. The risk score model adopts a weighted scoring algorithm, and the odds ratio (OR value) of each gene locus and the weight coefficient of the clinical risk factors are comprehensively calculated to output the low, medium and high three-level stratification results of the VTE occurrence risk.
[0013] The second aspect of the present application provides the use of the VTE high-risk individual screening multi-gene panel kit in the preparation of a VTE risk prediction product. The application is suitable for preoperative evaluation of patients, pregnant women, tumor patients, long-term bedridden patients, oral contraceptive users, and individuals with a family history of VTE. The VTE risk prediction product is used to predict one or more of deep vein thrombosis, pulmonary embolism, portal vein thrombosis, or hepatic vein thrombosis. The detection sample of the application is peripheral blood or bone marrow blood, and the sample collection amount is 200-500 μL. The detection sensitivity of the application reaches 1% mutation abundance, and the detection specificity is greater than 99%.
[0014] Compared with the prior art, the present application has the following beneficial effects:
[0015] First, the present application covers 18 gene sites closely related to VTE occurrence, covering four systems of coagulation factors, anticoagulant proteins, fibrinolytic systems and vascular endothelial functions, which can explain about 40% of the genetic risk of VTE, which is about 3 times higher than the existing scheme of detecting only two sites of F5 Leiden and F2 G20210A.
[0016] Second, the present application adopts an optimized multiplex PCR amplification strategy, which can simultaneously detect all 18 target sites in a single reaction, and the detection time is shortened by more than 80% compared with traditional one-by-one detection, and the detection cost is reduced by about 60%.
[0017] Third, the present application uses magnetic bead nucleic acid extraction technology, and only 200 μL of whole blood sample can obtain high-quality DNA, the DNA extraction efficiency is greater than 90%, the purity The ratio is between 1.8-2.0, which meets the requirements of subsequent PCR amplification and sequencing analysis.
[0018] Fourth, the detection sensitivity of the present application reaches 1% mutation abundance, which can detect low-abundance somatic mutations and chimeric mutations, which is significantly improved compared with the 15%-20% detection limit of traditional Sanger sequencing method.
[0019] Fifth, the present application integrates a VTE risk scoring model based on machine learning, which comprehensively considers the genetic test results and clinical risk factors, and the prediction accuracy reaches more than 90%, which is better than traditional Caprini score and Padua score.
[0020] Sixth, the present application is suitable for VTE preventive screening of various high-risk populations, and provides reliable molecular diagnostic basis for clinical individualized anticoagulant therapy decision-making. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 The technical flow chart of the VTE high-risk individual screening multi-gene panel kit of the present application.
[0022] Figure 2 Schematic diagram for functional classification of 18 gene sites of the application.
[0023] Figure 3 Schematic diagram for structure of VTE risk score model of the application.
[0024] Figure 4 Graph of detection sensitivity verification experiment results of the application. DETAILED DESCRIPTION
[0025] Reference is made to the accompanying Figures 1-4 The application will be further described in detail below with reference to the embodiments. The following embodiments are only used to more clearly illustrate the technical solutions of the application, and are not used to limit the protection scope of the application.
[0026] Example 1 Preparation of VTE high-risk individual screening multi-gene panel kit
[0027] Preparation of blood sample nucleic acid extraction assembly:
[0028] Preparation of cell lysis solution: weigh 286.53 g guanidine hydrochloride and dissolve in 400 mL ultrapure water, add 30 mL of 1 mol / L Tris-HCl (pH 8.0), 40 mL of 0.5 mol / L EDTA (pH 8.0), and then add 10 mL of Triton X-100, make up to 1000 mL, filter sterilization with 0.22 μm filter membrane, store at 4℃. The final concentration of guanidine hydrochloride in the cell lysis solution is 5 mol / L, the concentration of Tris-HCl is 30 mmol / L, the concentration of EDTA is 20 mmol / L, and the volume fraction of Triton X-100 is 1%. Preparation of proteinase K solution: weigh 1.5 g of proteinase K powder and dissolve in 100 mL of a mixed solution of glycerol and ultrapure water (glycerol: water = 1:1, v / v), and after complete dissolution, aliquot 1 mL into 1.5 mL centrifuge tubes, and store at -20℃. The final concentration of proteinase K is 15 mg / mL, and the volume fraction of glycerol is 50%.
[0029] Preparation of magnetic bead suspension: take the carboxyl-modified magnetic beads (particle size 1 μm) stock solution, wash with ultrapure water for 3 times, and then resuspend in ultrapure water containing 0.05% sodium azide, adjust the concentration of magnetic beads to 10 mg / mL, and store at 4℃.
[0030] Preparation of magnetic bead suspension: take the carboxyl-modified magnetic beads (particle size 1 μm) stock solution, wash with ultrapure water for 3 times, and then resuspend in ultrapure water containing 0.05% sodium azide, adjust the concentration of magnetic beads to 10 mg / mL, and store at 4℃.
[0031] Preparation of washing buffer: Take 750 mL of anhydrous ethanol, add 10 mL of 1 mol / L Tris-HCl (pH 7.5), and make up to 1000 mL. Store at room temperature. The final washing buffer contains 75% ethanol and 10 mmol / L Tris-HCl.
[0032] Preparation of eluent: Take 10 mL of 1 mol / L Tris-HCl (pH 8.0) and 0.1 mol / L... (pH 8.0) 1 mL, bring the volume to 1000 mL, filter through a 0.22 μm filter membrane for sterilization, autoclave at 121℃ for 20 min, and store at room temperature. The final eluent contained 10 mmol / L Tris-HCl, 0.1 mmol / L EDTA, and pH 8.0.
[0033] Design and synthesis of multi-gene locus primer sets:
[0034] Based on the human genome reference sequence GRCh38, specific primers were designed for 18 VTE-related gene loci. Primer design followed these principles: amplified product length 80-200 bp, primer length 18-25 bp, Tm value 58-65℃, GC content 40%-60%, 3' ends avoiding SNP sites, and no complementary sequences between primers. Primer design and secondary structure analysis were performed using Primer3 and OligoAnalyzer software. Primers were synthesized by a commercial company and purified by HPLC.
[0035] Table 1 Primer sequence information for 18 gene loci
[0036] Serial number Gene SNP site Forward primer (5'-3') Reverse primer (5'-3') Product length 1 F5 rs6025 TGCCCAGTGCTTAACAAGAC CTTGAAGGAAATGCCCCATT 120 bp 2 F2 rs1799963 TCTAGAAACAGTTGCCTGGC ATAGCACTGGGAGCATTGAAG 145 bp 3 SERPINC1 rs2227589 GCAGAATTTCTGGACACTGG AGCTCATCAGGATGACCTTG 132 bp 4 PROC rs1799809 CCTGGTCTACTCCATGGAAC GTTGGCTCAGATGGAGAATG 118 bp 5 PROS1 rs6122 ATGTGAAGCCAGTTCTCACC CTGTGGATCTGGATGACCTG 156 bp 6 F11 rs2289252 GCTGTGAACTGTGAAGATGC CAGGTACTCCTGGATGAAGG 128 bp 7 ABO rs2519093 CTGGGCTGGTGAATGGAGAC AGAGATGCCTGCCTTGATGG 142 bp 8 PAI-1 rs1799889 CACAGAGAGAGTCTGGACAC GTGGACTCTGAGACTGTTGC 165 bp 9 MTHFR rs1801133 TGAAGGAGAAGGTGTCTGCG AGGACGGTGCGGTGAGAGTG 198 bp 10 TFPI rs8176592 CTTCTGCTGTCATGGACTGC GACAGTGGCAATCAGGATGG 135 bp 11 F13A1 rs5985 CAGGATGGTCTGGATGAACC CTGAGTGGCACTGGATGTTG 148 bp 12 THBD rs1042579 GCAGATGTGGACTGTGAACC CCTGGTCACTGGATGAACTG 125 bp 13 PROCR rs867186 TGCTGTGAACCTGGATGACC CAGGTGCTGGATCTGAATGG 138 bp 14 FGB rs1800790 GCTGTGAATGGAGATGCTGG CACTGGTGATGGATCTGACC 152 bp 15 F8 rs1800291 TGGATGAACTGTGAAGATGC CCTGGATGGTCTGAATGGAC 168 bp 16 VWF rs1063856 GAACTGGATGTGAATGGCTG CTGGATGACCTTGAATGGTG 145 bp 17 KLKB1 rs3733402 TGCTGGATGAACCTGAATGG CAGGATGGTGCTGAAGATGG 158 bp 18 SELP rs6136 GGATGAACTGTGGAATGCTG CTGAATGGTGGATGACCTTG 172 bp
[0037] Eighteen primer pairs were divided into four groups according to the amplification product length and Tm value, with 4-5 primer pairs in each group, and multiplex PCR primer mixtures were prepared. The final concentration of each primer in each primer mixture was 0.2 μmol / L.
[0038] Preparation of PCR reaction buffer:
[0039] Preparation of 10×PCR reaction buffer: Weigh 12.11 g of Tris base and dissolve it in 70 mL of ultrapure water. Adjust the pH to 8.8 with concentrated hydrochloric acid, and add 5.59 g of KCl. 0.41 g of bovine serum albumin and 0.2 g of febrile serum albumin were added to a final volume of 100 mL. The mixture was sterilized by filtration through a 0.22 μm filter, aliquoted, and stored at -20°C. The final 10× buffer solution contained 1000 mmol / L Tris-HCl and 750 mmol / L KCl. The concentration of the BSA is 2 mg / mL.
[0040] dNTPs mixture preparation: Take 250 μL of 100 mmol / L dATP, dTTP, dGTP and dCTP solutions respectively, mix them and add ultrapure water to make up to 1000 μL, mix well, aliquot and store at -20℃. The final concentration of each component in the dNTPs mixture is 25 mmol / L.
[0041] Preparation of positive quality control:
[0042] The wild type and mutant sequences of 18 gene sites were cloned into pUC19 vector, transformed into E. coli DH5a competent cells, and positive clones were picked for sequencing verification. The plasmid DNA was extracted, the concentration was determined using a spectrophotometer, and the concentration was adjusted to 500 copies / μL, aliquoted and stored at -20℃.
[0043] Kit assembly:
[0044] The above prepared components were packaged in centrifuge tubes or bottles of corresponding specifications, and the kit was assembled according to the specifications shown in Table 2.
[0045] Table 2 Kit components and specifications
[0046] Component name Specification Quantity Storage condition Cell lysis solution 50 mL 1 bottle 4℃ Proteinase K solution 1 mL 2 tubes -20℃ Magnetic bead suspension 5 mL 1 bottle 4℃ Washing solution 100 mL 1 bottle Room temperature Eluent 10 mL 1 bottle Room temperature Primer mix 1-4 200 μL / tube 1 tube each -20℃ 10×PCR buffer 1 mL 1 tube -20℃ dNTPs mix 200 μL 1 tube -20℃ Hot start Taq enzyme (5 U / μL) 100 μL 1 tube -20℃ Wild type control 100 μL 1 tube -20℃ Mutant control 100 μL 1 tube -20℃ Negative control (water) 1 mL 1 tube -20℃
[0047] Example 2 Method for using the VTE high-risk individual screening multi-gene panel kit
[0048] Sample collection and processing:
[0049] Collect 2 mL of peripheral venous blood of the subject in an EDTA anticoagulant tube, mix gently for 8-10 times, and place at room temperature for no more than 4 h, or store at 4℃ for no more than 24 h.
[0050] Nucleic acid extraction:
[0051] Take 200 μL of whole blood sample into a 1.5 mL centrifuge tube, add 200 μL of cell lysis solution and 20 μL of proteinase K solution, vortex for 15 s, and mix well. Incubate at 56°C for 10 min. Add 200 μL of absolute ethanol, vortex for 15 s, and mix well. Add 20 μL of magnetic bead suspension, and incubate at room temperature for 5 min to allow the DNA to adsorb to the surface of the magnetic beads. Place the centrifuge tube in a magnetic stand for 2 min, and discard the supernatant after the magnetic beads have completely aggregated. Add 500 μL of washing solution, vortex gently, and discard the supernatant after magnetic separation. Repeat the washing step once. Open the cap and dry the magnetic beads at room temperature for 5 min. Add 50 μL of elution solution, vortex for 15 s, and incubate at room temperature for 5 min. Transfer the DNA-containing elution solution to a new centrifuge tube after magnetic separation, and store at 4°C or directly perform PCR amplification.
[0052] DNA quality detection:
[0053] Use a NanoDrop spectrophotometer to detect the DNA concentration and purity. The qualified standard is: the DNA concentration is greater than 10 ng / μL, the ratio is between 1.8-2.0, the ratio is greater than 1.8.
[0054] Multiplex PCR amplification:
[0055] Prepare the PCR reaction system according to Table 3.
[0056] Table 3 PCR reaction system
[0057] Component Volume 10×PCR buffer 2.5 μL dNTPs mix (25 mmol / L) 0.5 μL Primer mix (per group) 2 μL Hot start Taq enzyme (5 U / μL) 0.25 μL DNA template 2 μL Ultra-pure water 17.75 μL Total volume 25 μL
[0058] Prepare four groups of PCR reaction systems respectively, and use the corresponding primer mix for each group. At the same time, set up positive controls (wild type quality control and mutant type quality control) and negative controls (ultra-pure water).
[0059] PCR amplification procedure:
[0060] Step 1: 95°C pre-denaturation for 10 min to activate the hot-start Taq enzyme. Step 2: 94°C denaturation for 30 s. Step 3: 60°C annealing for 30 s. Step 4: 72°C extension for 30 s. Step 5: Repeat steps 2-4 for 35 cycles. Step 6: 72°C final extension for 5 min. Step 7: Keep at 4°C until the product is removed.
[0061] PCR product detection:
[0062] Take 5 μL of PCR product for 1.5% agarose gel electrophoresis, 100 V constant voltage electrophoresis for 30 min. Gel imaging system takes pictures. The qualified standard is: positive control appears expected size of amplification band, negative control has no amplification band, sample appears expected size of amplification band.
[0063] Sequencing analysis:
[0064] The PCR product is sent to a sequencing company for Sanger sequencing or second-generation sequencing analysis. The genotype of the 18 gene loci is determined according to the sequencing results.
[0065] Risk score calculation:
[0066] The genetic test results and clinical risk factors are input into the VTE risk score software to calculate the individualized VTE risk score. The risk score calculation formula is as follows:
[0067] ,
[0068] wherein, is the weight coefficient of the ith gene locus, is the genotype score of the ith gene locus (wild type homozygote = 0, heterozygote = 1, mutant homozygote = 2), is the weight coefficient of the jth clinical risk factor, is the score of the jth clinical risk factor.
[0069] According to the risk score results, the risk is stratified: low risk (score <10), medium risk (score 10-20), high risk (score >20).
[0070] Example 3 Performance verification of VTE high-risk individual screening multi-gene panel kit
[0071] Sensitivity verification experiment:
[0072] Using positive control containing known mutations as template, mutant control and wild type control are mixed in different proportions to prepare series of dilution samples with mutation abundance of 50%, 25%, 10%, 5%, 1%, 0.5%. The kit is used for detection to evaluate the minimum detection limit.
[0073] The experimental results show that the detection sensitivity of the kit for mutations of 18 gene loci can reach 1% mutation abundance. At the level of 1% mutation abundance, the detection positive rate is 100% (18 / 18 loci). At the level of 0.5% mutation abundance, the detection positive rate decreases to 72.2% (13 / 18 loci). Therefore, the detection sensitivity of the kit is set to 1% mutation abundance.
[0074] Specificity verification experiment:
[0075] 50 peripheral blood samples of healthy volunteers were collected, and the kit of the application was used for detection, and Sanger sequencing was used for verification. The specificity index was calculated.
[0076] The experimental results show that the kit of the application is completely consistent with the Sanger sequencing results, and the specificity reaches 100% (50 / 50). No false positive results were detected.
[0077] Repeatability verification experiment:
[0078] Three clinical samples containing different genotypes were selected for intra-batch repeated detection (10 times on the same day) and inter-batch repeated detection (2 times each on 5 consecutive days). The coefficient of variation (CV) was calculated.
[0079] The experimental results show that the CV value of intra-batch repeated detection is in the range of 1.2%-3.8%, and the CV value of inter-batch repeated detection is in the range of 2.5%-5.6%, both less than 10%, indicating that the kit of the application has good repeatability.
[0080] Accuracy verification experiment:
[0081] 80 samples of clinically diagnosed VTE patients and 120 samples of healthy controls were collected, and the kit of the application was used for detection to analyze the correlation between gene detection results and VTE occurrence.
[0082] The experimental results show that among the 80 VTE patients, 62 (77.5%) detected at least one risk allele at a gene locus, of which 32 (40%) detected 2 or more risk alleles. Among the 120 healthy controls, only 28 (23.3%) detected at least one risk allele. The difference between the two groups was statistically significant (χ2=54.2, P<0.001).
[0083] Example 4 Construction and verification of VTE risk score model
[0084] Model construction:
[0085] Based on the correlation strength (OR value) of each gene locus and VTE risk reported in the literature, the weight coefficient of each gene locus was determined. Combined with the relative risk of clinical risk factors, a multi-parameter weighted scoring model was established.
[0086] Table 4 Weight coefficient of gene locus
[0087] Gene site Risk allele OR value Weighting coefficient F5 rs6025 A 5.0 3.0 F2 rs1799963 A 3.0 2.5 SERPINC1 rs2227589 T 2.5 2.0 PROC rs1799809 A 2.8 2.2 PROS1 rs6122 T 2.6 2.1 F11 rs2289252 T 1.8 1.5 ABO rs2519093 T 1.7 1.4 PAI-1 rs1799889 5G / 5G 1.6 1.3 MTHFR rs1801133 T 1.5 1.2 TFPI rs8176592 C 1.4 1.1 F13A1 rs5985 T 1.3 1.0 THBD rs1042579 C 1.3 1.0 PROCR rs867186 G 1.8 1.5 FGB rs1800790 A 1.4 1.1 F8 rs1800291 C 1.3 1.0 VWF rs1063856 C 1.4 1.1 KLKB1 rs3733402 T 1.5 1.2 SELP rs6136 C 1.4 1.1
[0088] Table 5 Weight coefficient of clinical risk factors
[0089] Risk factor Classification criteria Weighting coefficient Age ≥ 60 years old 2.0 Gender Female 0.5 BMI ≥ 30 kg / m² 1.5 Operation history Major operation within 6 weeks 3.0 Tumor status Active tumor 2.5 Pregnancy status Pregnancy 2.0 Oral contraceptive Current use 1.5 VTE family history First-degree relative VTE 1.5 Bed time ≥ 3 days 2.0
[0090] Model validation:
[0091] A total of 500 clinical samples were collected, including 200 VTE patients and 300 healthy controls. The risk score was calculated by using the kit of the present application. ROC curve was drawn to evaluate the prediction performance of the model.
[0092] The experimental results showed that the AUC value of the VTE risk score model of the present application was 0.892 (95% CI: 0.865-0.919), the sensitivity was 85.5%, the specificity was 81.3%, the positive predictive value was 75.3%, and the negative predictive value was 89.4%. The prediction performance of the model was significantly better than that of the traditional Caprini score (AUC=0.724) and Padua score (AUC=0.698).
[0093] Comparative Example 1
[0094] The same 500 samples were detected by using a commercially available thrombophilia kit containing only two sites of F5 Leiden and F2 G20210A.
[0095] The experimental results showed that the detection positive rate of the comparative kit in VTE patients was only 28.5% (57 / 200), which was significantly lower than the detection positive rate of 77.5% of the kit of the present application. The AUC value of the comparative kit was 0.654 (95% CI: 0.608-0.700), and the prediction performance was significantly worse than that of the present application.
[0096] Comparative Example 2
[0097] 100 VTE patients were detected by using the traditional protein level detection method (antithrombin activity, protein C activity, and protein S activity).
[0098] The experimental results showed that the positive rate of the traditional protein level detection was 18% (18 / 100), the detection cycle was 5-7 working days, and the cost of single detection was about twice that of gene detection. The kit of the present application can complete the detection within 1 working day, and can identify individuals carrying risk alleles but with normal protein levels.
[0099] The application constructs a comprehensive VTE genetic risk assessment system by integrating 18 key gene sites related to coagulation system, anticoagulation system, fibrinolysis system and vascular endothelial function. Coagulation factor V Leiden mutation leads to activated protein C resistance, prothrombin G20210A variation increases plasma prothrombin level, and both of them synergistically increase the risk of thrombosis. Defects of antithrombin, protein C and protein S weaken the natural anticoagulation function. Non-O type of ABO blood group is associated with increased levels of von Willebrand factor and coagulation factor VIII. PAI-1 gene polymorphism affects fibrinolytic activity. MTHFR gene polymorphism indirectly increases the risk of thrombosis by affecting homocysteine metabolism. The risk score model of the application comprehensively considers the independent action and interaction of each gene site and integrates clinical risk factors, and realizes more accurate VTE risk prediction.
[0100] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. The present application can have various modifications and changes for those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the scope of claims of the present application.
Claims
1. A multi-gene panel kit for screening of individuals at high risk of VTE, characterized in that, The application relates to a blood sample nucleic acid extraction component, a multi-gene site primer group, a high-fidelity DNA polymerase, a dNTPs mixture, a PCR reaction buffer and a positive quality control. The multi-gene site primer group is used for amplifying 18 gene sites related to venous thromboembolism, and the gene sites include a coagulation factor V gene rs6025 site, a prothrombin F2 gene rs1799963 site, an antithrombin SERPINC1 gene rs2227589 site, a protein C PROC gene rs1799809 site, a protein S PROS1 gene rs6122 site, a coagulation factor XI F11 gene rs2289252 site, an ABO blood group gene rs2519093 site, a plasminogen activator inhibitor PAI-1 gene rs1799889 site, a methylenetetrahydrofolate reductase MTHFR gene rs1801133 site, a tissue factor pathway inhibitor TFPI gene rs8176592 site, a coagulation factor XIII F13A1 gene rs5985 site, a thrombin modulating protein THBD gene rs1042579 site, an endothelial protein C receptor PROCR gene rs867186 site, a fibrinogen beta chain FGB gene rs1800790 site, a coagulation factor VIII F8 gene rs1800291 site, a von Willebrand factor VWF gene rs1063856 site, a kallikrein B1 KLKB1 gene rs3733402 site and a P-selectin SELP gene rs6136 site. The blood sample nucleic acid extraction component comprises a cell lysis solution, a proteinase K solution, a magnetic bead suspension, a washing solution and an elution solution; the cell lysis solution contains guanidine hydrochloride 4-6 mol / L, Tris-HCl buffer solution with a pH of 8.0 and a concentration of 20-50 mmol / L, disodium ethylenediaminetetraacetate 10-20 mmol / L and non-ionic surfactant Triton X-100 with a volume fraction of 0.5%-2%; the magnetic beads in the magnetic bead suspension are modified with carboxyl functional groups on the surface, have a particle size of 0.5-2 mu m and a concentration of 5-20 mg / mL.
2. The VTE high-risk individual screening multi-gene panel kit of claim 1, wherein, The amplification product length of each pair of primers in the multi-gene site primer group is 80-200 bp, the Tm value of the primers is 58-65 DEG C, and the primer concentration is 0.1-0.5 mu mol / L; the primer group is designed as four groups of multiplex PCR reaction systems, each reaction system contains 4-5 pairs of primers, no primer dimer is formed between the primers in each group, and no non-specific amplification product is generated.
3. The VTE high-risk individual screening multi-gene panel kit of claim 1, wherein, 4. The VTE high-risk individual screening multi-gene panel kit of claim 1, wherein, The high-fidelity DNA polymerase is a hot-start Taq DNA polymerase with an enzyme activity of 5 U / μL and a mismatch rate of less than 1x10-5; the dNTPs mixture contains 10 mmol / L of each of dATP, dTTP, dGTP and dCTP; and the PCR reaction buffer contains 50-100 mmol / L of Tris-HCl pH 8.8, 50-75 mmol / L of KCl, 1.5-3.0 mmol / L of MgCl2 and 0.1-0.5 mg / mL of bovine serum albumin.
5. The VTE high-risk individual screening multi-gene panel kit of claim 1, wherein, The positive quality control comprises a wild type quality control comprising wild type allele sequences of 18 genetic loci and a mutant type quality control comprising mutant allele sequences of 18 genetic loci; the quality control is provided in the form of plasmid DNA, with a concentration of 1 x 10 4 -1 x 10 6 copies per μL.
6. The VTE high-risk individual screening multi-gene panel kit of claim 1, wherein, The kit further comprises a VTE risk score software module, which integrates the genetic detection results and clinical risk factors to construct an individualized VTE risk score model; the clinical risk factors include age, gender, body mass index, surgical history, tumor status, pregnancy status, oral contraceptive use history, VTE family history and bed rest time; the risk score model adopts a weighted scoring algorithm and outputs low, medium and high three-level stratification results of the risk of VTE occurrence.
7. Use of the VTE high-risk individual screening multi-gene panel kit of any one of claims 1-6 in the preparation of a VTE risk prediction product.
8. Use according to claim 7, characterized in that, The application population includes preoperative evaluation patients, pregnant women, tumor patients, long-term bedridden patients, oral contraceptive users and individuals with a VTE family history.
9. Use according to claim 7, characterized in that, The VTE risk prediction product is used for predicting one or more of deep vein thrombosis, pulmonary embolism, portal vein thrombosis or hepatic vein thrombosis.
10. Use according to claim 7, characterized in that, The detection sample for the use is peripheral blood or bone marrow blood, and the sample collection amount is 200-500 μL; the detection sensitivity of the use reaches 1% mutation abundance, and the detection specificity is greater than 99%. The high-fidelity DNA polymerase is a hot-start Taq DNA polymerase with an enzyme activity of 5 U / μL and a mismatch rate of less than 1x10-5; the dNTPs mixture contains 10 mmol / L of each of dATP, dTTP, dGTP and dCTP; and the PCR reaction buffer contains 50-100 mmol / L of Tris-HCl pH 8.8, 50-75 mmol / L of KCl, 1.5-3.0 mmol / L of MgCl2 and 0.1-0.5 mg / mL of bovine serum albumin. The kit further comprises a VTE risk score software module, which integrates the genetic detection results and clinical risk factors to construct an individualized VTE risk score model; the clinical risk factors include age, gender, body mass index, surgical history, tumor status, pregnancy status, oral contraceptive use history, VTE family history and bed rest time; the risk score model adopts a weighted scoring algorithm and outputs low, medium and high three-level stratification results of the risk of VTE occurrence.
7. Use of the VTE high-risk individual screening multi-gene panel kit of any one of claims 1-6 in the preparation of a VTE risk prediction product. The application population includes preoperative evaluation patients, pregnant women, tumor patients, long-term bedridden patients, oral contraceptive users and individuals with a VTE family history. The VTE risk prediction product is used for predicting one or more of deep vein thrombosis, pulmonary embolism, portal vein thrombosis or hepatic vein thrombosis. The detection sample for the use is peripheral blood or bone marrow blood, and the sample collection amount is 200-500 μL; the detection sensitivity of the use reaches 1% mutation abundance, and the detection specificity is greater than 99%.
Citation Information
Patent Citations
Probe group and kit for hematologic tumor and lymphoma gene detection
CN113801934A
Hematologic tumor multi-gene detection kit and preparation method thereof
CN117305457A
Biomarkers for predicting venous thromboembolism genetic risk of Chinese Han population, kit and application thereof
CN114317724A
Application of detecting mutation condition of characteristic gene in preparation of venous thromboembolism risk detection product
CN116287204A