Chimeric antigen receptor, medicine for treating tumors and application

Abstract

The invention provides a chimeric antigen receptor, a medicine for treating tumors and application, and belongs to the technical field of biological medicine. The intracellular signal transduction structural domain of the chimeric antigen receptor is an Fc [gamma] RIIc intracellular domain, and the nucleotide sequence of the Fc [gamma] RIIc intracellular domain is as shown in SEQ ID NO. 2. According to the CAR-NK cell prepared from the chimeric antigen receptor, the CAR-NK cell has the remarkable targeting tumor killing capacity, the toxic molecule expression level is high, the depletion marker and inhibitory phenotype expression level is low, and the apoptotic cell population proportion is low. Meanwhile, compared with the 28 zeta-CAR-NK cell, the CAR-NK cell disclosed by the invention can be used for effectively delaying the immune depletion process of immune cells while ensuring the killing power of tumor cells.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to a chimeric antigen receptor, a drug for treating tumors, and its application. Background Technology

[0002] Human epidermal growth factor receptor 2 (HER2 / erbB-2) is a key pan-cancer target in the treatment of solid tumors. Its expression levels are elevated in malignant tumors such as breast cancer, gastric cancer, and ovarian cancer. It promotes tumor invasion and metastasis, and treatment resistance by abnormally activating downstream signaling pathways, ultimately leading to poor patient prognosis. Clinical data show that while monoclonal antibodies targeting HER2 (such as trastuzumab) and tyrosine kinase inhibitors (such as lapatinib) have significantly improved clinical efficacy, tumor heterogeneity leading to antigen escape remains a key cause of targeted therapy escape, requiring breakthrough strategies to address this issue.

[0003] In recent years, immunotherapy has made significant progress in the field of cancer treatment. The emergence of chimeric antigen receptor (CAR) technology has brought new hope for the treatment of HER2-positive tumors. Although CAR-T cell therapy has achieved breakthrough progress in hematologic malignancies, its application in solid tumors is still limited by multiple biological barriers, including tumor microenvironment inhibition, target-related toxicities (such as cytokine release syndrome), and efficacy attenuation due to antigen heterogeneity. To address these challenges, researchers have developed a variety of novel CAR immunotherapy therapies, including CAR-M (CAR-macrophage) and CAR-NK (CAR-natural killer cell) therapies. The NK92 cell line, derived from natural killer cells from patients with malignant non-Hodgkin lymphoma, has shown unique therapeutic potential, possessing the unique autonomous recognition and killing mechanism of NK cells and exhibiting broad-spectrum and stable cytotoxicity against solid tumor cells. In recent years, NK92-based CAR-NK cell therapy has gradually become an emerging direction in the immunotherapy of solid tumors due to its low immunogenicity, high safety, scalability, and unique immune surveillance characteristics.

[0004] With the iterative development of CAR-NK cell therapy, CAR molecule design is exploring NK cell-specific signaling. Traditional CAR signaling domains largely rely on the CD3ζ chain, but the three-ITAM structure of CD3ζ easily induces NK cell overactivation and exhaustion phenotypes. In recent years, researchers have developed innovative designs based on inherent NK cell signaling pathways, significantly enhancing the anti-tumor potential of CAR-NK by integrating NK-specific signaling modules such as DAP10 and DAP12. However, this still inevitably triggers NK cell overactivation and functional exhaustion, limiting clinical efficacy. Therefore, a novel CAR molecule is urgently needed to address the technical challenges of NK cell overactivation and exhaustion phenotypes induced by traditional CAR signaling domains. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide a chimeric antigen receptor, a drug for treating tumors, and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention provides a chimeric antigen receptor, wherein the intracellular signal transduction domain of the chimeric antigen receptor is an FcγRIIc intracellular domain, and the nucleotide sequence of the FcγRIIc intracellular domain is shown in SEQ ID NO.2.

[0007] Preferably, the chimeric antigen receptor further includes a CD8α signal peptide, a HER2-targeting single-chain antibody P1h2, a CD8α hinge, and a transmembrane domain.

[0008] Preferably, the nucleotide sequence of the chimeric antigen receptor is shown in SEQ ID NO.1.

[0009] The present invention provides a recombinant expression vector containing the above-mentioned chimeric antigen receptor.

[0010] The present invention provides a recombinant cell that expresses the above-mentioned chimeric antigen receptor or recombinant expression vector.

[0011] Preferably, the host cell of the recombinant cells is an NK cell.

[0012] This invention provides the application of the above-mentioned chimeric antigen receptor, recombinant expression vector or recombinant cell in the preparation of a drug for treating tumors.

[0013] Preferably, the drug has the effect of delaying the immune depletion process of immune cells.

[0014] This invention provides an application of the above-mentioned chimeric antigen receptor, recombinant expression vector or recombinant cell in the preparation of CAR-NK cells.

[0015] The present invention provides a drug for treating tumors, comprising the chimeric antigen receptor, recombinant expression vector or recombinant cell described above.

[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a chimeric antigen receptor, a drug for treating tumors, and its application. The intracellular signal transduction domain of this chimeric antigen receptor is derived from FcγRIIc. The CAR-NK cells prepared from the CAR molecule with this structure, compared with the 28ζ-CAR-NK cells prepared from the traditional 28ζ-CAR, have lower levels of exhaustion markers and inhibitory phenotypes and a lower proportion of apoptotic cells, while maintaining the ability to target and kill tumor cells, effectively delaying the immune exhaustion process of immune cells. Attached Figure Description

[0017] Figure 1 Schematic diagram of the structures of plasmids 8a32c and 28ζ; Figure 2 The left image shows the positive percentage of each CAR-NK92 cell after 3 days of infection with 8a32c-CAR and 28ζ-CAR viral solutions. The right image shows the positive percentage of each CAR-NK92 cell after magnetic bead sorting and purification. Figure 3 To detect the killing ability of 8a32c-CAR-NK92, 28ζ-CAR-NK92 or NK92 cells against target cells with different HER2 antigen densities using the luciferase reporter gene assay; Figure 4 The results of cytotoxicity assays for different CAR-NK92 cells are shown in Figure A. Flow cytometry results of NKp30 activating receptor on the cell surface, NKp30 activating receptor expression levels, and MFI comparison between the 8a32c-CAR and 28ζ-CAR groups are shown in Figure B. Flow cytometry results of NKp44 activating receptor on the cell surface, NKp44 activating receptor expression levels, and MFI comparison between the 8a32c-CAR and 28ζ-CAR groups are shown in Figure B. Figure 5The results of different CAR-NK92 cell exhaustion markers and inhibitory receptor detection are shown in Figure A. Flow cytometry analysis of TIM-3, an exhaustion marker, on the cell surface of the 8a32c-CAR group and the 28ζ-CAR group, along with TIM-3 expression levels and MFI comparisons. Figure B. Flow cytometry analysis of LAG-3, an exhaustion marker, on the cell surface of the 8a32c-CAR group and the 28ζ-CAR group, along with LAG-3 expression levels and MFI comparisons. Figure C. Flow cytometry analysis of the inhibitory receptor NKG2A on the cell surface of the 8a32c-CAR group and the 28ζ-CAR group, along with NKG2A expression levels and MFI comparisons. Figure 6 The results of apoptosis detection for different CAR-NK92 cells are shown in the flow cytometry of apoptosis and the apoptosis rate of cells in the 8a32c-CAR group and the 28ζ-CAR group after immune interaction. Detailed Implementation

[0018] The present invention provides a chimeric antigen receptor, wherein the intracellular signal transduction domain of the chimeric antigen receptor is an FcγRIIc intracellular domain, and the nucleotide sequence of the FcγRIIc intracellular domain is shown in SEQ ID NO.2.

[0019] In this invention, the applicant has discovered for the first time that replacing the CD28 intracellular signaling region and CD3ζ intracellular signaling region on the traditional 28ζ-CAR structure with the FcγRIIc intracellular domain as shown in SEQ ID NO.2 can effectively ensure the tumor-killing ability of CAR-NK cells and delay the immune depletion process of immune cells. This invention further improves the technical effect of tumor treatment by modifying the CAR molecule, and provides a new idea and theoretical basis for the selection of drugs for tumor treatment using CAR-NK cells.

[0020] In this invention, the chimeric antigen receptor further includes a CD8α signal peptide, a HER2-targeting single-chain antibody P1h2, a CD8α hinge, and a transmembrane domain. As a preferred embodiment, the chimeric antigen receptor includes a CD8α signal peptide, a HER2-targeting single-chain antibody P1h2, a CD8α hinge, a transmembrane domain, and an FcγRIIc intracellular domain. The nucleotide sequence of the chimeric antigen receptor is shown in SEQ ID NO.1.

[0021] The present invention provides a recombinant expression vector containing the above-mentioned chimeric antigen receptor.

[0022] In this invention, the expression vector includes a plasmid vector or a viral vector; the viral vector includes lentiviral vectors, adenovirus vectors, AAV viral vectors, retroviral vectors, etc., and is further a lentiviral vector, such as pLVX-EF1α-IRES-Puro lentiviral plasmid.

[0023] The present invention provides a recombinant cell that expresses the above-mentioned chimeric antigen receptor or recombinant expression vector.

[0024] In this invention, the host cell for the recombinant cells is NK cells. NK cells do not exhibit clinical side effects such as cytokine storms during clinical applications; therefore, the CAR-NK cells designed in this invention are safer.

[0025] This invention provides the application of the above-mentioned chimeric antigen receptor, recombinant expression vector or recombinant cell in the preparation of a drug for treating tumors.

[0026] In this invention, the drug has the effect of delaying the immune depletion process of immune cells. The tumor cells include one or more of HER2-positive tumor cells, such as lung cancer cells, gastric cancer cells, lung adenocarcinoma cells, breast adenocarcinoma cells, cervical cancer cells, and ovarian cancer cells.

[0027] This invention provides an application of the above-mentioned chimeric antigen receptor, recombinant expression vector or recombinant cell in the preparation of CAR-NK cells.

[0028] The present invention provides a drug for treating tumors, comprising the chimeric antigen receptor, recombinant expression vector or recombinant cell described above.

[0029] In this invention, the drug may further include pharmaceutically acceptable excipients. In this invention, a chimeric antigen receptor, recombinant expression vector, or recombinant cell is used as the sole active ingredient.

[0030] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] In the following examples, HEK 293T (human renal epithelial cells) were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences and cultured in DMEM medium containing 10% fetal bovine serum; NK92 (natural killer cells from human patients with malignant non-Hodgkin lymphoma) were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences and cultured in X-VIVO15 medium containing 10% fetal bovine serum and 200 IU / mL IL-2.

[0033] Example 1 The FcγRIIc-CAR plasmid was successfully constructed using molecular cloning technology, and FcγRIIc-CAR-NK92 cells were prepared. The specific experimental details are as follows: Experimental methods 1. Construction and identification of FcγRIIc-CAR plasmid The recombinant plasmids involved in this embodiment are 8a32c-CAR (denoted as 8a32c) and 28ζ-CAR (denoted as 28ζ).

[0034] The CAR structures of the 8a32c and 28ζ plasmids both use the humanized single-chain antibody P1h2 targeting HER2 as the antigen recognition region, CD8α hinge and transmembrane domain. The 8a32c-CAR uses FcγRIIc as the intracellular signal transduction domain, while the 28ζ-CAR uses CD28 and CD3ζ as the intracellular signal transduction domain.

[0035] The 8a32c sequence is annotated as CD8α-Leader~P1h2~CD8α-Hinge&TM~FcγRIIc, and the nucleotide sequence of 8a32c is as follows:

[0036] The nucleotide sequence of the FcγRIIc intracellular domain is as follows: tgcaggaaaaagcggatttcagccaattccactgatcctgtgaaggctgcccaatttgagccacctggacgtcaaatgattgccatcagaaagagacaacctgaagaaaccaacaat gactatgaaacagctgacggcggctacatgactctgaaccccagggcacctactgacgatgataaaaacatctacctgactcttcctcccaacgaccatgtcaacagtaataac (seq ID NO.2).

[0037] The 28ζ sequence is annotated as CD8α-Leader~P1h2~CD8α-Hinge&TM~CD28~CD3ζ, and the nucleotide sequence of 28ζ is as follows:

[0038] Among them, 28ζ was preserved in our laboratory as a control plasmid, namely Zeta-CAR in patent ZL.202210214509.0.

[0039] The nucleotide sequence shown in SEQ ID NO.1 was synthesized (the nucleotide sequence was synthesized in its entirety by Qingke Xinyue Biotechnology (Beijing) Co., Ltd.), and then introduced into the pLVX-EF1α-IRES-Puro lentiviral plasmid with EcoRI and BamHI restriction sites, respectively, to obtain the lentiviral expression vector 8a32c plasmid.

[0040] Figure 1 This is a schematic diagram of the structure of the 8a32c and 28ζ plasmids. Figure 1 It can be seen that the difference in the CAR molecular structure design of 8a32c and 28ζ plasmids lies in the intracellular signal transduction domain, and the intracellular signal transduction domain of the 8a32c-CAR molecule comes from FcγRIIc.

[0041] 2. Preparation of 8a32c-CAR-NK92 cells and 28ζ-CAR-NK92 cells 2.1 Lentiviral packaging encoding the 8a32c and 28ζ genes (1) Take HEK-293T cells out of liquid nitrogen and place them in a 37°C water bath to thaw quickly. In a sterile laminar flow hood, transfer the cell suspension into a 15mL centrifuge tube, add 4-5 times the volume of DMEM complete culture medium containing 10% fetal bovine serum, centrifuge at 800rpm for 5min, discard the supernatant, and repeat this step twice to obtain cell pellet.

[0042] (2) Add 5 mL of complete culture medium to the cell pellet from step (1), resuspend thoroughly, transfer to a 6 cm cell culture dish, and incubate at 37°C in a 5% CO2 incubator.

[0043] (3) Once the cell density reaches 80% or higher, add 0.05% trypsin to digest the cells. When a small number of cells detach from the bottom of the dish, immediately add complete culture medium to stop the digestion. Adjust the cell state to the optimal level for lentivirus packaging.

[0044] 2.2 Plasmid Extraction A three-plasmid lentiviral packaging system was used, comprising the lentiviral expression vector and the lentiviral packaging plasmids psPAX2 and pMD2G. Endotoxin-free large-scale extraction kits were used to extract the required plasmids in large quantities for later use.

[0045] 2.3 Lentiviral Packaging (1) Cell preparation: Seed HEK-293T cells in optimal culture condition into a 10cm culture dish, shake well, and wait until the density reaches 80% for lentivirus packaging.

[0046] (2) Preparation of transfection solution: Add 1.25 mL of Opti-MEM culture medium to a 5 mL EP tube, then add 60 μL of Lipofectamine 2000 and mix well. Let stand for 5 min. Add an equal volume of culture medium to another 5 mL EP tube, then add 10 μg of the target plasmid (8a32c or 28ζ), 7.5 μg of psPAX2, and 2.5 μg of pMD2G helper plasmid. Gently mix the above solution and let stand for 20 min.

[0047] (3) Discard the HEK-293T cell culture supernatant and slowly add 5 mL of serum-free DMEM culture medium. After the mixture from step (2) has completely settled, discard the culture medium, slowly add the mixture to the dish, and then add 2.5 mL of Opti-MEM culture medium. Gently shake the bottom of the dish to make the liquid uniform. Place the cells in an incubator and incubate at 37°C and 5% CO2 for 6 h.

[0048] (4) After incubating the cells with the DNA-Lipofectamine 2000 complex for 6 hours, discard the liquid and slowly add 10 mL of LDM complete culture medium to culture the cells. Collect the virus at 48 hours and 72 hours after transfection, respectively. Mix the collected virus collected at 48 hours and 72 hours after transfection evenly and centrifuge at 3000 rpm for 5 minutes to remove cell debris from the virus.

[0049] 2.4 Lentiviral Concentration (1) Collect the prepared virus solution into a 50mL centrifuge tube and determine the volume to be 20mL.

[0050] (2) Add 4.66 mL of ice-cold 50% PEG-6000 (i.e., final concentration of 8.5%) and 2.74 mL of 3M NaCl solution (i.e., final concentration of 0.3M) to each virus solution, invert and mix once every 20-30 min, and place at 4℃ for 1.5 h.

[0051] (3) Pre-cool the centrifuge to 4°C, place the virus solution in the centrifuge, and centrifuge at 7000g for 30 minutes.

[0052] (4) Discard the viral supernatant after centrifugation, add X-VIVO 15 serum-free culture medium to resuspend the viral precipitate at a concentration of 100 times, and obtain 8a32c or 28ζ lentivirus suspensions respectively.

[0053] 2.5 Infect NK92 cells with 8a32c or 28ζ lentiviruses. (1) First, calibrate the density of the 8a32c or 28ζ lentiviral cell suspension to 1×10⁻⁶. 6 / mL, virus infection was performed using the centrifugation infection method—the cells were mixed with the VSV-G pseudotyped lentivirus stock solution and transferred to a 24-well plate, and centrifuged at 1000g for 60min at 37℃.

[0054] (2) Then add an equal volume of X-VIVO 15 complete medium containing 10% heat-inactivated fetal bovine serum and 200 U / mL recombinant human IL-2 to resuspend the cell pellet, and place it in a three-gas incubator to maintain the standard culture environment (37℃, 5% CO2, 95% humidity).

[0055] (3) Six hours after the initial transduction, a second enhanced centrifugation (1000g, 60min) was performed to remove unintegrated viral particles. Fresh complete culture medium (containing 200U / mL IL-2) was added to adjust the cell density to the initial level. The cells were then cultured dynamically for 3 days, and the expression efficiency of fluorescently labeled genes was monitored daily.

[0056] 3. Identification of CAR-NK92 cells 3.1 Flow cytometry was used to identify the positive rate of CAR-NK92 cell infection. At 72 hours post-lentiviral infection, cells in each experimental group were accurately counted, and 1×10⁶ cells were collected from each group. 6 Cell samples were centrifuged at 800 rpm for 5 min, and the supernatant was discarded. The cell pellet was then gently dispersed, and 100 μL of flow cytometry buffer was added to resuspend the cells. Next, 25 μL of biotin-labeled human HER2 recombinant protein was added to each CAR-modified NK92 cell sample, and the mixture was thoroughly vortexed and incubated at 4°C for 30 min, with one agitation during incubation. The cell pellet was then gently dispersed again, and 1 mL of flow cytometry buffer was added to resuspend the cells. This centrifugation and washing process was repeated twice to remove residues. The cells were then resuspended in 100 μL of buffer, and 5 μL of streptavidin-conjugated fluorescently labeled antibody was added. The cells were incubated at 4°C in the dark for 30 min (with one agitation during incubation). Finally, after two washing cycles, the cells were resuspended in 500 μL of buffer and analyzed by flow cytometry. This procedure, through a dual staining strategy combined with the principle of antigen-antibody specific binding, enables quantitative assessment of lentiviral transduction efficiency.

[0057] 3.2 Magnetic bead sorting and purification of CAR-NK92 cells The standardized operating procedure for purifying CAR-NK92 cells using a magnetic bead sorting system is as follows: First, 1×10 6Engineered CAR-NK92 cells were centrifuged at 800 rpm for 5 min to completely remove the supernatant and resuspended in 100 μL of sorting buffer. Then, 20 μL of biotin-labeled human HER2 recombinant protein was added, and the cells were incubated on ice for 15 min, with vortexing once during incubation. This was followed by three repeated centrifugation washes to thoroughly remove unbound protein. The washed cells were then resuspended in 100 μL of sorting buffer and processed using MojoSort. TM The streptavidin nanoparticle magnetic bead separation kit was used. After precisely adding 1 μL of magnetic beads, the cells were incubated on ice for 15 min (with one shake interval). The cell suspension was then transferred to a magnetic separator for magnetic adsorption separation. After standing for 5 min, the magnetic field of the separator was maintained. Non-magnetic liquid components were carefully aspirated using a micropipette. 1 mL of sorting buffer was added to gently rinse the tube wall. The magnetic adsorption process was repeated. The magnetically labeled cells finally adsorbed onto the tube wall are the target positive cell population. Based on the obtained cell number, the cell density was adjusted to 1 × 10⁶ cells / mL using X-VIVO 15 complete medium supplemented with cytokines. 6 Cells were purified to a density of 10 cells / mL for later use. This process utilizes a biotin-streptavidin system for efficient antigen capture, combined with magnetic bead sorting technology for precise enrichment of positive cell populations.

[0058] Figure 2 The results showed that after infecting NK92 cells with 8a32c-CAR and 28ζ-CAR viral solutions for 3 days, the expression of CAR molecules on the cell surface was detected. After purification by magnetic bead sorting, the positive rate of CAR-NK92 cells was above 95%, and purified CAR-NK92 cells were obtained.

[0059] Example 2 CAR-NK92 cell lines, 8a32c-CAR-NK92 (denoted as 8a32c-CAR) and 28ζ-CAR-NK92 (denoted as 28ζ-CAR), were successfully prepared using Example 1. This example focuses on investigating the performance of FcγRIIc-CAR-NK92 cells in in vitro functional experiments to verify the effectiveness of FcγRIIc as a signaling domain in NK-CAR design. Specific experimental results are as follows: Experimental methods 1. In vitro killing effect of CAR-NK92 cells on tumor cells This embodiment uses a standardized cell killing assay to evaluate the targeted clearance ability of different CAR-NK92 cells against tumor cells. The specific experimental procedure is as follows: First, NCI-N87, NCI-H1975, SK-OV-3, HeLa, MCF-7 cell lines in logarithmic growth phase and HER2 cells were selected. + Tagged PC-9 HER2 +Cells, after precise counting, were divided into 2×10⁻⁶ cells. 4 The cells were seeded at a density of 1 / 2 wells in black transparent 96-well plates. After 24 hours of cell adhesion culture, different numbers of CAR-NK92 cells were added according to a preset effector-to-target ratio gradient (2:1 and / or 1:1). The negative control group contained untransgenic universal NK92 cells (UTD), while the blank control group contained only tumor cells. Four replicates were set for each group to control experimental error. After 8 hours of co-culture, the culture supernatant containing suspended cells was discarded, and the cells were gently washed with 1×PBS buffer pre-cooled to 4°C to remove residual effector cells and tumor debris. Then, 100 μL of pre-diluted luciferase working solution was added to each well, and the reaction was carried out at room temperature in the dark for 2 minutes. Bioluminescence signals were acquired using the Xenogen IVIS Lumina II small animal in vivo imaging system, and data were quantified using Living Image analysis software. The specific killing rate was calculated using the following formula: Kill rate (%) = (Relative activity of luciferase in the blank group - Relative activity of luciferase in the experimental group) / Relative activity of luciferase in the blank group × 100%. This experimental system, through quantitative detection of reporter genes combined with in vivo imaging technology, enables precise evaluation of the targeted killing efficacy of different CAR-NK92 cells.

[0060] Figure 3 The luciferase reporter gene results showed that, despite differences in HER2 antigen expression density among target cell lines, all different CAR-NK92 cells exhibited effective lysis ability against HER2-positive tumor cells. Furthermore, compared to 28ζ-CAR-NK92 cells, 8a32c-CAR-NK92 cells showed greater lysis ability against different HER2-positive tumor cells (NCI-N87, NCI-H1975, SK-OV-3, HeLa, MCF-7, and PC-9 HER2-positive tumor cells). + It exhibits equivalent pyrolysis capability.

[0061] 2. Identification of CAR-NK92 cell phenotypes This embodiment uses a standardized co-culture system to evaluate the immune response characteristics of CAR-NK92 cells. The specific experimental procedure is as follows: accurately count and collect 2×10⁶ cells. 6 10 different CAR-NK92 cells and 1×10 6 PC-9 HER2 + Target cells were co-cultured at a 2:1 ratio of effector cells to target cells and incubated at 37°C with 5% CO2 for 8 hours. Subsequently, the cells underwent standardized processing, and the following immunophenotypic markers were simultaneously detected using multi-parameter flow cytometry: (1) Cytotoxic activation receptor expression profile: The expression levels of activating receptors such as NKp30 and NKp44 on the surface of NK92 cells were quantitatively detected by fluorescently labeled antibodies.

[0062] (2) Immunosuppressive receptor detection: assess the expression ratio of inhibitory receptors such as NKG2A.

[0063] (3) Monitoring of cell exhaustion markers: expression levels of exhaustion-related molecules such as lymphocyte activation gene 3 (LAG-3) and T cell immunoglobulin mucin 3 (TIM-3).

[0064] (4) Apoptosis level assessment: The apoptosis rate of effector cells (8a32c-CAR-NK92 or 28ζ-CAR-NK92) was detected by Annexin V / 7-AAD double staining method.

[0065] Figure 4 Flow cytometry analysis showed that the positive rates of cytotoxic activation receptors NKp30 and NKp44 and their corresponding fluorescence values ​​(MFI) in the 8a32c-CAR group were higher than those in the 28ζ-CAR group, indicating that the 8a32c-CAR group has stronger cytotoxic killing ability.

[0066] Figure 5 The results showed that the positive rates of exhaustion markers TIM-3 and LAG-3 in the 8a32c-CAR group were significantly lower than those in the 28ζ-CAR group, and the positive rate of inhibitory receptor NKG2A was also much lower than that in the 28ζ-CAR group, indicating that the 8a32c-CAR designed based on FcγRIIc more effectively delayed the immune exhaustion process of NK cells.

[0067] Figure 6 The results showed that the apoptosis rate of CAR-NK92 cells in the 8a32c-CAR group was significantly lower than that in the 28ζ-CAR group, which verified the advantages of 8a32c-CAR-NK92 cells in maintaining cell viability.

[0068] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A chimeric antigen receptor, characterized in that, The intracellular signaling domain of the chimeric antigen receptor is an FcγRIIc intracellular domain, and the nucleotide sequence of the FcγRIIc intracellular domain is shown as SEQ ID NO.

2.

2. The chimeric antigen receptor of claim 1, wherein, The chimeric antigen receptor further comprises a CD8α signal peptide, a HER2-targeting single-chain antibody P1h2, a CD8α hinge and transmembrane domain.

3. The chimeric antigen receptor of claim 1, wherein, The nucleotide sequence of the chimeric antigen receptor is shown as SEQ ID NO.

1.

4. A recombinant expression vector, characterized in that, The recombinant expression vector contains the chimeric antigen receptor according to any one of claims 1-3.

5. A recombinant cell, characterized in that, The recombinant cell expresses the chimeric antigen receptor according to any one of claims 1-3 or the recombinant expression vector according to claim 4.

6. The recombinant cell of claim 5, wherein, The host cell of the recombinant cell is an NK cell.

7. Use of the chimeric antigen receptor according to any one of claims 1-3, the recombinant expression vector according to claim 4, or the recombinant cell according to claim 5 or 6 in the preparation of a medicament for treating tumors.

8. Use according to claim 7, characterized in that, The medicament has the effect of delaying the immune exhaustion process of immune cells.

9. Use of the chimeric antigen receptor according to any one of claims 1-3, the recombinant expression vector according to claim 4, or the recombinant cell according to claim 5 or 6 in the preparation of CAR-NK cells.

10. A medicament for treating a tumor, characterized by, The chimeric antigen receptor according to any one of claims 1-3, the recombinant expression vector according to claim 4, or the recombinant cell according to claim 5 or 6.

Images