A method for preparing leptin gene edited sheep

By using CRISPR/Cas gene editing technology, the Lep-sgRNA5 and Lep-sgRNA13 combination was used to knock out the Leptin gene in sheep, which solved the problem of low efficiency in conventional breeding, improved the growth traits of sheep, and provided a breeding foundation for excellent sheep breeds.

CN121380075BActive Publication Date: 2026-03-24INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-25
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Conventional breeding and selection processes are lengthy, time-consuming, labor-intensive, inefficient, and limited by seed sources, making it difficult to achieve rapid breakthroughs, especially in the improvement of multi-gene economic traits in livestock and poultry.

Method used

Using CRISPR/Cas gene editing technology, the Lep-sgRNA5 and Lep-sgRNA13 combination was used to knock out the Leptin gene in sheep. Leptin-edited sheep were then prepared by somatic cell nuclear transfer, achieving large-fragment gene editing.

Benefits of technology

It significantly improved the growth traits of sheep, such as body length and body size, and provided a breeding foundation for excellent sheep breeds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380075B_ABST
    Figure CN121380075B_ABST
Patent Text Reader

Abstract

The present application relates to the field of animal breeding technology, and particularly relates to a method for preparing Leptin gene edited sheep. The method comprises: using sgRNA combination to knockout Leptin gene of sheep. The sgRNA combination comprises: Lep-sgRNA5: CCGCGATTCCTCGATCCCTC; Lep-sgRNA13: CTCCCTCTACTCCACCGAGG. A group of sgRNA combinations capable of efficiently knocking out Leptin gene is obtained through research, and the sgRNA combination can realize directional editing of Leptin gene. The Leptin gene edited sheep obtained based on the knockout method has significantly improved growth traits such as body length and body size, which has important application value in the field of sheep breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of animal breeding technology, and in particular to a method for preparing Leptin gene-edited sheep. Background Technology

[0002] Conventional breeding and selection suffer from problems such as long cycles, high time and labor costs, low efficiency, and limitations imposed by germplasm sources, making it difficult to achieve rapid breakthroughs. Since important economic traits in livestock and poultry are typically controlled by complex polygenic structures, and many mutation sites associated with these traits exhibit linkage, modern bio-breeding technologies urgently need to develop towards precision, efficiency, and large-fragment or multi-gene aggregation. Large-fragment gene editing technology can achieve precise gene replacement, which is more conducive to restoring or enhancing the function of target genes at the translational level. Compared to traditional ZFN and TALEN technologies, gene editing technologies represented by CRISPR / Cas are more efficient and have a simpler construction process. Targeted editing can be performed by constructing corresponding sgRNAs for specific targets, and the combined use of multiple sgRNAs can achieve precise large-fragment editing, making it suitable for targeted and precise modification of key target genes, thereby creating new animal germplasm with the target traits.

[0003] The discovery of leptin originated from studies on ob / ob mice with recessive genetic obesity. Early on, the genetic mechanism of this mouse strain was unclear. Later, researchers cloned the leptin gene and used DNA recombination technology to synthesize the expression product of the ob gene, formally naming it leptin. Leptin is mainly secreted by mature white adipose tissue and enters the brain via the bloodstream, where it binds to leptin receptors (LepRb) in the central nervous system to exert its biological functions. Leptin enters the brain primarily through: direct entry from the arcuate nucleus of the hypothalamus; crossing the blood-brain barrier via receptor-mediated blood-brain transport systems; and transmitting signals to the nucleus tractus solitarius of the hypothalamus via vagal afferent fibers. The hypothalamus is the main target of leptin in the central nervous system, with arcuate nucleus neurons highly expressing the LepR gene. Leptin suppresses appetite and alleviates obesity by upregulating the expression of appetite-suppressing neuropeptides (such as Pomc, Cck, and Cart) and downregulating the expression of appetite-promoting neuropeptides (such as NPY and AgRP). Furthermore, leptin can upregulate α-MSH synthesis, reducing appetite while enhancing sympathetic nerve excitability and increasing energy expenditure. Studies have shown that animal models with leptin or its receptor gene knockout generally exhibit increased appetite and weight gain, confirming the central role of leptin in the regulation of energy metabolism. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a method for preparing Leptin gene-edited sheep.

[0005] In a first aspect, the present invention provides an sgRNA combination comprising:

[0006] Lep-sgRNA5 (SEQ ID NO.5): CCGCGATTCCTCGATCCCTC;

[0007] Lep-sgRNA13 (SEQ ID NO. 13): CTCCCTCTACTCCACCGAGG.

[0008] In a second aspect, the present invention provides an expression cassette or vector comprising the aforementioned sgRNA combination.

[0009] Thirdly, the present invention provides a cell comprising the aforementioned sgRNA combination, or the aforementioned expression cassette or vector.

[0010] Fourthly, the present invention provides a kit comprising the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cells.

[0011] Fifthly, the present invention provides the application of the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cell, or the aforementioned kit in reducing the expression level of the leptin gene in animals.

[0012] In a sixth aspect, the present invention provides the application of the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cell, or the aforementioned kit in animal breeding, or in the preparation of leptin gene-edited animals.

[0013] In a seventh aspect, the present invention provides the use of the aforementioned sgRNA combination, or the aforementioned expression cassette or vector, or the aforementioned cells in the preparation of a kit for improving the growth traits of animals;

[0014] Preferably, the growth traits include one or more of body length, body size, or body weight.

[0015] Furthermore, the animal in question is a mammal;

[0016] Preferably, the animal includes one or more of sheep, pigs, cattle, or horses;

[0017] Furthermore, the animal in question is a sheep.

[0018] Eighthly, the present invention provides a method for preparing Leptin gene-edited sheep, comprising: knocking out the Leptin gene of sheep using the aforementioned sgRNA combination.

[0019] Furthermore, the knockout includes: introducing the sgRNA combination and gene editor into sheep embryonic fibroblasts to obtain gene-edited positive cells;

[0020] Reconstructed embryos were obtained by somatic cell nuclear transfer using the gene-edited positive cells as nuclear donors;

[0021] The reconstituted embryo was transplanted into the recipient ewe.

[0022] The present invention has the following beneficial effects:

[0023] This invention provides an sgRNA combination comprising two sgRNAs. This sgRNA combination can accurately and efficiently edit the Leptin gene. Leptin gene-edited sheep obtained using this editing method exhibit significantly improved growth traits (body length and body size), which has important application value in the field of breeding superior sheep breeds. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0025] Figure 1 This is a diagram of the Leptin gene sequence and specific target location provided in Example 1 of the present invention.

[0026] Figure 2 This is an experimental diagram of target sgRNA efficiency screening - T7E1 provided in Example 1 of the present invention.

[0027] Figure 3 This is a PCR statistical experiment graph showing the efficiency of large fragment deletion induced by the Lep-sgRNA combination provided in Example 1 of this invention.

[0028] Figure 4 The Suffolk sheep is a large-fragment knockout positive clone of the Leptin gene provided in Example 3 of this invention.

[0029] Figure 5 This is a sequencing comparison diagram of the large fragment knockout of the Leptin gene in the cloned Suffolk sheep provided in Example 3 of this invention.

[0030] Figure 6 This is a comparison of the growth trait indicators of the F0 generation Leptin gene-edited cloned sheep at four months of age provided in Example 4 of this invention with industry standards. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0032] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0033] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available. DMEM culture medium, trypsin, PBS buffer, and FBS in the examples are all commercially available, for example from Gibco or Life Technologies. Electrolysis buffer and electrolysis cuvettes in the examples are also commercially available, for example from LONZA.

[0034] The gene editors used in the following examples are commercially available, for example, from Nanjing Genscript Biotech Co., Ltd.

[0035] Example 1: Screening for sgRNAs targeting sheep leptin gene knockout

[0036] 1. Based on the sheep genome sequence in NCBI, exons 1, 2, and 3 of the Leptin gene in the sheep genome were selected as target sites to design sgRNAs. The target site sequences are as follows: Figure 1 As shown in Table 1, a total of 18 sgRNAs were designed, of which 6 were located near Exon1, 3 near Exon2, and 9 near Exon3.

[0037] Table 1. Sequences and target sites of sgRNAs (SEQ ID NO.1-SEQ ID NO.18)

[0038]

[0039] 2. Amplification primers were designed for the target sites. The primer sequences are shown in Table 2. S-lep-F1 / R1 is the S-L1-L6 identification primer with a Tm value of 58 degrees, amplifying the target fragment length of 615 bp; S-lep-F2 / R2 is the L7-L9 identification primer with a Tm value of 58 degrees, amplifying the target fragment length of 592 bp; S-lep-F3 / R3 is the L10-L18 identification primer with a Tm value of 58 degrees, amplifying the target fragment length of 711 bp. T7E1 restriction enzyme digestion experiments and high-throughput sequencing efficiency were performed to screen sgRNA efficiency.

[0040] Table 2 Primer sequences (SEQ ID NO.19-24)

[0041]

[0042] T7E1 restriction enzyme digestion and sequencing results showed that all 18 sgRNAs exhibited cleavage efficiency (e.g., Figure 2 Further sequencing of the sgRNAs in the Exon1 and Exon3 regions was performed to verify gene editing efficiency, and the results are shown in the table below.

[0043] Table 3-1 Statistics on gene editing efficiency of candidate sgRNAs through high-throughput sequencing - Part 1

[0044]

[0045] Table 3-2 Statistics on gene editing efficiency of candidate sgRNAs through high-throughput sequencing - Part 2

[0046]

[0047] As shown in the table above, among the 18 sgRNAs, the gene editing efficiency of 7 sgRNAs, namely Lep-sgRNA1, Lep-sgRNA2, Lep-sgRNA4, Lep-sgRNA5, Lep-sgRNA12, Lep-sgRNA13 and Lep-sgRNA16, all exceeded 50%, making them highly efficient sgRNAs. The other sgRNAs also showed efficiency.

[0048] This invention conducts a detailed analysis of its mutant types and preferentially selects Exon1 region - sgRNA2 / sgRNA5 and Exon3 region - sgRNA12 / sgRNA13 / sgRNA16 for subsequent experiments.

[0049] 3. PCR primers used to identify large fragment deletions include the deletion identification primer pairs S-lep-deletion-F1 / R1 and S-lep-deletion-F2 / R2, and the wild-type identification primer pairs S-lep-deletion-F1 / WT-R1 and S-lep-deletion-F2 / WT-R2 (as shown in Table 4).

[0050] The English combination for simultaneously identifying deletion and wild-type events using 3 primer combinations is: S-lep-deletion-F1 / WT-R1 and S-lep-deletion-F2 / WT-R2.

[0051] Table 4. Identification primer sequences (SEQ ID NO.25-30)

[0052]

[0053] After combining electroporation and performing PCR statistical analysis and comparison of the amplification products to determine the efficiency of large fragment deletion induced by Lep-sgRNA combination (results are shown in the figure below). Figure 3 ).from Figure 3 It was found that several combinations of sgRNA2 & sgRNA12, sgRNA2 & sgRNA13, sgRNA5 & sgRNA12, and sgRNA5 & sgRNA13 can all effectively delete large fragments. Among them, the knockout mutant of sgRNA5 & sgRNA13 is optimal, confirming the optimal pairing of sgRNA5 & sgRNA13. Simultaneously, S-lep-deletion-F1R1 + S-lep-WT-R1 was confirmed as the optimal combination of PCR primers.

[0054] Example 2: Obtaining gene-edited positive cell clones

[0055] In this embodiment, the method for preparing gene-positive cell clones includes:

[0056] 1. Establishment of sheep fetal fibroblasts.

[0057] Fetuses of pregnant blackhead Suffolk sheep at 45 days of age were collected, and fetal fibroblasts were established using standard methods. Once the cells reached 80% confluence, they were passaged or cryopreserved.

[0058] 2. Electroporation of sheep fetal fibroblasts and screening of cell clonal sites.

[0059] (1) Two days before electroporation, 2×10 5 The sheep fibroblast cell line obtained in step 1 above was revived in a 6-well plate and 4 mL of DMEM medium containing 10% (v / v) fetal bovine serum (FBS) was added. The plates were then incubated at 37°C in a 5% CO2 incubator.

[0060] (2) After the cells in the 6-well plate have grown to a confluence, approximately 1×10 6 Digest cells with 1 mL of 0.25% trypsin solution. Centrifuge at 1000g for 5 min to pellet the cells. Wash the cell pellet once with PBS buffer. Resuspend the cells in 100 μL of electroporation buffer to obtain a cell suspension.

[0061] (3) Add the gene editor and 15 μg of Lep-sgRNA5 and sgRNA13 selected in Example 1 to 100 μL of the cell suspension obtained in (2) above, mix and transfer to an electroporation cup.

[0062] (4) Electrolyze the cells with an electric field strength of 1.2 kV / cm and a pulse time of 1 ms.

[0063] (5) Transfer the electrolyzed cells into a 60 μm cell culture dish; add 4 mL of DMEM culture medium containing 10% (volume percentage) fetal bovine serum, and culture in a CO2 incubator until the cells recover their growth status and are screened.

[0064] (6) When the cell clones in the culture dish grow to a diameter of more than 2 μm, remove the culture medium, rinse with DPBS, cover the clone cluster with a cloning loop, add about 100 μL of 0.1% trypsin at 37°C, digest for about 3 min, add DMEM medium containing 20% ​​(v / v) FBS to stop digestion, gently pipette and transfer to a 48-well plate for expansion culture.

[0065] (7) When the cell fusion rate in the 48-well plate reaches 90%, half of the cells are digested and used for cell clone genotype identification, while the remaining half are cultured in the well plate.

[0066] Cells used for genotyping were centrifuged at 1000g for 5 minutes, the supernatant was discarded, and 10-20 μL of cell lysis buffer (50 Mm KCl, 2.5 Mm MgCl2, 10 Mm Tris-HCl, 0.45% NP40, 0.45% Tween 20 and 0.2 mg / mL proteinase K) was added according to the amount of cell pellet.

[0067] 3. Identification of positive cell clonal sites.

[0068] (1) Take 3 μL of cell lysate as a template for PCR identification, and use primer pairs consisting of S-lep-deletion-F1 / R1 and S-lep-deletion-F1 / WT-R1 for PCR amplification.

[0069] Deletion identification primers: S-lep-deletion-F1 / R1, 58 degrees, 606bp;

[0070] S-lep-deletion-F1:GATTTCTCACACCTGCCCAG;

[0071] S-LEP-DELETION-R1: GTGGGCATGGAACCTGTATT.

[0072] WT identification primers: S-lep-deletion-F1 / WT-R1, 58 degrees, 868bp;

[0073] S-LEP-DELETION-F1: GATTTCTCACACCTGCCCAG;

[0074] S-LEP-WT-R1: TGAGGACAGATGCAGTGAGA.

[0075] The reaction system consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTP, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O.

[0076] Reaction program: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min, store at 4℃.

[0077] After purifying and sequencing the amplification products obtained from the above PCR amplification, cloned sheep were prepared.

[0078] Example 3: Preparation and Identification of Nuclear Transfer Embryos and Cloned Sheep

[0079] 1. In vitro maturation of sheep oocytes.

[0080] Ovaries were retrieved from the slaughterhouse and transported back to the laboratory. Follicles measuring 3-6 mm on the surface of the ovary were aspirated using a 20 mL syringe equipped with an 18-gauge needle. Under a stereomicroscope, cumulus-oocyte complexes (COCs) with ≥2 layers of cumulus cells, dense structure, and homogeneous cytoplasm were selected and cultured in an in vitro maturation medium for 22 hours.

[0081] 2. Somatic cell preparation.

[0082] Using the serum starvation method, when the cells (the gene-edited positive cell clones constructed in Example 2) grew to 80% confluence, they were subjected to serum starvation treatment, that is, the FBS concentration in the culture medium was reduced from 20% to 0.5% and cultured for 2-5 days. The cells were digested, centrifuged and washed, and finally the cell pellet was resuspended in 1 mL of micromanipulation solution for use as donor cells.

[0083] 3. Enucleation of recipient oocytes and nuclear transfer of donor cells.

[0084] Enucleation of mature oocytes was performed using a blind aspiration method. After cumulus exfoliation of mature oocytes (22 hours old), oocytes with homogeneous cytoplasm, a clear perivitelline space, and intact cell membranes were selected and placed in a micromanipulation droplet. Under micromanipulation, the first polar body and a small amount of cytoplasm near it were aspirated. A single, smooth, round somatic cell (15-20 μM in diameter) with strong refractive properties was selected and injected sub-zona pellucida of the enucleated oocyte through the enucleation needle insertion point, ensuring close contact between the donor cell and the oocyte membrane. 25-30 oocytes were processed per batch. After all procedures were completed, the donor cell-oocyte cytoplasm pair was transferred to culture medium and incubated at 38.5℃, 5% CO2, and 100% humidity for 1-2 hours.

[0085] 4. Integration and activation.

[0086] The reconstructed eggs were transferred in batches to the fusion medium and equilibrated for 3 minutes. After washing three times with the fusion / activation solution, five eggs per batch were placed in a fusion tank filled with fusion medium. The reconstructed eggs were moved with a drawn, fine-tipped solid glass needle to make the donor cell-recipient egg cell membrane contact surface parallel to the electrode. A 30 μs, 2.0 kV / cm DC pulse was applied using an ECM2001 fusion instrument to induce fusion and activate the eggs. After washing five times with culture medium, the eggs were immediately transferred to embryo culture medium covered with mineral oil and cultured at 38.5℃, 5% CO2, and 100% humidity for 0.5 h to 1 h. The eggs were then removed and the fusion was determined under a stereomicroscope.

[0087] 5. Embryo culture.

[0088] The successfully fused reconstructed embryos were washed five times with embryo culture medium and then transferred to embryo culture medium. Eight to ten reconstructed embryos were cultured in 30 μL droplets each, and the cleavage rate was recorded after 48 h of culture.

[0089] 6. Embryo transfer.

[0090] Select recipient ewes in estrus at the same time. Anesthetize them with sedative nigra II. After disinfecting the abdomen, make an 8-10cm incision along the midline of the abdomen, and pull out the ovary and fimbriae of the oviduct. Insert a transfer tube containing selected embryos at least 5cm into the oviduct (to the ampulla-isthmus junction) through the fimbriae, and inject the qualified embryos. The transferred embryos include two types: one is embryos developed to the 2 / 4 / 8 cell stage, with equal division of blastomeres and no cytoplasmic debris; the other is embryos at the 1 / 2 cell stage, where 2-cell embryos divide equally and single-cell embryos are compact. The procedure is sutured. After embryo transfer, administer the agonist benzoxazole hydrochloride (0.15mL) intramuscularly to the lateral hind leg of each ewe to relieve the anesthesia. Then, administer oxytetracycline (5mL) intramuscularly to each ewe to prevent subsequent inflammation and infection.

[0091] 7. Identification of F0 generation positive gene-edited cloned sheep.

[0092] After five months of gestation, gene-edited cloned lambs are born (e.g. Figure 4 ).

[0093] Take cloned sheep ear tissue or blood samples, add DNA extraction buffer and proteinase K to the samples, digest completely in a 56℃ water bath, then extract sequentially with Tris-saturated phenol (twice), phenolform (1:1), and chloroform, centrifuge and collect the supernatant, add anhydrous ethanol to precipitate DNA, wash with 70% ethanol and air dry, then dissolve in TE buffer, detect the concentration and purity of genomic DNA, store at -20℃, and then perform PCR amplification and sequencing.

[0094] Deletion identification primers: S-lep-deletion-F1 / R1, 58 degrees, 606bp;

[0095] S-LEP-DELETION-F1: GATTTCTCACACCTGCCCAG;

[0096] S-LEP-DELETION-R1: GTGGGCATGGAACCTGTATT.

[0097] WT identification primers: S-lep-deletion-F1 / WT-R1, 58 degrees, 868bp;

[0098] S-LEP-DELETION-F1: GATTTCTCACACCTGCCCAG;

[0099] S-LEP-WT-R1: TGAGGACAGATGCAGTGAGA.

[0100] The reaction mixture consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTPs, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O. The reaction program was: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min, then stored at 4℃.

[0101] This invention uses positive identification sequencing on newborn lambs, and the results confirm that the lamb's Leptin gene has been knocked out at a sequence length of 13918 bp, with no non-specific mutations. Figure 5 They successfully obtained a cloned sheep with the Leptin gene precisely knocked out.

[0102] Example 4: Determination of growth indicators in F0 generation positive gene-edited cloned sheep

[0103] At four months of age, the body weight, body length, height, and chest circumference of F0 generation positive gene-edited cloned sheep were measured. The measurements were strictly performed according to the "Technical Specifications for Performance Testing of Sheep and Goats." According to industry standard NY / T 3134-2017, the growth traits of weaned male lambs (4 months of age) of wild-type Suffolk Class II breeding sheep are: height 54cm, body length 54cm, chest circumference 58.5cm, and weight 40.5kg. The comparison results are as follows... Figure 6 As shown.

[0104] from Figure 6 As can be seen, the F0 generation gene-edited cloned sheep of this invention have body length, height, and chest circumference all exceeding the Suffolk breeding sheep industry standards. Specifically, body length exceeds the standard by 23.5%, height by 5%, and chest circumference by 27.5%. This large physique provides a good foundation for later growth and body conditioning. In this invention, to ensure the safety of the F0 generation gene-edited cloned sheep, they were strictly fed a restricted diet, primarily consisting of forage with very little concentrate supplementation. Despite this, their growth indicators still far exceed the breeding sheep industry standards, fully demonstrating the significant growth trait advantages of the Leptin gene-edited cloned sheep created in this study.

[0105] The data shows that only their weight is slightly below the Suffolk breeding sheep industry standard. This is because, to ensure the health of the F0 generation cloned sheep, they have been kept on a restricted diet to prevent excessive weight gain, resulting in relatively lean animals. Normal Suffolk breeding sheep are not restricted in their feeding; they are allowed free access to feed and are given sufficient concentrates for rapid fattening. Current research indicates that the cloning process (especially in vitro manipulation of embryos) may interfere with early developmental programming, leading to slower growth and smaller size during the fetal or neonatal period. However, the next generation (F1 generation) produced through natural sexual reproduction of cloned animals is completely normal and exhibits superior growth traits. Therefore, since F1 generation sheep are born normally rather than cloned, they do not require restricted feeding and are likely to show better growth performance than the F0 generation, significantly exceeding the breeding sheep industry standard.

[0106] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An sgRNA combination, characterized in that, include: Lep-sgRNA5:CCGCGATTCCTCGATCCCTC; Lep-sgRNA13: CTCCCTCTACTCCACCGAGG.

2. An expression box or carrier, characterized in that, Includes the sgRNA combination as described in claim 1.

3. A cell, characterized in that, Includes the sgRNA combination of claim 1, or the expression cassette or vector of claim 2.

4. A reagent kit, characterized in that, Includes the sgRNA combination of claim 1, or the expression cassette or vector of claim 2, or the cell of claim 3.

5. The use of the sgRNA combination of claim 1, or the expression cassette or vector of claim 2, or the cell of claim 3, or the kit of claim 4 in reducing the expression level of the leptin gene in sheep.

6. The use of the sgRNA combination of claim 1, or the expression cassette or vector of claim 2, or the cell of claim 3, or the kit of claim 4 in sheep breeding or in the preparation of leptin gene-edited sheep.

7. The use of the sgRNA combination of claim 1, or the expression cassette or vector of claim 2, or the cells of claim 3 in the preparation of a kit for improving growth traits in sheep; said growth traits include: One or more of body length, body size, or weight.

8. A method for preparing Leptin gene-edited sheep, characterized in that, include: The sgRNA combination described in claim 1 was used to knock out the Leptin gene in sheep.

9. The method according to claim 8, characterized in that, The knockout includes: introducing the sgRNA combination and gene editor into sheep embryonic fibroblasts to obtain gene-edited positive cells; Reconstructed embryos were obtained by somatic cell nuclear transfer using the gene-edited positive cells as nuclear donors; The reconstructed embryo was transplanted into the recipient ewe.

Citation Information

Patent Citations

  • Porcine LepR gene knockout targeting vector, construction method and application thereof

    CN106755024A