Gene for regulating plant temperature-sensitive male sterility and application thereof
By using gene editing technology to regulate the temperature-sensitive male sterility trait of Chinese cabbage, the breeding problem of Chinese cabbage under different environmental conditions has been solved, and the breeding process has been simplified and the yield of hybrid varieties has been increased.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHENYANG AGRI UNIV
- Filing Date
- 2025-12-17
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies are insufficient to effectively regulate the temperature-sensitive male sterility trait in Chinese cabbage, limiting its breeding applications under different environmental conditions.
By using gene editing technology, especially the CRISPR/Cas9 system, the BraA06g042380.3.5C gene can be knocked out or interfered with, causing it to exhibit male infertility under high temperature conditions and to revert to male fertility under low temperature conditions, thus achieving control of the temperature-sensitive male infertility phenotype.
This has enabled the "one line, two uses" breeding of Chinese cabbage, simplified the breeding process, expanded the range of crossbreeding, and increased the yield of hybrid varieties.
Smart Images

Figure CN121380112B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant trait control gene identification and breeding technology, and specifically relates to a gene that can be used to regulate the temperature-sensitive male sterility trait of Chinese cabbage and its application. Background Technology
[0002] Chinese cabbage is an important vegetable crop in my country, exhibiting significant heterosis. Male sterility is an ideal way to utilize heterosis in Chinese cabbage; therefore, research on the molecular mechanisms of stamen fertility regulation in Chinese cabbage has received considerable attention from breeders. Environmentally sensitive male-sterile lines exhibit reversible fertility conversion under different environmental conditions, enabling them to achieve "dual-use" characteristics. Under restrictive conditions such as long-day, high-temperature, or low-humidity conditions, this sterile line exhibits male sterility, facilitating hybridization for seed production; while under suitable conditions such as short-day, low-temperature, or high-humidity conditions, it reverts to male fertility, allowing for self-pollination to complete the seed production process. Compared to the three-line method, the two-line method eliminates the dependence on restorer lines, allowing for more flexible parental selection and more diverse combinations, which is beneficial for breeding higher-yielding hybrid varieties. The applicant previously used EMS chemical mutagenesis of germinating seeds of the DH line 'FT' of Chinese cabbage to create a genetically rich Chinese cabbage mutant library. This experiment screened a temperature-sensitive male-sterile mutant from this library. M5032 Based on the phenotypic and genetic characteristics analysis of mutant traits, candidate mutant genes are cloned using forward genetics techniques, and their expression characteristics are analyzed. Summary of the Invention
[0003] In view of this, the purpose of this invention is to provide a gene that regulates the thermosensitive male sterility trait and its application.
[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a gene controlling the temperature-sensitive male sterility phenotype in plants, the gene being... BraA06g042380.3.5C .
[0005] In some implementations, when the gene fails to correctly translate and express the relevant protein product, it exhibits a stable male sterility phenotype under high temperature conditions and a stable male fertility phenotype under low temperature conditions. In some implementations, when the gene is correctly translated and expresses the relevant protein product, the male is fertile and the phenotype is not regulated by temperature changes.
[0006] In some specific implementations, the high temperature condition refers to a daily average temperature exceeding 14°C, and the low temperature condition refers to a daily average temperature below 9°C.
[0007] In some implementations, in temperature-sensitive male-sterile phenotype plants, a C-to-T mutation occurs in the second exon of the gene, leading to premature termination of translation.
[0008] In some specific embodiments, the gene is BrMA1, which contains the sequence shown in SEQ ID NO:3.
[0009] This invention provides the application of genes described in any of the above places in regulating the thermosensitive male sterility phenotype in plants.
[0010] In some implementations, the plant acquires the thermosensitive male sterility phenotype by gene editing, knockout, interference, or reduction of gene expression. In some specific implementations, the gene editing causes premature termination of gene translation. In some specific implementations, the gene editing causes a C-to-T mutation in the second exon of the gene.
[0011] This invention provides a method for cultivating temperature-sensitive male-sterile plants, characterized by using genetic engineering techniques such as gene editing, knockout, interference, and reduction of gene expression to prevent the normal expression of any of the genes mentioned above, thereby obtaining temperature-sensitive male-sterile plants.
[0012] In some specific embodiments, the genetic engineering technique causes premature termination of gene translation. In some specific embodiments, the gene editing causes a C-to-T mutation in the second exon of the gene.
[0013] In some embodiments, the genetic engineering techniques include CRISPR / Cas9, ribozymes, and / or small interfering RNA. In some specific embodiments, the genetic engineering technique is CRISPR / Cas9 technology.
[0014] In some specific implementations, gene editing technology was used to induce a C-to-T mutation in the second exon of BraA06g042380.3.5C in the recipient plant, leading to premature termination of translation.
[0015] In some specific implementations, the thermosensitive male-sterile line exhibits male sterility under high-temperature conditions and can be used for hybrid seed production; under low-temperature conditions, it exhibits male fertility and can be used for self-pollination.
[0016] In some embodiments, any of the plants mentioned above are plants of the Brassicaceae family. In some specific embodiments, any of the plants mentioned above are plants of the Brassica genus. In some specific embodiments, any of the plants mentioned above are Chinese cabbage, bok choy, turnip, rapeseed, radish, baby bok choy, mustard greens, or cabbage. In some specific embodiments, any of the plants mentioned above are Chinese cabbage.
[0017] In some implementations, any of the plants mentioned above is Arabidopsis thaliana.
[0018] This invention provides a novel gene regulating temperature-sensitive male sterility, enabling "one line for two uses" in plant breeding, simplifying the breeding process and accelerating the breeding process. Compared with the three-line method, the two-line method is not limited by restorer lines, has a wide range of pairings, and produces high yields of hybrids. Attached Figure Description
[0019] Figure 1 Phenotypic observations of 'FT' and M5032 are shown.
[0020] Figure 2 The results of floral organ observations for 'FT' and M5032 are shown. Figure 2 a-2f are, in order, pistil, long stamen, short stamen, petals, flower bud, and sepals.
[0021] Figure 3 Pollen viability analysis of 'FT' and M5032 is shown.
[0022] Figure 4 Transmission electron microscopy observations of 'FT' and M5032 are shown.
[0023] Figure 5 The temperature-sensitive characteristics of M5032 are shown. Figure 5 a-5b represent the characteristics of 'FT' at 14℃ and 9℃, respectively; Figure 5 c-5d represent the characteristics of M5032 at 14℃ and 9℃, respectively.
[0024] Figure 6 The distribution map of SNP-index on chromosomes is shown.
[0025] Figure 7 The KASP genotyping at SNP27103470 is shown. G:G corresponds to red dots, and A:A corresponds to blue dots.
[0026] Figure 8 The KASP genotyping at SNP27173548 is shown. G:G corresponds to red dots, G:A corresponds to green dots, and A:A corresponds to blue dots.
[0027] Figure 9 The gene structure of BraA06g042380.3.5C is shown. The red arrows highlight the mutation sites.
[0028] Figure 10 Clonal alignments of sequences surrounding the 'FT' and M5032 mutation sites are shown.
[0029] Figure 11 The subcellular localization of BrMA1 and Brma1 is shown.
[0030] Figure 12The phenotypic identification of BrMA1 Arabidopsis gene-edited plants is shown. Col-0 is the wild-type Arabidopsis, a homozygous atm mutant, and LT-atm is a homozygous mutant at low temperature. Detailed Implementation
[0031] The present invention will now be described in detail with reference to embodiments, but the embodiments provided herein are for illustrative purposes only and are not intended to limit the present invention.
[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials and reagents used are commercially available.
[0033] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Nevertheless, this invention still intends to provide a more detailed description and explanation of these terms and phrases. In the event of any inconsistency between the terms and phrases mentioned and their known meanings, the meanings expressed in this invention shall prevail.
[0034] Example 1: Identification of male sterility phenotype in Chinese cabbage 1.1 Experimental Methods A mutant library of Chinese cabbage was created by mutagenesis of germinating seeds of the DH line 'FT' using 0.8% EMS solution. A stable, heritable, thermosensitive male-sterile mutant was identified from this library. M5032 The materials used in this study were all cultivated at the Vegetable Genetics and Breeding Experimental Base of Shenyang Agricultural University.
[0035] Wild-type 'FT' and thermosensitive male sterile mutants were selected. M5032 The plants were examined for floral organs and pollen viability was measured. Specific procedures included: 1) During the reproductive growth stage of the plant, 'FT' and '...' were observed using a stereomicroscope (Nikon SMZ800, Japan). M5032 The morphology of floral organs (pistil, long stamens, short stamens, petals, sepals, and buds).
[0036] 2) During the peak flowering period, anthers were collected from the flower buds and placed on a glass slide. The 'FT' and 'FT' were assessed using the 2,3,5-triphenyltetrazolium chloride (TTC) staining method. M5032 Pollen viability was determined by placing 50 µL of TTC (0.2%) staining solution onto a glass slide and then placing a coverslip on top. The slide was incubated at 37°C for 20–30 min. Pollen viability was observed using a fluorescence inverted microscope (OLYMPUS DP80, Japan).
[0037] 1.2 Experimental Results During the peak flowering period, wild-type 'FT' and thermosensitive male-sterile mutants were tested. M5032Phenotypic observation revealed M5032 The phenomenon of stamen abortion occurs (see...) Figure 1 ). Compared to 'FT', mutant M5032 The anther surface lacks pollen grains. For 'FT' and M5032 Observation of floral organs revealed that the mutant M5032 The long stamens, short stamens, petals, pistil, sepals, and buds are all slightly smaller than 'FT' (see Figure 2 Pollen viability analysis showed that 'FT' produced viable pollen grains, while M5032 No pollen grains were produced (see) Figure 3 ).
[0038] Example 2: M5032 Transmission electron microscopy observation of mutants 2.1 Experimental Methods Wild-type 'FT' and thermosensitive male sterile mutants were selected. M5032 Anther samples from flower buds at the appropriate developmental stage were fixed in glutaraldehyde-phosphate buffer, followed by fixation in osmium tetroxide fixative for 7 hours. Dehydration was then performed in ethanol of varying concentrations, followed by final dehydration in acetone. Next, the samples were embedded in a mixture of acetone and embedding agent at 37°C, then inserted into embedding plates and incubated overnight at 37°C. Finally, the embedding plates were polymerized at 60°C for 48 hours, and the resin blocks were removed for later use. Ultrathin sections of approximately 60-80 nm thickness were then prepared using a 150-mesh copper screen. Finally, staining was performed. Transmission electron microscopy was used for image acquisition. 2.2 Experimental Results Using transmission electron microscopy to observe 'FT' and M5032 The ultrastructure of microspores. The pollen exine of 'FT' is complete, with clearly defined rod-shaped and operculum morphologies, after the tetrad stage. M5032 The delayed degradation of the callosity wall affects the formation of the rod-shaped columnar layer and apical layer of the microspores, leading to abnormal pollen exwall structure and stamen abortion (see...). Figure 4 ).
[0039] Example 3: M5032 Thermosensitive male sterility mutants possess thermosensitive properties 3.1 Experimental Methods Will M5032The temperature-sensitive male-sterile mutant was germinated in late July, vernalized for 20 days, and then sown in a cold greenhouse. The plants were transferred to a greenhouse in mid-October. Plant fertility was continuously observed from the flowering period, and the actual ambient temperature was recorded. The daily average temperature (T) was calculated using the formula T = (2T1 + T2 + T3) / 4, where T1 is the temperature at 8:00 AM, T2 is the temperature at 12:00 PM, and T3 is the temperature at 8:00 PM.
[0040] 3.2 Experimental Results When the average daily temperature exceeds 14℃, the temperature-sensitive sterile mutant... M5032 The plants exhibit a stable sterile phenotype and can be used as sterile lines for hybridization and seed production; when the average daily temperature is below 9℃, they exhibit a stable fertile phenotype and can be used for self-pollination (see...). Figure 5 ).
[0041] Example 4: Genetic characteristics analysis of thermosensitive male sterile mutants in Chinese cabbage 4.1 Experimental Methods Utilizing parent M5032 Genetic analysis was performed on F1 and F2 generations constructed using 'FT'. The number of male-fertile and male-sterile plants in the F1 and F2 generations was observed and statistically analyzed. The segregation ratio of the F2 population was analyzed using the chi-square test (χ²).
[0042] 4.2 Experimental Results The F2 population contained 499 fertile male plants and 159 male sterile plants, a ratio consistent with 3:1 (χ2=0.24) (see Table 1). Therefore... M5032 The thermosensitive male sterility phenotype is controlled by a pair of recessive nuclear genes.
[0043]
[0044] Example 5: Localization of the control gene in the thermosensitive male sterility mutant of Chinese cabbage 5.1 Experimental Methods MutMap Location: An improved MutMap method was used to identify genomic regions of thermosensitive male sterility mutations and to identify candidate genes for these mutations through analysis.
[0045] Thirty-eight F2 plants with good nutritional status and a sterile phenotype were selected. DNA was extracted from young leaves of each plant, and equal volumes of qualified DNA samples were mixed to form the mutant-mixed pool for sequencing. Leaf DNA was extracted from wild-type 'FT' plants to form the wild-type parental DNA pool (Parental WT-Pool), and DNA from preserved M2 generation male-sterile plants was used as the mutant parental DNA pool (Parental M-Pool). Whole-genome DNA extraction of the above materials was performed using the DNA Secure Plant Genomic DNA Extraction Kit (TIANGE, Beijing), strictly following the instructions. Library construction began with random fragmentation of DNA by sonication, followed by end-componenting, A addition, and adapter fragment generation to obtain target DNA of appropriate length. PCR amplification was then used to construct the DNA-seq library. After quality control testing, the constructed DNA library was sequenced using the Illumina HiSeq platform with paired-end (PE) sequencing. The raw sequencing data was filtered, processed, and quality-assessed to obtain high-quality reads (HQ reads). The Burrows-Wheeler Aligner (BWA) software was used to align the HQ reads with the *Brassica rapa* reference genome. Single nucleotide polymorphism (SNP) sites were extracted and annotated using the mutation analysis software GATK and ANNOVAR. A sliding window method was used to plot the distribution of SNP-index on the *Brassica rapa* chromosome. SNP-index values are directly proportional to the linkage strength of the target trait; higher values indicate a stronger association with the target trait. The 95th percentile was selected as candidate regions, and genes within these regions were functionally annotated.
[0046] KASP genotyping: To obtain SNP loci cosegregating with the sterility trait, KASP (Kompetitive Allele Specific PCR) technology was used to genotype and validate the SNP loci of candidate genes. Eighty male-sterile mutants were selected, with the wild-type parent 'FT' as a control. Fresh leaf material was collected, and leaf DNA was extracted using a modified CTAB method. Specific primers containing SNP loci were designed, and fluorescent probes were ligated to their tails. Genotype was determined by the fluorescence pattern.
[0047] 5.2 Experimental Results MutMap sequencing technology for location M5032 Thermosensitive male sterility mutant gene. For wild-type 'FT' and thermosensitive male sterility mutants. M5032 High-throughput sequencing was performed on a pool of F2 male sterile phenotypes. The sequencing data included some low-quality data. FastP (v0.20.0) was used to filter the raw data using a sliding window method, resulting in 176,452,962, 119,951,698, and 143,254,126 high-quality data points, respectively. Among these, 99.21%, 96.05%, and 98.88% could be aligned to the Brara_Chiifu_V3.5 reference genome, respectively.
[0048] To ensure reliability, SNP polymorphic sites were further filtered according to the filtering criteria, SNP-index values were calculated, and the distribution of SNP indices on the Chinese cabbage chromosome was plotted. Regions with SNP-index values exceeding the 95th percentile were selected as [the most relevant regions]. M5032 Candidate regions associated with the temperature-sensitive male sterility trait were identified, and candidate genes were located at chromosomes A06 from 3,600,000 to 7,400,000, 7,600,000 to 11,400,000, and 24,600,000 to 28,000,000 (see [link to relevant data]). Figure 6 A total of 26 SNPs were found within the candidate region, including two SNPs with an SNP-index of 1 located in exons of the gene: SNP27103470 and SNP27173548. SNP27103470 is a premature termination mutation, and SNP27173548 is a non-synonymous mutation. BraA06g042380.3.5C and BraA06g042590.3.5C These are candidate genes (see Table 2).
[0049]
[0050] To identify candidate genes, wild-type 'FT' and thermosensitive male sterile mutants were used. M5032 Using [material name], KASP genotyping was performed on SNP27103470 and SNP27173548. BraA06g042380.3.5C Taking SNP27103470 as an example, the genotype of its male-sterile phenotype should be A:A, and the genotype of the wild type should be G:G. The results showed that the genotype of SNP27103470 in all tested F2 mutant phenotype individuals was A:A, and the wild type was G:G (see...). Figure 7 The tested plants showed a one-to-one correspondence between phenotype and genotype, meaning that this SNP co-segregated with the thermosensitive male sterility phenotype; while another SNP, 27173548, did not co-segregate with the thermosensitive male sterility phenotype (see...). Figure 8 Therefore, the corresponding site of SNP27103470 BraA06g042380.3.5C The gene was identified as causing M5032 Candidate genes for temperature-sensitive male sterility phenotype.
[0051] Example 6: BrMA1 Gene cloning and analysis from M5032 Cloning in 'FT' BraA06g042380.3.5C DNA and cDNA sequences. The results showed that... BraA06g042380.3.5C It is 3380 bp in length and contains 13 exons. A C-to-T mutation occurs in the second exon (see...). Figure 1-10 The mutation from CGA (alanine) to TGA (stop codon) causes premature termination of translation. Therefore, it is predicted that... BraA06g042380.3.5C Thermosensitive male sterility mutant M5032 Candidate genes, due to M5032 The mutation causes abnormal meiosis, and it is named BrMA1 .
[0052] > BrMA1 Partial sequence near the -wt mutation site GTATTGGACCGTTGGAACCACAGGCATCGCGATCACAGCAGTCGCAGCAGCTT C GATCTCAGCAGTCACAGCAGTCGTTCTCGCAGGGACCTTCGTCTTACTCTCAGCGTGGTTGTTTTTCTCAGAGGACTCAGGGCTCGGTT SEQ ID NO:1 > BrMA1 Partial sequence near the mutation site GTATTGGACCGTTGGAACCACAGGCATCGCGATCACAGCAGTCGCAGCAGCTT T GATCTCAGCAGTCACAGCAGTCGTTCTCGCAGGGACCTTCGTCTTACTCTCAGCGTGGTTGTTTTTCTCAGAGGACTCAGGGCTCGGTT SEQ ID NO:2 Note: The bolded underlined parts indicate the mutation locations relative to wild-type CDS.
[0053] Example 7: BrMA1 Subcellular localization 7.1 Experimental Methods clone BrMA1The CDS sequence of the gene was seamlessly cloned into the pBWA(V)HS-egfp vector, and the constructed vector was transformed into Agrobacterium GV3101. When the OD600 value of the Agrobacterium culture reached 0.6-0.8, it was injected into tobacco leaves. After 24 h of dark and light treatment, the fluorescence signal in the tobacco leaf tissue was observed using a laser confocal microscope (Leica Microsystems, Wetzlar, Germany). GFP fluorescence signal was detected in the wavelength range of 496-540 nm.
[0054] 7.2 Experimental Results: The results are as follows Figure 11 As shown, pBWA(V)HS- BrMA1 The -egfp fusion protein can co-localize with nuclear markers, indicating that... BrMA1 It is located in the cell nucleus.
[0055] >BrMA1 -wt CDS sequence SEQ ID NO:3 Example 8: Knockout in Arabidopsis using the CRISPER / Cas9 gene editing system BrMA1 8.1 Experimental Methods sgRNAs were designed using the online platform of Huazhong Agricultural University (http: / / crispr.hzau.edu.cn / CRISPR2 / ). Two sgRNAs from the gene were constructed into the pHEE401 vector. The vector, which was verified to be correct by sequencing, was then transformed into Agrobacterium GV3101 strain for plant infection. Agrobacterium tumefaciens carrying the appropriate vector was cultured at a ratio of approximately 1:50 until OD600 = 0.9. The bacterial cells were collected in 50 ml centrifuge tubes, centrifuged at 5000 RPM for 10 min, and resuspended in Agrobacterium tumefaciens transformation buffer (osmotic buffer). After resuspending, OD600 was ensured to be 0.8-1.0; this was the transformation buffer for Agrobacterium tumefaciens infection. Healthy 5-7 week old Arabidopsis thaliana plants were selected, and existing pods and fully open flowers were removed. The pruned Arabidopsis inflorescences were immersed in the Agrobacterium tumefaciens transformation buffer for approximately 60 seconds. The soaked Arabidopsis thaliana was then laid flat and kept in the dark for 24 hours to recover growth. Afterward, the Arabidopsis thaliana was left to grow normally until the seeds matured and were harvested; these were the T0 generation seeds. The T0 generation seeds were sterilized with 75% ethanol solution and then germinated on 1 / 2 MS plates carrying hygroscopic resistance for resistance selection. Select resistant seedlings that have grown true leaves and are able to take root, and transplant them to grow.
[0056] The mutant screening steps are as follows: ① Take a small number of leaves from T0 positive plants, extract genomic DNA, and use it as a PCR template; ② Design PCR primers at appropriate positions on both sides of the sgRNA target site, perform PCR amplification, and directly sequence the PCR product to detect whether the editing target site has been edited (if editing occurs, the sequencing peak diagram will show base deletion causing heterogeneous peaks / double peaks).
[0057] 8.2 Experimental Results Chinese cabbage BrMA1 Arabidopsis homologs AT1G01690 Knockout, the successfully identified mutants were self-crossed, and the phenotypes of the offspring were observed after sowing. Floral organ observation of flowering Arabidopsis revealed that, under normal temperature of 23℃, the wild-type Col-0 had pollen attached to the anther surface, but the homozygous mutant atm had short stamens and no pollen on the anther surface, exhibiting male sterility. Fertility was restored under a low-temperature treatment of 14℃. Figure 12 This experiment proved BrMA1 It is a key gene that regulates temperature-sensitive male sterility in Chinese cabbage, and its mutation causes the male sterility phenotype in Chinese cabbage.
[0058] The specific embodiments are merely illustrative of the present invention and are not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to these embodiments without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.
Claims
1. The application of a plant thermosensitive male sterility phenotype control gene in regulating the plant thermosensitive male sterility phenotype, characterized in that, The plant in question is Arabidopsis thaliana, and the gene in question is Arabidopsis thaliana. AT1G01690 The application described above causes Arabidopsis thaliana to exhibit male sterility at 23°C by knocking out the gene, and to regain fertility at 14°C.
2. A method for cultivating temperature-sensitive male-sterile plants, characterized in that, The plant in question is Arabidopsis thaliana, and genes in Arabidopsis thaliana were knocked out through gene editing. AT1G01690 This makes Arabidopsis genes AT1G01690 Unable to express normally, thus obtaining thermosensitive male-sterile Arabidopsis thaliana, causing Arabidopsis thaliana to exhibit male sterility at 23℃ and regain fertility at 14℃.