Application of protein encoded by trim25 gene in improving transfection efficiency of fish cells

Abstract

The present application belongs to the field of molecular biology and cell engineering technology, and particularly relates to application of a protein encoded by a trim25 gene in improving fish cell transfection efficiency. The present application aims to solve the problem of low fish cell transfection efficiency. The technical problem of the present application is the application of the protein encoded by the trim25 gene in improving fish cell transfection efficiency; the amino acid sequence of the protein is shown as SEQ ID No. 1. The present application first explicitly defines the role of the protein encoded by the trim25 gene in fish cell transfection efficiency. The method of the present application is simple to operate, low in cost and good in repeatability, and provides an efficient tool for fish gene function research, gene editing and the like.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and cell engineering technology, specifically relating to the application of the protein encoded by the trim25 gene in improving the transfection efficiency of fish cells. Background Technology

[0002] Transfection of exogenous genes into fish cells is fundamental for gene function research and gene editing, but it currently faces the bottleneck of generally low efficiency. Existing methods are mainly divided into three categories: physical methods (microinjection, electroporation), which can bypass some barriers, are complex to operate and sensitive to the hard eggshells and strong membrane barriers of fish, with efficiency often less than 40%; chemical methods (liposomes, nanocarriers), which are gentle but have limited delivery effects and are easily affected by fish serum components; and biological methods (viral vectors, gene guns), which are highly efficient but have safety risks and physical damage problems. The core challenge of transfection of exogenous genes into fish cells lies in the fact that the special structure of fish (multi-layered membranes, hard eggshells, low-temperature culture environment) makes it difficult for exogenous genes to enter efficiently. Therefore, in practical applications, a trade-off must be made between operational difficulty, cell damage, and transfection efficiency based on cell type, experimental scale, and purpose, and there is still no universally applicable and highly efficient solution.

[0003] Existing methods for improving fish cell transfection efficiency mainly focus on physical or chemical means such as optimizing transfection reagents, adjusting cell density, and changing electroporation parameters. There are no reports of improving transfection efficiency by knocking down endogenous RNA degradation pathways in cells. Summary of the Invention

[0004] The technical problem to be solved by this invention is the low transfection efficiency of fish cells.

[0005] The technical problem of this invention is the application of the protein encoded by the trim25 gene in improving the transfection efficiency of fish cells; the amino acid sequence of the protein is shown in SEQ ID No. 1.

[0006] Specifically, the improvement in fish cell transfection efficiency is achieved by knocking down the expression of the trim25 gene in fish cells.

[0007] Furthermore, the specific operation of knocking down the expression of the trim25 gene in fish cells is as follows: designing siRNA targeting the trim25 gene and transfecting it into fish cells.

[0008] The siRNA is at least one of the SEQ ID No. 5-7.

[0009] Specifically, the trim25 gene has a nucleotide sequence as shown in NCBI number NM_200175.1.

[0010] The fish cells in question are zebrafish (Danio rerio) cells.

[0011] Furthermore, the zebrafish (Danio rerio) cells are zebrafish embryonic fibroblasts PAC2.

[0012] The present invention also provides a method for improving the transfection efficiency of fish cells by knocking down the expression of the trim25 gene in fish cells.

[0013] Furthermore, the specific operation of knocking down the expression of the trim25 gene in fish cells is as follows: designing an siRNA interference fragment targeting the trim25 gene and transfecting it into fish cells.

[0014] The siRNA is at least one of the SEQ ID No. 5-7.

[0015] Specifically, the trim25 gene has a nucleotide sequence as shown in NCBI number NM_200175.1.

[0016] The fish cells in question are zebrafish (Danio rerio) cells.

[0017] Furthermore, the zebrafish (Danio rerio) cells are zebrafish embryonic fibroblasts PAC2.

[0018] The present invention further provides a method for transfecting exogenous genes into fish cells, comprising the following steps: knocking down the expression of the trim25 gene in fish cells to obtain cells with low trim25 gene expression; and transfecting exogenous nucleic acid into cells with low trim25 gene expression.

[0019] Furthermore, the specific operation to reduce the expression of the trim25 gene in fish cells is as follows: design siRNA targeting the trim25 gene and transfect it into fish cells.

[0020] The siRNA is at least one of the SEQ ID No. 5-7.

[0021] Specifically, the trim25 gene has a nucleotide sequence as shown in NCBI number NM_200175.1.

[0022] The fish cells in question are zebrafish (Danio rerio) cells.

[0023] Furthermore, the zebrafish (Danio rerio) cells are zebrafish embryonic fibroblasts PAC2.

[0024] Specifically, the transfection of exogenous nucleic acid into cells with low expression of the trim25 gene is performed using either liposome nucleic acid transfection or mRNA transfection.

[0025] More specifically, the exogenous nucleic acid is a coding fragment of eGFP.

[0026] Preferably, in the mRNA transfection method, the coding fragment for eGFP is eGFP mRNA, and its structure is Cap1-m1Ψ-eGFP mRNA. The aforementioned structure includes: a Cap1 cap structure at the 5' end modified with m1Ψ, and a poly(A) tail at the 3' end.

[0027] The beneficial effects of this invention are as follows: This invention clarifies for the first time the role of the protein encoded by the trim25 gene in the transfection efficiency of fish cells. Based on experimental results, this invention provides the application of the protein encoded by the trim25 gene in improving the transfection efficiency of fish cells. This application is achieved by knocking down the expression of the trim25 gene in fish cells; specifically, RNA interference technology is used to target and inhibit the expression of the trim25 gene, thereby achieving efficient transient transfection of exogenous nucleic acids in fish cells. This invention also uses eGFP as an example for transfection of exogenous nucleic acids, and the transfection efficiency is significantly improved (up to 81%). The method of this invention is simple to operate, low in cost, and highly reproducible, providing an efficient tool for fish gene function research and gene editing. In subsequent use, the Cas9 system can be used to knock out the trim25 gene in cells, thereby successfully obtaining trim25 knockout cell lines. Other exogenous nucleic acid transfections can then be performed based on the aforementioned cell lines. Attached Figure Description

[0028] Figure 1 Results of RNA quality detection and PCR amplification of the trim25 gene in zebrafish PAC2 cells. β-actin gene was used as an internal control, and the trim25 gene size was 854 bp.

[0029] Figure 2 The results are Semi-quantitative PCR and qRT-PCR detection results after interference with the trim25 gene.

[0030] Figure 3 This is a comparison of fluorescence expression after GFP-mRNA transfection with mRNA transfection reagent 48h following trim25 gene interference. NC is the negative control group. Scale bar: 100μm.

[0031] Figure 4 This is a comparison of fluorescence expression after GFP-mRNA transfection with liposome transfection reagent 48h following trim25 gene interference. NC is the negative control group. Scale bar: 100μm.

[0032] Figure 5 This is a comparison of fluorescence expression after transfection of GFP-N1 plasmid with liposome transfection reagent 48 h after interference with the trim25 gene. NC is the negative control group. Scale bar: 100 μm. Detailed Implementation

[0033] Trim25 (Tripartite motif-containing protein 25) is an E3 ubiquitin ligase widely involved in cellular antiviral responses, RNA metabolism, and protein stability regulation. Recent studies have found that TRIM25 can recognize exogenous RNA in mammalian cells and mediate its degradation through ubiquitination, thereby reducing the expression efficiency of exogenous genes. However, the function of Trim25 in fish cells has not been systematically studied, and whether it participates in regulating the stability and transfection efficiency of exogenous nucleic acids remains unclear.

[0034] This invention first designed siRNA targeting the trim25 gene and transfected zebrafish embryonic fibroblasts to obtain cells with the trim25 gene knocked down. Then, using eGFP as an example, transfection with exogenous nucleic acids was performed, significantly improving transfection efficiency (up to 81%). In subsequent applications, the Cas9 system can be used to knock out the trim25 gene in cells, thus successfully obtaining trim25 knockout cell lines. Other exogenous nucleic acids can then be transfected based on the aforementioned cell lines.

[0035] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0036] Example 1: Interference with trim25 gene expression

[0037] The subject of this embodiment is zebrafish embryonic fibroblast PAC2 cells that normally express the trim25 gene (purchased from Shanghai Jinyuan Biotechnology, cell source strain: zebrafish Danio rerio (Brachydanio rerio), NCBI Taxonomy: 7955), and the cells were in the third to tenth generation at the time of use.

[0038] 1) Total RNA extraction and cDNA synthesis

[0039] Total RNA extraction: Total RNA was extracted from PAC2 cells using a small-volume total RNA extraction kit (Jianshi Bio). After PAC2 cells were lysed and washed, RNA was extracted and purified using TRIzol lysis buffer according to the kit instructions, and genomic DNA was removed. The purity A260 / A280 = 2.01.

[0040] cDNA synthesis: Reverse transcription was performed using an All-In-One 5x RT Master (Abm) PCR instrument, following a reaction program of 37 ℃ for 15 min and 60 ℃ for 10 min. The resulting reaction solution could be directly used for subsequent PCR reactions. The reaction solution was aliquoted and stored at -20 ℃.

[0041] 2) Detection of cDNA template

[0042] Using the above cDNA as a template and zebrafish β-actin-specific primers as internal control primers, PCR amplification was performed to determine if the template could be used in subsequent experiments. The resulting product was subjected to agarose gel electrophoresis to detect the cDNA template. The obtained fragment size was approximately correct, and the bands were single, without any extraneous bands or diffusion, proving that the obtained cDNA could be used in subsequent experiments.

[0043] 3) Trim25 gene testing

[0044] The full-length trim25 gene is 1965 bp (NCBI accession number NM_200175.1). Specific primers P1 / P2 were designed using Primer 6.0 to detect trim25 gene expression in PAC2 cells. The expected fragment size was 854 bp (positions 169-1022 of the full-length trim25 gene sequence). Primer P1: CGAATTGGCGTTCAGCAGTAA (SEQ ID No. 2); Primer P2: ACAGCAGAGGAGTGGTAAGC (SEQ ID No. 3).

[0045] Protein encoded by the trim25 gene in SEQ ID No. 1:

[0046] .

[0047] The cDNA was used as a template for PCR amplification. After amplification, a small amount of the PCR product was subjected to agarose gel electrophoresis. The size of the obtained fragment was consistent with the expected value. The amplified system was then sent to the company for sequencing. The results showed that the sequenced sequence was consistent with the trim25 gene fragment, as shown in SEQ ID No. 4.

[0048] SEQ ID No.4:

[0049] TGTGGTAGACTGTCCTCGGCGCGGTGCTGGATGCCTATAGAGTAAAAGCGGGCATTTCGGAACCTGTCAAGAATCCAGTTGAAGAGAAAAAGAAGGATCCAGATGCGATTAAATGTGACAGCTGTATGGAAGCCAAAGCGGTCAAAACTTGTCTGACGTGTATGGCGTCCTATTGTGAAGATCATGTGAGGCCTCACCGAGAGAATGCCATTTTCCGGGCGCATCAACTTTGTGATCCGCTGCCAGATCTAATGGAGCGTCTCTGTTCCGATCATGGCAAACTGATGGAGTTCTACTGCATTCAGCACCAGAGCTGCATCTGCAGCACCTGTCTTCAGTACATTCACAAGGGCTGTGAGTTCATCACCACAGATGAGCGGCGCTTCAAACAAAAGACTGATCTGACTGACAAGCTAAACATGATTGAAGGCAAAATGGACAAGAATGAACAGGTTATCACACAGATGAAGGAGCAGCAAAATAAATTAAAGGATCTAGCTGCCACCCGAAAGCGCATTCTTGAGGCAGAATATAGCCAGATCAGAGAAATGATCGACAGAGATGAAAAAGAGGCCATGCTGGCAATTGATAAGGAACAAGAGAGAGGTCAGAGCAAACTTGTCTCCTTGATGAAGAAGTTTAATGAGAATATTGAGAAGATGGAAAGGACCAAGTGTGAGATCAACAGTCTGCTGGACCAGTCGCAATCACTCACATTTTTAAAGGCCTCCATAGATTTGCCCTCAGTGATAAATTTTGAGCCCTATAACCCACGCATGAATTTGGACAGTAAAGAGGTGATCGCTTACCACCCTTCTCGGGCTGGTA。

[0050] 4) siRNA Design and Synthesis

[0051] Based on the zebrafish trim25 gene sequence (NM_200175.1), three 21-nt siRNAs (Table 1) were designed with dTdT hangers at the 3' end. They were synthesized by Sangon Biotech (Shanghai) Co., Ltd., with HPLC purity ≥95%, and were RNase-free lyophilized powder, stored at −80 °C.

[0052] Table 1. Trim25 gene interference fragment .

[0053] 5) PAC2 cell resuscitation, culture, and passage

[0054] The experimental cells were the PAC2 zebrafish embryonic fibroblast cell line, cultured in Leibovitz's L-15 medium with 10% FBS and 1% antibiotics at 28 °C, CO2-free, and 70-80% humidity. PAC2 cells were purchased from the Shanghai Cell Bank (Jinyuan Biotechnology). Cell cryopreservation tubes were rapidly thawed in a 28 °C water bath and then transferred to culture dishes containing culture medium for 3-4 hours, during which cell growth was observed. Cells showing good growth were passaged to the third generation, and after the fourth generation, they were plated for subsequent experiments.

[0055] 6) siRNA transfection

[0056] First, add 1.25 μL of Hieff Trans® LipoBooster 3000 Transfection Reagent (Yeasen) to 25 μL of Opti-MEM medium and mix well. Next, premix 2.5 μL of siRNA (Sangon Biotech, 20 μM) in 25 μL of Opti-MEM medium and incubate with the LipoBooster 3000 premix for 10–15 min. A negative control (NC) with no homology to the target gene sequence is set up, which has no interference with trim25. After incubation, add the siRNA to fresh L15 complete medium and transfect into 24-well plates. Incubate at 28 °C for 24 h, then change the medium. After changing the medium, continue culturing for 24–48 h to harvest cells and extract total RNA (refer to step 1).

[0057] 7) Real-time PCR technology was used to detect the expression of the trim25 gene after interference.

[0058] All qRT-PCR experiments in this application used β-actin as an internal control, with primer pair P3 / P4. Based on the gene sequence, qRT-PCR primers P5 / P6 were designed using Primer 6 software. Primer pair P5 / P6 was used for the detection of the trim25 gene, with a fragment size of 134 bp.

[0059] According to TB Green ® Premix Ex Taq TM Prepare a mixed system using the II (Takara) kit, and set up three parallel samples for each experiment.

[0060] Table 2. Primers for semi-quantitative and qRT-PCR expression of the trim25 gene in zebrafish. .

[0061] Data analysis: The method for calculating the relative expression level of genes is 2. -ΔΔCt One-way ANOVA was performed using GraphPad Prism 9.0.0 software to determine differences in gene expression levels. Results are expressed as mean ± standard deviation (mean ± SD), and p < 0.05 was considered statistically significant. Significance levels were set as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001; "ns" indicates no significance.

[0062] Depend on Figure 1 and Figure 2 It can be seen that zebrafish PAC2 cells express the trim25 gene. After siRNA interference for 48-72 h, semi-quantitative and qRT-PCR detection showed that the target gene inhibition rate was 20-40%, which significantly reduced the expression level of trim25.

[0063] Example 2: Exogenous nucleic acid transfection

[0064] For PAC2 cell resuscitation, passage, and culture experiments, refer to Example 1. Three replicates were set up for each group in a 96-well plate. The reagents and dosages for each group were the optimal amounts determined through trial and error. For siRNA transfection of fish cells to inhibit trim25 gene expression, refer to step 6 of Example 1. When interfering with the 96-well plate, add 0.25 μL of LipBooster 3000 to 5 μL of Opti-MEM medium, and add 0.5 μL of siRNA (20 μM) to 5 μL of Opti-MEM medium.

[0065] After 48 hours of interference, eGFP was transfected using Hieff Trans® Liposomal 2000 Transfection Reagent and Hieff Trans® mRNA Transfection Reagent.

[0066] a) Lip2000 transfection: Add 0.5 μL of Lipofectamine 2000 to 25 μL of Opti-MEM medium and incubate for 5 min; add 0.5 μg of Cap1-m1Ψ-eGFP mRNA (Cap1-m1Ψ-eGFP mRNA purchased from Genscript Biotech, Cap1 structure capped, N1-m1Ψ modified, concentration 1 mg / mL, buffer 1 mM Sodium citrate, pH 6.5, full-length mRNA 1007 nt) or peGFP-N1 plasmid (purchased from Ubisoft Biotech) to 25 μL of Opti-MEM medium and incubate for 5 min; mix the liquids from the previous two steps and incubate for 20 min. After incubation, transfer to 96-well plates (96-well plates containing PAC2 cells that have been transfected with siRNA for 48 h and have had their trim25 gene suppressed) for transfection, change the medium after 24 h, and observe eGFP expression 36-48 h after transfection. PAC2 cells were transfected with non-targeted siRNA, and a negative control (NC) with no homology to the target gene sequence was set up, which had no interference with trim25.

[0067] b) mRNA transfection reagent transfection: Add 0.25 μL of mRNA transfection reagent to 5 μL Opti-MEM medium and incubate for 5 min; add 0.5 μg Cap1-m1Ψ-eGFP mRNA to 5 μL Opti-MEM medium and incubate for 5 min; mix the liquids from the previous two steps and incubate for 20 min. After incubation, transfer the mixture to a 96-well plate for transfection, change the medium after 24 h, and observe eGFP expression 36–48 h post-transfection.

[0068] Detection and Statistics:

[0069] Exogenous gene expression was detected by fluorescence microscopy 24–48 h after transfection. Transfection efficiency was calculated as the number of fluorescent cells divided by the total number of cells. Cell counts were performed using ImageJ software, with three replicates. One-way ANOVA was conducted using GraphPad Prism 9.0.0 software to assess differences. Results are expressed as mean ± standard deviation (mean ± SD), and p < 0.05 was considered statistically significant. Significance levels were set as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001; "ns" indicates no significance.

[0070] Table 3. Transfection efficiency of exogenous gene (eGFP) .

[0071] As shown in Table 3, the positive cell rate increased by 2.5 - 3.5 times after transfection of Cap1-m1Ψ-eGFP mRNA with the mRNA transfection reagent; the positive cell rate increased by 3.8 - 5 times after transfection of RNA with the liposome nucleic acid transfection reagent, and the positive cell rate increased by 1.8 - 2.4 times after transfection of eGFP-N1. The addition of the two transfection reagents has low cytotoxicity to cells and is judged to be qualified.

[0072] From Figure 3 , Figure 4 and Figure 5 it can be seen that after knockdown of trim25, the positive rate of plasmid DNA transfection increased by 2.4 times, and the positive cells of exogenous mRNA increased by up to 5 times, achieving a maximum transient expression of 81% in PAC2 cells for the first time.

[0073] The above is only a preferred embodiment of the present invention, and it does not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to equivalent embodiments by using the disclosed technical content within the scope of the technical solution of the present invention. However, as long as it does not depart from the content of the technical solution of the present invention, any brief modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. trim25 The application of genes in improving fish cell transfection efficiency is characterized by: The trim25 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 1; The method to improve fish cell transfection efficiency is to knock down fish cells. trim25 Gene expression and targeted design trim25 The siRNA interference fragment of the gene is transfected into fish cells; the siRNA is at least one of the SEQ ID Nos. 5-7; the transfection method is liposome nucleic acid transfection; the fish cells are zebrafish (Danio rerio) cells.

2. The application according to claim 1, characterized in that: Zebrafish (Danio rerio) cells are zebrafish embryonic fibroblasts PAC2.

3. A method for improving the transfection efficiency of fish cells, characterized in that: By knocking down fish cells trim25 Gene expression and targeted design trim25 The gene contains an siRNA interference fragment, which is transfected into fish cells; the siRNA is at least one of SEQ ID Nos. 5-7; the transfection method is liposome nucleic acid transfection; the fish cells are zebrafish (Danio rerio) cells; trim25 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

1.

4. The method according to claim 3, characterized in that: The trim25 The gene has a nucleotide sequence as shown in NCBI number NM_200175.

1.

5. A method for transfecting exogenous genes into fish cells, characterized in that: The steps include: designing targets trim25 The siRNA interference fragment of the gene was transfected into fish cells to obtain... trim25 Cells with low gene expression; transfection of exogenous nucleic acids into trim25 In cells with low gene expression; the siRNA is at least one of SEQ ID Nos. 5-7; the transfection method is liposome nucleic acid transfection; the fish cells are zebrafish (Danio rerio) cells; trim25 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 1.

Images