Cucumber pto-snrp molecular marker associated with pseudomonas recruitment and application thereof

By using SNP molecular markers related to cucumber recruitment of Pseudomonas and Pseudomonas agents, the problems of bacterial wilt and chemical pesticide pollution in cucumber were solved, significantly promoting cucumber growth and inhibiting pathogens, achieving a highly efficient and environmentally friendly biological control effect.

CN121380418BActive Publication Date: 2026-07-03INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511800496.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-02
Publication Date
2026-07-03
Estimated Expiration
2045-12-02

Smart Images

  • Figure CN121380418B_ABST
    Figure CN121380418B_ABST
Patent Text Reader

Abstract

This invention provides a SNP molecular marker related to Pseudomonas recruitment in cucumber and its application, belonging to the field of microbial technology. The SNP molecular marker is closely related to the enrichment of Pseudomonas in cucumber. Haplotype cucumbers with the SNP molecular marker CCA recruit Pseudomonas more efficiently than haplotype cucumbers with the SNP molecular marker TTG, increasing the abundance of Pseudomonas in the xylem. This invention further demonstrates that by applying a *Pseudomonas chrysogenum* inoculant to different haplotype cucumbers, the *Pseudomonas chrysogenum* inoculant significantly increases the number of *Pseudomonas chrysogenum* in haplotype cucumbers with the SNP molecular marker CCA, more significantly promoting cucumber growth and increasing plant height, stem diameter, leaf area, fresh weight, dry weight, and the content of 4-methylene glutamine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a SNP molecular marker related to the recruitment of cucumber and Pseudomonas aeruginosa and its application. Background Technology

[0002] A large number of beneficial microorganisms, collectively known as plant growth-promoting bacteria (PGPRs), exist in the rhizosphere and internal tissues (such as xylem) of plants. These microorganisms can promote plant growth through various mechanisms, including nitrogen fixation, phosphorus solubilization, siderophore production, and plant hormone production (such as indole-3-acetic acid, IAA). They can also inhibit plant pathogens by producing antimicrobial substances or inducing systemic resistance. Bacterial wilt of cucumber is caused by Ralstonia solanacearum (Ralstonia solanacearum). Ralstonia solanacearum This disease, caused by chemical pesticides, is a serious vascular bundle disease that results in significant losses for cucumber production. Currently, the overuse of chemical pesticides leads to environmental pollution and pesticide resistance in pathogens. Therefore, developing efficient and environmentally friendly biological control and growth-promoting strains is of great importance.

[0003] The xylem, as a crucial channel for water and nutrient transport in plants, likely harbors core microorganisms that play a vital role in plant health. However, the resources of xylem endophytic bacteria with clearly defined growth-promoting and biocontrol functions remain to be explored. Furthermore, the effects of different cucumber germplasms on the efficacy of microbial inoculants have not yet been reported. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a SNP molecular marker related to the recruitment of cucumber by Pseudomonas aeruginosa and a Pseudomonas aeruginosa agent that interacts with it; the SNP molecular marker is closely related to the enrichment of cucumber by Pseudomonas aeruginosa; the Pseudomonas aeruginosa agent has completely different effects on haplotype plants with different SNP molecular markers, and can significantly promote the growth of cucumber with the SNP molecular marker CCA.

[0005] The objective of this invention is achieved through the following technical solution:

[0006] This invention provides a SNP molecular marker associated with cucumber recruitment by Pseudomonas aeruginosa. The SNP molecular marker includes Chr3_24847315, Chr3_24847328, and Chr3_24847344 on cucumber chromosome 3. Chr3_24847315 is located at 51 bp of SEQ ID NO.1; Chr3_24847328 is located at 64 bp of SEQ ID NO.1; Chr3_24847344 is located at 80 bp of SEQ ID NO.1; the polymorphism of Chr3_24847315 is T / C; the polymorphism of Chr3_24847328 is T / C; and the polymorphism of Chr3_24847344 is G / A.

[0007] Preferably, the abundance of Pseudomonas in cucumber xylem is increased when the SNP molecular marker sequence is CCA; the abundance of Pseudomonas in cucumber xylem is decreased when the SNP molecular marker sequence is TTG.

[0008] Preferably, the pseudomonad includes *Pseudomonas aeruginosa* ivf-220.

[0009] This invention provides the application of the SNP molecular markers described in the above technical solution in the analysis of genetic diversity and / or assisted selection breeding of cucumber.

[0010] This invention provides a Pseudomonas agent that interacts with the SNP molecular markers described in the above-mentioned technical solutions, wherein the Pseudomonas agent includes *Pseudomonas aeruginosa* (…). Pseudomonas fulva The preservation number of the *Pseudomonas aeruginosa* ivf-220 is CGMCC No. 36162.

[0011] This invention provides a microbial preparation comprising the Pseudomonas agent described in the above technical solution.

[0012] This invention provides a method for preparing the microbial preparation described in the above technical solution, comprising:

[0013] The Pseudomonas agent is cultured in a culture medium to obtain a microbial preparation.

[0014] This invention provides the application of the Pseudomonas agent described in the above-mentioned technical solution, the microbial preparation described in the above-mentioned technical solution, or the microbial preparation obtained by the preparation method described in the above-mentioned technical solution in the preparation of preparations for inhibiting plant pathogens; the plant pathogens include Ralstonia solanacearum.

[0015] This invention provides the application of the Pseudomonas agent described in the above-mentioned technical solution, the microbial preparation described in the above-mentioned technical solution, or the microbial preparation prepared by the preparation method described in the above-mentioned technical solution in promoting cucumber growth; the cucumber includes cucumbers with the SNP molecular marker CCA as described in the above-mentioned technical solution.

[0016] This invention provides the application of the Pseudomonas agent described in the above-mentioned technical solution, the microbial preparation described in the above-mentioned technical solution, or the microbial preparation prepared by the preparation method described in the above-mentioned technical solution in increasing the 4-methylene glutamine content in cucumber; the cucumber includes cucumbers with the SNP molecular marker CCA described in the above-mentioned technical solution.

[0017] The beneficial effects of this invention are:

[0018] This invention provides SNP molecular markers associated with cucumber recruitment of Pseudomonas aeruginosa. The SNP molecular markers include Chr3_24847315, Chr3_24847328, and Chr3_24847344 on cucumber chromosome 3. Chr3_24847315 is located at 51 bp of SEQ ID NO. 1; Chr3_24847328 is located at 64 bp of SEQ ID NO. 1; and Chr3_24847344 is located at 80 bp of SEQ ID NO. 1. The polymorphism of Chr3_24847315 is T / C; the polymorphism of Chr3_24847328 is T / C; and the polymorphism of Chr3_24847344 is G / A. In this invention, the SNP molecular markers are closely related to the enrichment of Pseudomonas aeruginosa in cucumber. The haplotype cucumber with the SNP molecular marker CCA recruits Pseudomonas bacteria more efficiently and increases the abundance of Pseudomonas bacteria in the xylem compared to the haplotype cucumber with the SNP molecular marker TTG. This invention, by applying a *Pseudomonas chrysogenum* inoculant to different haplotype cucumbers, shows that the *Pseudomonas chrysogenum* inoculant significantly increases the number of *Pseudomonas chrysogenum* in haplotype cucumbers with the SNP molecular marker CCA, more significantly promoting cucumber growth and increasing plant height, stem diameter, leaf area, fresh weight, dry weight, and the content of 4-methylene glutamine; while the *Pseudomonas chrysogenum* inoculant has no significant effect on improving the growth of haplotype cucumbers with the SNP molecular marker TTG.

[0019] Biological Preservation Information

[0020] Pseudomonas aeruginosa IVF-220, Latin scientific name Pseudomonas fulva It was deposited on October 13, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 36162. Attached Figure Description

[0021] Figure 1 for Pseudomonas Relative abundance plot of _ASV4 in different haplotypes;

[0022] Figure 2 Gene structure diagrams and functional annotation diagrams of three genes located within 15 kb upstream and downstream of a significant SNP (Chr3_24 847 328);

[0023] Figure 3 The results of the stem transcriptome for 3 genes are shown in the figure.

[0024] Figure 4 A genome-wide maximum likelihood phylogenetic tree of strain ivf-220 based on 92 core genes;

[0025] Figure 5 The graph shows the mean nucleotide similarity (ANI) values ​​between strain ivf-220 and its most similar type strain.

[0026] Figure 6 A circular diagram of the genome of strain ivf-220;

[0027] Figure 7 The graph shows the results of the phosphorus-solubilizing ability of strain ivf-220 to inorganic phosphorus.

[0028] Figure 8 The graph shows the results of the phosphorus-solubilizing ability of strain ivf-220 to organophosphates.

[0029] Figure 9 The graph shows the results of the siderophore production capacity assay for strain ivf-220.

[0030] Figure 10 The graph shows the results of ammonium production capacity determination for strain ivf-220;

[0031] Figure 11 The image shows the antagonistic effect of strain ivf-220 on Ralstonia solanacearum.

[0032] Figure 12 Photographs showing the effects of strain ivf-220 on the growth of cucumber varieties with the Hap1 (TTG) genotype;

[0033] Figure 13 Figure showing the effect of strain ivf-220 on the plant height of cucumber varieties with the Hap1 (TTG) genotype;

[0034] Figure 14 Figure showing the effect of strain ivf-220 on stem diameter of cucumber varieties with the Hap1 (TTG) genotype;

[0035] Figure 15Figure showing the effect of strain ivf-220 on leaf area of ​​cucumber varieties with the Hap1 (TTG) genotype;

[0036] Figure 16 Figure showing the effect of strain ivf-220 on the fresh weight of cucumber varieties with the Hap1 (TTG) genotype;

[0037] Figure 17 Figure showing the effect of strain ivf-220 on the dry weight of cucumber varieties with the Hap1 (TTG) genotype;

[0038] Figure 18 The figure shows the effect of strain ivf-220 on the relative content of 4-methylene glutamine in cucumber cultivars with the Hap1 (TTG) genotype.

[0039] Figure 19 Photographs showing the effects of strain ivf-220 on the growth of cucumber varieties with the Hap2 (CCA) genotype;

[0040] Figure 20 Figure showing the effect of strain ivf-220 on the plant height of cucumber varieties with the Hap2 (CCA) genotype;

[0041] Figure 21 Figure showing the effect of strain ivf-220 on stem diameter of cucumber varieties with the Hap2 (CCA) genotype;

[0042] Figure 22 Figure showing the effect of strain ivf-220 on leaf area of ​​cucumber varieties with the Hap2 (CCA) genotype;

[0043] Figure 23 Figure showing the effect of strain ivf-220 on the fresh weight of cucumber varieties with the Hap2 (CCA) genotype;

[0044] Figure 24 The figure shows the effect of strain ivf-220 on the dry weight of cucumber varieties with the Hap2 (CCA) genotype.

[0045] Figure 25 The figure shows the effect of strain ivf-220 on the relative content of 4-methylene glutamine in cucumber cultivar Hap2 (CCA);

[0046] Figure 26 This image shows the observation results of strain ivf-220 colonizing the xylem of cucumber. Detailed Implementation

[0047] This invention provides a SNP molecular marker associated with cucumber recruitment by Pseudomonas aeruginosa. The SNP molecular marker includes Chr3_24847315, Chr3_24847328, and Chr3_24847344 on cucumber chromosome 3. Chr3_24847315 is located at 51 bp of SEQ ID NO.1; Chr3_24847328 is located at 64 bp of SEQ ID NO.1; Chr3_24847344 is located at 80 bp of SEQ ID NO.1; the polymorphism of Chr3_24847315 is T / C; the polymorphism of Chr3_24847328 is T / C; and the polymorphism of Chr3_24847344 is G / A. As an optional embodiment of the present invention, the abundance of Pseudomonas in cucumber xylem is increased when the SNP molecular marker sequence is CCA; the abundance of Pseudomonas in cucumber xylem is decreased when the SNP molecular marker sequence is TTG. As an optional embodiment of the present invention, the Pseudomonas includes *Pseudomonas chrysogenum* ivf-220.

[0048] This invention provides the application of the SNP molecular markers described in the above-mentioned technical solution in cucumber genetic diversity analysis and / or assisted selection breeding. The SNP molecular markers provided by this invention can identify the enrichment of Pseudomonas in the xylem of cucumber. When the SNP molecular marker in cucumber germplasm is CCA, the cucumber germplasm can better enrich Pseudomonas, and the abundance of Pseudomonas in the xylem of the cucumber germplasm is high. Using *Pseudomonas chrysogenum* ivf-220 on cucumber germplasm with the SNP molecular marker CCA can significantly promote the growth of the cucumber germplasm and increase the content of 4-methylene glutamine in the cucumber germplasm. When the SNP molecular marker in cucumber germplasm is TTG, the cucumber germplasm has a lower ability to enrich Pseudomonas, and the abundance of Pseudomonas in the xylem of the cucumber seeds is low. Using *Pseudomonas chrysogenum* ivf-220 on cucumber germplasm with the SNP molecular marker TTG cannot significantly promote the growth of the cucumber germplasm, nor can it significantly increase the content of 4-methylene glutamine in the cucumber germplasm. The SNP molecular markers described in this invention can be used to screen and / or cultivate cucumber germplasm with the SNP molecular marker CCA, thereby enabling it to better act on the corresponding cucumber when Pseudomonas aeruginosa ivf-220 is applied.

[0049] This invention provides a Pseudomonas agent that interacts with the SNP molecular markers described in the above-mentioned technical solutions, wherein the Pseudomonas agent includes *Pseudomonas aeruginosa* (…). Pseudomonas fulva The preservation number of the *Pseudomonas aeruginosa* ivf-220 is CGMCC No. 36162.

[0050] The *Pseudomonas aeruginosa* ivf-220 provided by this invention was isolated from cucumber xylem sap. The nucleotide sequence of the 16S rDNA of *P. aeruginosa* ivf-220 is shown in SEQ ID NO.2. The genome size of *P. aeruginosa* ivf-220 is 5,126,730 bp, with a GC content of 61.42%, encoding 4,807 predicted genes. Functional annotation analysis of the *P. aeruginosa* ivf-220 genes shows that the genome contains genes related to indole-3-acetic acid (IAA) biosynthesis, proteases, cellulases, β-galactosidase, and amylase, as well as gene clusters involved in phosphorus solubilization and nitrogen metabolism. Experimental testing revealed that *P. aeruginosa* ivf-220 possesses the ability to dissolve organic and inorganic phosphorus, produce siderophores and ammonium, secrete IAA, and inhibit the growth of *Ralstonia solanacearum*.

[0051] The *Pseudomonas aeruginosa* ivf-220 provided by this invention can colonize the xylem of cucumber and act on it. It specifically promotes the growth of cucumber by increasing the content of nitrogen carriers and 4-methylene glutamine in the xylem sap of haplotype cucumber germplasm with the SNP molecular marker CCA. The growth-promoting effect of strain ivf-220 on cucumber varieties is genotype-dependent. The results of the embodiments of this invention show that *Pseudomonas aeruginosa* ivf-220, by acting on the Hap2 cucumber variety with the SNP molecular marker CCA, promotes the growth of the Hap2 cucumber variety, significantly increasing plant height, stem diameter, leaf area, fresh weight, dry weight, and the content of 4-methylene glutamine. However, *Pseudomonas aeruginosa* ivf-220 has no significant effect on the growth of the Hap1 genotype cucumber variety with the SNP molecular marker TTG, nor does it significantly increase the content of 4-methylene glutamine in cucumber.

[0052] This invention provides a microbial preparation comprising the *Pseudomonas aeruginosa* agent described in the above-mentioned technical solution. As an optional embodiment of this invention, the viable count of *Pseudomonas aeruginosa* ivf-220 in the microbial preparation is ≥1×10⁻⁶. 8 CFU / mL.

[0053] This invention provides a method for preparing the microbial preparation described in the above-mentioned technical solution, comprising: culturing the *Pseudomonas aeruginosa* agent in a culture medium to obtain the microbial preparation. As an optional embodiment of this invention, the culture medium includes LB medium; the culture temperature can be 28-30°C, or 28, 29, or 30°C. As an optional embodiment of this invention, the culture process can be accompanied by shaking, and the shaking speed can be 220 rpm. As an optional embodiment of this invention, the culture can be overnight; the overnight culture time can be 12-18 hours, or 12, 13, 14, 15, 16, 17, or 18 hours. After the culture is completed, this invention obtains a culture medium. As an optional embodiment of this invention, the culture medium can be directly used as a microbial preparation. As another optional embodiment of this invention, the bacterial cells in the culture medium can also be separated and resuspended to obtain a *Pseudomonas aeruginosa* ivf-220 bacterial suspension. After obtaining the *Pseudomonas aeruginosa* ivf-220 bacterial suspension, this invention can directly use the *Pseudomonas aeruginosa* ivf-220 bacterial suspension as a microbial preparation.

[0054] This invention provides the application of the *Pseudomonas aeruginosa* agent described in the above-described technical solutions, the microbial preparations described in the above-described technical solutions, or the microbial preparations obtained by the preparation methods described in the above-described technical solutions in the preparation of agents to inhibit plant pathogens. As an optional embodiment of this invention, the plant pathogen includes *Ralstonia solanacearum*. The results of the embodiments of this invention show that *Pseudomonas aeruginosa* ivf-220 can significantly inhibit the growth of *Ralstonia solanacearum*.

[0055] This invention provides the application of the *Pseudomonas aeruginosa* agent, the microbial preparation described in the above-described technical solutions, or the microbial preparation obtained by the preparation method described in the above-described technical solutions in promoting cucumber growth. As an optional embodiment of this invention, the cucumber includes cucumber varieties with the SNP molecular marker CCA. The results of the embodiments of this invention show that *Pseudomonas aeruginosa* ivf-220 can significantly increase the plant height, stem diameter, and fresh weight of cucumber seedlings with the SNP molecular marker CCA compared to the control group, thereby better promoting cucumber seedling growth.

[0056] This invention provides the application of the *Pseudomonas* agent described in the above-described technical solutions, the microbial preparations described in the above-described technical solutions, or the microbial preparations prepared by the preparation methods described in the above-described technical solutions in the control of bacterial wilt of plants. As an optional embodiment of this invention, the bacterial wilt of plants includes cucumber bacterial wilt.

[0057] This invention provides the application of the Pseudomonas agent described in the above technical solution, the microbial preparation described in the above technical solution, or the microbial preparation prepared by the preparation method described in the above technical solution in increasing the 4-methylene glutamine content in cucumber; the cucumber includes cucumber varieties with the SNP molecular marker CCA.

[0058] This invention provides a method for promoting cucumber growth, comprising: applying a microbial preparation containing *Pseudomonas aeruginosa* ivf-220 during the growth of a cucumber variety with the SNP molecular marker CCA. This invention does not specifically limit the timing of the application; any timing conventionally used in the art is acceptable. As an optional embodiment of this invention, the application can be performed during the seedling stage. This invention does not specifically limit the method of application; any conventional method conventionally used in the art is acceptable. As an optional embodiment of this invention, the application method can be root irrigation and / or foliar spraying.

[0059] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0060] The strain ivf-220 mentioned in the following instructions and accompanying diagrams may also be referred to as strain 220 or simply 220.

[0061] Example 1

[0062] Different cucumber varieties (see Table 1 for specific variety information) were planted, and during the vigorous growth period of the cucumbers, stem tissues of different varieties were collected, and xylem sap was obtained. Total DNA was extracted from the cucumber xylem sap, and genotype data were obtained using amplicon sequencing for genome-wide association analysis (GWAS).

[0063] Table 1 Information on 109 different cucumber germplasms

[0064]

[0065] Note: For detailed germplasm information in Table 1, please refer to the reference Qi J, Liu X, Shen D, Miao H, Xie B, Li X, et al. A genomic variation map provides insights into the genetic basis of cucumber domestication and diversity. Nature genetics. 2013;45(12):1510-5.

[0066] GWAS results showed that only one genetic signal significantly associated with the core Pseudomonas_ASV4 (16S rDNA V4 region) was detected on chromosome 3. Furthermore, the relative abundance of Pseudomonas_ASV4 varied across different xylem types, suggesting that its accumulation may be regulated by genetic factors.

[0067] To further analyze the genetic loci associated with the target trait, this study employed linkage disequilibrium (LD) analysis to perform detailed LDblock analysis on the genomic regions containing significantly associated loci. The LD values ​​(RL) between SNPs were calculated. 2 ), identified 3 consecutive SNP sites (R 2 =0.99), these sites showed high linkage disequilibrium, and the three consecutive SNP sites were Chr3_24847315, Chr3_24847328, and Chr3_24847344. Among them, Chr3_24847315 is located at 51 bp of SEQ ID NO.1; Chr3_24847328 is located at 64 bp of SEQ ID NO.1; and Chr3_24847344 is located at 80 bp of SEQ ID NO.1. SEQ ID NO.1 is the sequence of 24847265-24847394 bp on chromosome 3 (i.e., the sequence of 24847265-24847394 bp of Cucumber (Chinese Long) v3 Genome chr3, see: http: / / www.cucurbitgenomics.org / blast / report / 606432).

[0068] SEQ ID NO. 1: CATCAAATTTAATACATTTTACTAACGTCATATATTACATATACTTATCATAAATCTTTGGTTTTAAAATACACACCATGACTGAAACTTATACTCATGAAACACAGCATTATTGATCTTAAATATTTAT.

[0069] The specific SNP molecular markers are shown in bold in SEQ ID NO.1.

[0070] Based on the results of LD block analysis, further haplotype analysis was performed on the three SNPs. The results showed that these germplasms were classified into three main haplotypes (e.g., ...). Figure 1TTG (Hap1, n=64), CCA (Hap2, n=11), and YYR (Hap3, n=6) are heterozygous types of Hap1 and Hap2. Analysis revealed that Hap1 was present in all four cucumber subgroups, while Hap2 was only present in cultivated cucumbers (East Asian and Eurasian types). This distribution pattern suggests that Hap2 may have differentiated during cultivation, while Hap1 was preserved in a broader genetic context. Statistically, the relative abundance of Pseudomonas_ASV4 showed a significant correlation with different haplotype types. Germplasm in Hap1 showed significantly lower Pseudomonas_ASV4 abundance compared to Hap2 (East Asian type: p = 0.012, Eurasian type: p = 0.026). This result indicates that Hap2 germplasm is more significantly enriched in Pseudomonas_ASV4.

[0071] To further explore candidate genes that regulate the accumulation of Pseudomonas_ASV4 in the xylem, a detailed search was conducted on genes within a 15 kb range upstream and downstream of the most significant SNP (Chr3_24 847 328) based on linkage disequilibrium (LD) decay in the genomic region containing the most significant signal. Combined with their functional annotations, candidate genes that may be involved in regulating the accumulation of this ASV were screened.

[0072] The results showed that within a 15 kb range upstream and downstream of the significant SNP (Chr3_24 847 328) (i.e., the sequence 24832328-24862328 bp of Cucumber(Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 606429 for details), there were 3 genes ( Figure 2The nucleotide sequence of CsaV3_3G028410 is shown below, encoding a subtilisin-like serine protease. These proteases belong to the serine hydrolase family and can hydrolyze proteins into small peptides. These peptides can act as signaling molecules or ligands, binding to receptors and participating in cell signal transduction. In plants, the subtilisin family (SBT) is widely involved in plant developmental regulation and environmental stress responses. The nucleotide sequence of CsaV3_3G028420 is shown below, encoding a Tetratricopeptide repeat (TPR)-like superfamily protein. TPR is a conserved protein domain, typically containing about 34 amino acids, forming a right-handed helical structure with amphiphilic channels. The main function of the TPR domain is as a module for protein-protein interactions, participating in various biological processes such as cell cycle regulation, gene expression, and protein degradation. In plants, TPR proteins often serve as scaffolds for the assembly of multi-protein complexes, participating in intracellular signal transduction and metabolic regulation. The nucleotide sequence of CsaV3_3G028430 is as follows, which encodes a xyloglucan galactosyltransferase belonging to the KATAMARI1 protein family. This protein plays a role in the endoplasmic reticulum and Golgi apparatus of plant cells, mainly involved in cell wall synthesis, regulation of cytoskeleton organization, and normal cell elongation and development.

[0073] CsaV3_3G028410 (i.e., the sequence 24844997~24842049bp of Cucumber (Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 607033 for details).

[0074] CsaV3_3G028420 (i.e., the sequence 24852569~24854245bp of Cucumber (Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 607032 for details).

[0075] CsaV3_3G028430 (i.e., the sequence 24857735~24854365bp of Cucumber (Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 607029 for details).

[0076] To further investigate the effects of Hap1 and Hap2 on gene expression levels, the expression levels of three genes near the SNP (Chr3_24 847 328) were quantitatively analyzed using stem transcriptome data. See details below. Figure 3 The results showed that only CsaV3_3G028420 exhibited significant expression differences between Hap1 and Hap2. The CsaV3_3G028420 gene was annotated as a tetratricopeptide repeat (TPR)-like superfamily protein. This protein has been shown to be involved in abiotic stress responses and hormone signaling. Considering that xylem is a major pathway for water transport in plants and is crucial for photosynthesis, it can be inferred that microorganisms in the xylem may interact with this gene.

[0077] The above results indicate that Hap1 exhibits lower CsaV3_3G028420 gene expression levels and Pseudomonas_ASV4 abundance, while Hap2 exhibits higher CsaV3_3G028420 gene expression levels and Pseudomonas_ASV abundance. Based on the frequencies of these two alleles in the Indian, Xishuangbanna, East Asian, and Eurasian subpopulations, it is speculated that during the domestication of cultivated cucumbers, the differentiation into the Hap2 haplotype upregulated CsaV3_3G028420 gene expression, resulting in a stronger ability of cucumbers to recruit Pseudomonas_ASV4.

[0078] Example 2

[0079] Isolation and identification of strains

[0080] Xylem sap sampling: Collect xylem sap from the stem of a healthy cucumber plant.

[0081] Bacterial isolation: Xylem sap samples were serially diluted and spread onto R2A, NA, and TSA agar plates, with three replicates for each dilution. The samples were incubated at 30°C for 5 days.

[0082] Purification and Preservation: Single colonies were selected based on colony morphology and purified using the three-strike method. The purified strain was stored at -80℃ in a medium containing 50% (v / v) glycerol to obtain strain ivf-220.

[0083] 16S rDNA gene identification: The 16S rDNA gene fragment of strain ivf-220 was amplified by PCR using universal primers 27F and 1492R. The PCR system used was the Phanta Max Master Mix kit P515, containing 1.25 µL of primer pair (10 µM) and 1.25 µL of genomic DNA. PCR program: 95℃ for 3 minutes; 95℃ for 15 seconds, 56℃ for 30 seconds, 72℃ for 90 seconds, 30 cycles; 72℃ for 5 minutes. Sequence alignment was performed using the BLAST algorithm after sequencing.

[0084] The nucleotide sequence of the 16S rDNA of strain ivf-220 is shown in SEQ ID NO.2, specifically:

[0085]

[0086] Core strain screening: The 16S rDNA gene V4 region of the isolated strains was compared with predefined core ASVs (operable taxonomic units) (using SnapGene software). Strains with sequence similarity ≥97% were identified as core strains and proceeded to further studies. The final strain obtained was ivf-220, which was identified as *Pseudomonas aeruginosa*. Pseudomonas fulva ).

[0087] Example 3

[0088] Whole genome sequencing and analysis of strain ivf-220

[0089] DNA extraction: Genomic DNA of the core strain was extracted using the TIANamp Bacteria DNA Kit.

[0090] Library construction and sequencing: Sequencing libraries were constructed using the Watchmaker DNA Library Prep Kit (PCR-free) and PE150 sequencing was performed on the Illumina NovaSeq X plus platform.

[0091] Genome assembly and annotation: After quality control of the raw data, de novo genome assembly was performed using SPAdes (v3.15.4) (removing contigs <300 bp in length). Gene prediction was performed using Prokka (v1.14.6), and functional annotation (GO, COG, KEGG) was performed using the eggNOG v5.0 database.

[0092] Phylogenetic and ANI analysis: Maximum likelihood phylogenetic trees were constructed using UBCG (v3.0) based on a set of 92 core genes. The mean nucleotide identity (ANI) between strains and model strains was calculated using FastANI (v1.32).

[0093] A genome-wide maximum likelihood phylogenetic tree based on 92 core genes is shown below. Figure 4 As shown; the average nucleotide similarity (ANI) value between strain ivf-220 and the most similar type strain is as follows. Figure 5 As shown; the genome circle diagram of strain ivf-220 is as follows. Figure 6 As shown. The complete genome sequence of strain ivf-220 has been submitted to the National Genome Science Data Center, accession number: CRA02506.

[0094] This invention identifies the core strain ivf-220 isolated from cucumber xylem sap as *Pseudomonas aeruginosa* through whole-genome phylogenetic analysis and average nucleotide similarity (ANI) score. Pseudomonas fulva The genome size of this strain is 5,126,730 bp, with a GC content of 61.42%, encoding 4,807 predicted genes.

[0095] Functional annotation analysis revealed that the genome of strain ivf-220 contains genes associated with indole-3-acetic acid (IAA) biosynthesis, proteases, cellulases, β-galactosidase, and amylase, as well as gene clusters involved in phosphorus solubilization and nitrogen metabolism. Figure 6 ).

[0096] Example 4

[0097] Determination of in vitro plant growth-promoting and antagonistic characteristics of strain IVF-220

[0098] 1. Ammonia production capacity determination: Inoculate strain ivf-220 into LB medium and culture at 28℃ and 200 rpm for 2 days with shaking. Take 200 µL of culture supernatant into a white porcelain plate, add 3 drops of Nessler's reagent, and the appearance of a yellow or brownish-red precipitate indicates positive ammonia production.

[0099] 2. Phosphate-solubilizing ability determination: The determination was performed using NBRIP medium according to Nautiyal's method, observing the clear zone around the colony. The specific steps are as follows: Inoculate strain ivf-220 into LB liquid medium and incubate at 28℃ and 200 rpm for 2 days with shaking. Collect the bacterial cells to prepare a bacterial suspension, adjusting the concentration to an OD600 value of 0.1. Pipette 10 µL of the adjusted bacterial suspension into the center of an NBRIP solid medium plate. Invert the inoculated plate and place it in a constant temperature incubator, statically culturing the strain at 28℃ for 3–4 days. Observe whether a clear zone forms around the colony to determine the phosphate-solubilizing ability of strain ivf-220 for inorganic phosphorus.

[0100] Strain strain ivf-220 was inoculated into LB liquid medium and cultured at 28°C and 200 rpm for 2 days with shaking. The bacterial cells were collected and a bacterial suspension was prepared, with the concentration adjusted to an OD600 value of 0.1. 10 µL of the adjusted bacterial suspension was added dropwise to the center of a Monkina solid medium plate. The inoculated plate was inverted and placed in a constant temperature incubator, where the strain was statically cultured at 28°C for 3–4 days. The presence or absence of a clear zone around the colonies was observed to determine the phosphorus-soluble capacity of strain ivf-220 for organophosphates.

[0101] 3. Siderophore production capacity determination: The determination was performed using Chromium Azure S (CAS) blue agar plates according to the method of Schwyn and Neilands, observing the orange halo around the colonies. The specific steps are as follows: Inoculate strain ivf-220 into LB liquid medium and incubate at 28℃ and 200 rpm for 2 days with shaking. Collect the bacterial cells to prepare a bacterial suspension, adjusting the bacterial concentration to an OD600 value of 0.1. Use an inoculation loop to pick up a small amount of the bacterial suspension and spot it onto the surface of a CAS blue agar plate. After incubation for 3-4 days, observe the color change of the medium around the colonies.

[0102] 4. Antagonism experiment: 5 mL of Ralstonia solanacearum grown to the stationary phase was tested. Ralstonia solanacearum Mix the bacterial suspension with 45 mL of pre-melted and cooled NA medium to 50°C, then pour the mixture onto a plate. Add 5 mL of the culture of the test strain ivf-220, grown to the stationary phase, to the center of the plate. After incubating at 28°C for 3 days, measure the diameter of the inhibition zone.

[0103] All of the above experiments were repeated three times.

[0104] 5. Results

[0105] The results of the phosphorus-solubilizing ability of strain ivf-220 for inorganic phosphorus are as follows: Figure 7 As shown; the results of the phosphorus-solubilizing ability test of strain ivf-220 for organophosphates are as follows. Figure 8 As shown; the results of the siderophore production capacity assay for strain ivf-220 are as follows. Figure 9 As shown; the results of the ammonium production capacity test of strain ivf-220 are as follows. Figure 10 As shown; the antagonistic effect of strain ivf-220 against Ralstonia solanacearum is as follows: Figure 11 As shown.

[0106] Strain ivf-220 showed positive results in all the above tests, indicating that it possesses the ability to solubilize both organic and inorganic phosphorus, produces siderophores, exhibits ammonium production capabilities, and effectively inhibits Ralstonia solanacearum, with an inhibition zone diameter of 2.07 ± 0.12 cm. These results suggest that this strain, as a core member of the xylem flora, has potential plant growth-promoting properties.

[0107] Example 5

[0108] Cucumber seedling inoculation growth promotion experiment

[0109] Cucumber growth promotion experiments were conducted using cucumber varieties NK1 (germplasm number CG5539) with Hap1 (TTG) genotype and NK60 (germplasm number CG1083) with Hap2 (CCA) genotype.

[0110] Preparation of bacterial suspension: Incubate strain ivf-220 overnight in LB broth at 30°C and 220 rpm with shaking. Collect bacterial cells by centrifugation, resuspend in sterile deionized water, and adjust OD. 600 Up to 0.2 (approximately 2 × 10⁻⁶) 8 CFU / mL), respectively, to prepare bacterial suspensions of strain ivf-220.

[0111] Seed treatment: After removing the shells from cucumber seeds, soak them in 75% ethanol for 15 seconds, then rinse them three times with sterile water; next, disinfect them with a sodium hypochlorite solution containing approximately 1.6% available chlorine for 15 minutes, followed by rinsing them five times with sterile water for 5 minutes each time. Use the final rinse water to coat a test plate to confirm surface sterility.

[0112] Sowing and inoculation: After germination on MS medium, sterilized seeds were transplanted into plastic pots containing a mixture of sterilized nutrient soil and vermiculite. An uninoculated control and an inoculated strain ivf-220 treatment were included. Inoculation method: root drenching: 200 mL of bacterial suspension (OD600=0.2) was applied to each seedling.

[0113] Cultivation and Measurement: Seedlings were cultivated under controlled greenhouse conditions (30℃ day / 25℃ night; 16 hours light / 8 hours darkness). Two weeks after inoculation, plant height, stem diameter, leaf area, fresh weight, and dry weight were measured. The content of 4-methylene glutamine in cucumber xylem sap was determined by mass spectrometry.

[0114] The results are as follows Figures 12-25 As shown. Figure 12 Photographs showing the effects of strain ivf-220 on the growth of cucumber varieties with the Hap1 (TTG) genotype; Figure 13 Figure showing the effect of strain ivf-220 on the plant height of cucumber varieties with the Hap1 (TTG) genotype; Figure 14 Figure showing the effect of strain ivf-220 on stem diameter of cucumber varieties with the Hap1 (TTG) genotype; Figure 15 Figure showing the effect of strain ivf-220 on leaf area of ​​cucumber varieties with the Hap1 (TTG) genotype; Figure 16 Figure showing the effect of strain ivf-220 on the fresh weight of cucumber varieties with the Hap1 (TTG) genotype; Figure 17 Figure showing the effect of strain ivf-220 on the dry weight of cucumber varieties with the Hap1 (TTG) genotype; Figure 18 The figure shows the effect of strain ivf-220 on the relative content of 4-methylene glutamine in cucumber cultivars with the Hap1 (TTG) genotype. Figure 19 Photographs showing the effects of strain ivf-220 on the growth of cucumber varieties with the Hap2 (CCA) genotype; Figure 20 Figure showing the effect of strain ivf-220 on the plant height of cucumber varieties with the Hap2 (CCA) genotype; Figure 21Figure showing the effect of strain ivf-220 on stem diameter of cucumber varieties with the Hap2 (CCA) genotype; Figure 22 Figure showing the effect of strain ivf-220 on leaf area of ​​cucumber varieties with the Hap2 (CCA) genotype; Figure 23 Figure showing the effect of strain ivf-220 on the fresh weight of cucumber varieties with the Hap2 (CCA) genotype; Figure 24 The figure shows the effect of strain ivf-220 on the dry weight of cucumber varieties with the Hap2 (CCA) genotype. Figure 25 The figure shows the effect of strain ivf-220 on the relative content of 4-methylene glutamine in cucumber variety with Hap2 (CCA) genotype.

[0115] Depend on Figures 12-25 The results showed that strain ivf-220 significantly promoted the growth of Hap2 (CCA) genotype cucumber varieties, increasing plant height, stem diameter, leaf area, fresh weight, and dry weight. It also significantly increased the content of 4-methylene glutamine in cucumbers. However, strain ivf-220 had no significant effect on the growth of Hap1 (TTG) genotype cucumber varieties, nor did it significantly increase the content of 4-methylene glutamine. This indicates that strain ivf-220 only has a significant growth-promoting effect on Hap2 (CCA) genotype cucumber varieties, suggesting that strain ivf-220 specifically promotes nitrogen carriers in the xylem sap of a haplotype cucumber germplasm (NK60), and the increased content of 4-methylene glutamine further promotes cucumber growth. Therefore, the growth-promoting effect of strain ivf-220 on cucumber varieties is genotype-dependent.

[0116] Example 6

[0117] Verification of xylem colonization of GFP-labeled strains

[0118] GFP labeling: The donor plasmid pBBRMCS2-GFP-Km was introduced into strain ivf-220 via triparental conjugation using the helper plasmid pRK600 to obtain a GFP-labeled strain.

[0119] For detailed information on pBBRMCS2-GFP-Km, please refer to "A genetic tool for production of GFP-expressing Rhodopseudomonas palustris for visualization of bacterial colonization".

[0120] Inoculation and Sampling: Cucumber seedlings of the Hap2 (CCA) genotype cucumber variety NK60 (germplasm number CG1083) were inoculated with a GFP-labeled bacterial suspension of strain ivf-220 (the preparation method of strain ivf-220 was the same as in Example 5, and the viable count of strain ivf-220 was 10). 7 Soak in a solution of CFU / mL for 20 minutes. After transplanting, apply 50 mL of 10% CFU / mL solution to the soil around the plant once a week. 7 CFU / mL strain ivf-220 bacterial suspension. Three weeks after inoculation, xylem sap was collected from surface-sterilized plants.

[0121] Microscopic observation: The GFP fluorescence signal in the xylem sap samples was observed using a Leica TCS SP8 confocal laser scanning microscope.

[0122] The results are as follows Figure 26 As shown in the figure. The results indicate that confocal microscopy revealed that the GFP-labeled strain ivf-220 colonized the xylem sap of cucumber (green fluorescence). Strong GFP fluorescence was observed in the xylem sap of the inoculated group, confirming that strain ivf-220 can endogeneously colonize the xylem of cucumber.

[0123] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of a cucumber SNP molecular marker in screening cucumber (Cucumis sativus L.) with promoting effect of Pseudomonas cullorum (Pc) ivf-220, the SNP molecular marker comprising site one, site two and site three on chromosome 3 of cucumber; the site one is located at 51 bp of SEQ ID NO. 1; the site two is located at 64 bp of SEQ ID NO. 1; the site three is located at 80 bp of SEQ ID NO. 1; the polymorphism of the site one is T / C; the polymorphism of the site two is T / C; the polymorphism of the site three is G / A. Pseudomonas fulva ) The preservation number of the *Pseudomonas aeruginosa* ivf-220 is CGMCC No. 36162; The *Pseudomonas aeruginosa* ivf-220 can promote the growth of Hap2 haplotype cucumber with the SNP molecular marker sequence CCA; The *Pseudomonas aeruginosa* ivf-220 could not promote the growth of Hap1 haplotype cucumber with the SNP molecular marker sequence TTG.

2. Application of *Pseudomonas aeruginosa* ivf-220 in promoting cucumber growth; the cucumber being a Hap2 haplotype with SNP molecular marker CCA; The SNP molecular markers include loci 1, loci 2, and loci 3 on cucumber chromosome 3; loci 1 is located at 51 bp of SEQ ID NO. 1; loci 2 is located at 64 bp of SEQ ID NO. 1; loci 3 is located at 80 bp of SEQ ID NO. 1; the polymorphism of loci 1 is T / C; the polymorphism of loci 2 is T / C; and the polymorphism of loci 3 is G / A. The preservation number of the *Pseudomonas aeruginosa* ivf-220 is CGMCC No. 36162.

3. Application of *Pseudomonas aeruginosa* ivf-220 in increasing the content of 4-methylene glutamine in cucumber; wherein the cucumber is a Hap2 haplotype cucumber with SNP molecular marker CCA; The SNP molecular markers include loci 1, loci 2, and loci 3 on cucumber chromosome 3; loci 1 is located at 51 bp of SEQ ID NO. 1; loci 2 is located at 64 bp of SEQ ID NO. 1; loci 3 is located at 80 bp of SEQ ID NO. 1; the polymorphism of loci 1 is T / C; the polymorphism of loci 2 is T / C; and the polymorphism of loci 3 is G / A. The preservation number of the *Pseudomonas aeruginosa* ivf-220 is CGMCC No. 36162.