Application of OPG033 sequence in detection or auxiliary detection of monkey pox type I virus

Abstract

The invention discloses an application of an OPG033 sequence in detection or auxiliary detection of a monkey pox type I virus. The nucleotide sequence of the OPG033 sequence is as shown in SEQ ID No. 1. Experiments prove that if the total DNA of the to-be-detected sample contains the OPG033 sequence, the to-be-detected sample contains the monkey pox type I virus, otherwise, the to-be-detected sample does not contain the monkey pox type I virus. The method is simple and convenient, not only is low in cost, but also is high in sensitivity and specificity, and has an important application value for detecting the monkey pox type I virus.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the OPG033 sequence in the detection or auxiliary detection of monkeypox type I virus. The nucleotide sequence of the OPG033 sequence is shown in SEQ ID No. 1. Background Technology

[0002] Monkeypox virus (MPXV) belongs to the genus Orthopoxvirus in the family Poxviridae and is the pathogen that causes monkeypox. The envelope structure of monkeypox virus allows it to survive for weeks to months on dry surfaces (such as clothing and bed sheets) and it is relatively resistant to low temperatures, but it is easily inactivated by common disinfectants (such as sodium hypochlorite and ethanol). Clinical manifestations of monkeypox range from mild symptoms to severe and even fatal ones. Among them, the non-branched monkeypox virus (Congo Basin branch, Clade I, i.e., monkeypox type I virus) has become a focus of global public health concern due to its high pathogenicity. Monkeypox type I virus is characterized by high pathogenicity, severe illness, and high mortality; after infection, patients often develop high fever (above 39°C), widespread and severe necrotic rashes (usually affecting the face, palms, and soles), and significant lymphadenopathy. More seriously, monkeypox type I virus easily causes serious complications such as encephalitis and corneal ulcers, with a mortality rate of up to 10%. In addition, monkeypox type I virus has a stronger ability to spread between humans, which can easily cause cluster outbreaks and community transmission, posing a serious threat to public health and safety.

[0003] Laboratory diagnosis of monkeypox primarily relies on nucleic acid detection, virus isolation (requiring a biosafety level 3 laboratory), and electron microscopy observation (brick-shaped enveloped virus particles). Serological tests (such as ELISA for IgM / IgG antibodies) have limited specificity due to cross-reactivity with smallpox vaccines and are mostly used in epidemiological studies. While these methods play an important role in detecting monkeypox virus, they also suffer from drawbacks such as being time-consuming and labor-intensive, having long time cycles and low efficiency, requiring specialized personnel and expensive equipment, having a high false positive rate, and being unsuitable for rapid on-site detection. Therefore, for both prevention and treatment, there is a need to develop a rapid, sensitive, and specific method for detecting monkeypox type I virus.

[0004] CRISPR-Cas technology is a rapidly developing gene-editing technology in recent years. The CRISPR-Cas system consists of clustered, regularly interspaced short palindromic repeats (CRISPR) and their associated proteins (Cas). Originally, the CRISPR-Cas system was an adaptive immune mechanism found in prokaryotes. Currently, after a series of modifications, CRISPR-Cas technology is widely used in various life science research fields, including genome editing, gene expression regulation, gene therapy, pathogen detection, high-throughput screening of target genes, and epigenetic modification. Besides being a gene-editing tool, class II Cas proteins (such as Cas12a protein) also possess "accessory cleavage" properties and have been developed into nucleic acid detection methods to identify different types of targets, showing great potential in the field of rapid detection.

[0005] Recombinase polymerase isothermal amplification (RPA) is a novel isothermal amplification technique widely used for the molecular diagnosis of pathogenic nucleic acids. In China, based on differences in the companies developing it and the sources of the enzymes used, it is also known as recombinase-mediated isothermal amplification (RAA; including Jiangsu Qitian Gene Biotechnology Co., Ltd. and Hangzhou Zhongce Biotechnology Co., Ltd.) or enzyme-catalyzed isothermal amplification (ERA; Suzhou Xianda Gene Technology Co., Ltd.). RAA replaces the thermal cycling required by polymerase chain reaction (PCR) with three core enzymes. Unlike many other isothermal techniques, RAA eliminates the need for a heating or precise temperature control stage; the amplification reaction can be carried out within a temperature range of 25–42°C, and the reaction is usually completed within 5–15 minutes. RAA technology has been widely used in the field of nucleic acid detection since its inception.

[0006] The purpose of this invention is to detect monkeypox type I virus rapidly and accurately.

[0007] This invention first protects the use of the nucleic acid molecule shown in SEQ ID No. 1 or the nucleic acid molecule shown in positions 1 to 224 from the 5' end of SEQ ID No. 1 as a target sequence for detecting monkeypox type I virus in the detection or auxiliary detection of monkeypox type I virus.

[0008] In the above applications, if the nucleic acid of the sample to be tested contains the nucleic acid molecule shown in SEQ ID No. 1 or the nucleic acid molecule shown in positions 1 to 224 from the 5' end of SEQ ID No. 1, then the sample to be tested contains or is a candidate to contain monkeypox type I virus.

[0009] This invention also protects a kit of reagents for detecting monkeypox type I virus. The kit may include RAA primer pairs and OPG033-crRNA4(-3); The RAA primer pair may consist of an upstream primer OPG033-F2 and a downstream primer OPG033-R3; The upstream primer OPG033-F2 can be either a1) or a2). a1) The single-stranded DNA molecule shown in SEQ ID No. 4; a2) A single-stranded DNA molecule of SEQ ID No. 4 with one or more nucleotide substitutions and / or deletions and / or additions that have the same function as SEQ ID No. 4; The downstream primer OPG033-R3 can be either a3) or a4). a3) The single-stranded DNA molecule shown in SEQ ID No. 7; a4) A single-stranded DNA molecule that has undergone substitution and / or deletion and / or addition of one or more nucleotides of SEQ ID No. 7 and has the same function as SEQ ID No. 7; The OPG033-crRNA4(-3) may include, from 5' to 3', RNA fragment A and RNA fragment B for binding the Cas12a protein; RNA fragment B is identical to or reverse complementary to the target sequence portion of the monkeypox type I virus genome of the RAA primer pair.

[0010] The complete set of reagents may specifically consist of the RAA primer pair and the OPG033-crRNA4(-3).

[0011] The OPG033-crRNA4(-3) described above can be composed of RNA fragment A and RNA fragment B from 5' to 3' respectively.

[0012] The nucleotide sequence of any of the RNA fragments described above may be as shown in SEQ ID No. 10 from position 1 to 21 starting from the 5' end.

[0013] The nucleotide sequence of any of the RNA fragments B described above may be as shown in SEQ ID No. 10 from position 22 to 43 starting from the 5' end.

[0014] The nucleotide sequence of any of the above-described OPG033-crRNA4(-3) may be as shown in SEQ ID No. 10.

[0015] The nucleotide sequence of the target sequence of any of the RAA primer pairs described above in the monkeypox type I virus genome can be as shown in SEQ ID No. 1 from position 1 to 224 starting from the 5' end.

[0016] The aforementioned reagent kit for detecting monkeypox type I virus may further include an ssDNA fluorescent reporter group with a nucleotide sequence as shown in SEQ ID No. 14; one end of the ssDNA fluorescent reporter group is modified with a fluorescent group, and the other end is modified with a quenching fluorescent group. In a specific embodiment of the present invention, the fluorescent group may specifically be FAM, and the quenching fluorescent group may specifically be BHQ1.

[0017] The complete set of reagents for detecting monkeypox type I virus described above may specifically consist of the RAA primer pair described above, the OPG033-crRNA4(-3) described above, and the ssDNA fluorescent reporter group described above.

[0018] The kits for detecting monkeypox type I virus described above may also include the Cas12a protein.

[0019] The complete set of reagents for detecting monkeypox type I virus described above may specifically consist of the RAA primer pair described above, the OPG033-crRNA4(-3) described above, the ssDNA fluorescent reporter group described above, and the Cas12a protein described above.

[0020] The complete set of reagents for detecting monkeypox type I virus described above may specifically consist of the RAA primer pair described above, the OPG033-crRNA4(-3) and Cas12a protein described above.

[0021] This invention also protects the application of any of the aforementioned kits of reagents, which may be as follows: b1) or b2). b1) Prepare a kit for detecting or assisting in the detection of monkeypox type I virus; b2) Detection or auxiliary detection of monkeypox type I virus.

[0022] Methods for detecting or assisting in the detection of whether a sample contains or is candidate to contain monkeypox type I virus are also within the scope of protection of this invention.

[0023] The method for detecting or assisting in the detection of whether a sample contains or is candidate for monkeypox type I virus, protected by this invention, may specifically be Method 1, which may include the following steps: (c1) Using the nucleic acid of the sample to be tested as a template, perform RAA using any of the RAA primer pairs described above to obtain the RAA amplification product; (c2) The RAA amplification product obtained in step (c1) is cleaved by CRISPR using any of the above-described OPG033-crRNA4(-3), any of the above-described ssDNA fluorescent reporter groups and Cas12a protein to obtain the cleavage reaction product; (c3) Detect the fluorescence of the cleavage reaction product obtained in step (c2), and then make the following judgments: If fluorescence can be detected in the cleavage reaction product, the sample to be tested contains or is a candidate for containing monkeypox type I virus. If fluorescence is not detected in the cleavage reaction product, the sample to be tested does not contain or does not contain monkeypox type I virus.

[0024] In step (c1), the RAA reaction system can specifically be 50 μL, consisting of 25 μL RAA amplification buffer (a component in a standard RAA kit), 2 μL of 10 μM upstream primer OPG033-F2 aqueous solution, 2 μL of 10 μM downstream primer OPG033-R3 aqueous solution, 17.5 μL of water, 1 μL of nucleic acid from the sample to be tested, and 2.5 μL of magnesium acetate.

[0025] In step (c1), the reaction conditions for RAA can be 35-41℃ (e.g., 35-37℃, 37-39℃, 39-41℃, 35℃, 37℃, 39℃, or 41℃) for 20-40 min (e.g., 20-30 min, 30-40 min, 20 min, 30 min, or 40 min). In the embodiments of the present invention, the specific reaction conditions for RAA can be 39℃ for 20 min.

[0026] In step (c1), when the nucleic acid of the sample to be tested is replaced with water or other non-monkeypox type I virus nucleic acid, all other steps remain unchanged, and it can be used as a negative control.

[0027] In step (c2), the reaction system for CRISPR cutting can specifically be 20 μL, which can be composed of 2 μL NE Buffer. TM The reaction mixture consisted of 1 μL LbCas12a protein dilution (1 μM concentration), 1 μL OPG033-crRNA4(-3) solution (5 μM concentration), 1 μL ssDNA fluorescent reporter (2.5 μM concentration), 10 μL DEPC water, and 5 μL of the RAA amplification product obtained in step 1. In the cleavage reaction system, the concentrations of LbCas12a protein (50 nM), OPG033-crRNA4(-3) (250 nM), and ssDNA fluorescent reporter (125 nM) were all present.

[0028] In step (c2), the reaction conditions for CRISPR cutting can be 35-39℃ (e.g., 35-37℃, 37-39℃, 35℃, 37℃ or 39℃) for 10-30 min (e.g., 10-20 min, 20-30 min, 10 min, 20 min or 30 min).

[0029] In step (c3), the method for detecting the fluorescence of the cleavage reaction product obtained in step (c2) can be either method A or method B.

[0030] The method A can be specifically as follows: When performing step (c2), the fluorescence value is read every 20 seconds using the RAA-F1620 isothermal amplification fluorescence detection system, and the accumulated fluorescence value is used as the fluorescence amount. Then, the following judgment is made: if the fluorescence amount is more than twice that of the negative control, it is determined that the cleavage reaction product can be detected with fluorescence; if the fluorescence amount of the test sample is less than twice that of the negative control, it is determined that the cleavage reaction product cannot be detected with fluorescence.

[0031] Method B can specifically involve: directly illuminating the cleavage reaction product obtained in step (c2) with a fluorescent flashlight, and visually judging whether the cleavage reaction product can emit fluorescence. The fluorescence emission wavelength of the fluorescent flashlight can be 440-460nm.

[0032] The method for detecting or assisting in the detection of whether a sample contains or is candidate for monkeypox type I virus, protected by this invention, can specifically be Method Two, which may include the following steps: detecting whether the total DNA of the sample contains a specific DNA fragment, and then making the following determination: If the total DNA of the sample to be tested contains a specific DNA fragment, then the sample to be tested contains or is a candidate for containing monkeypox type I virus; If the total DNA of the sample to be tested does not contain specific DNA fragments, then the sample to be tested does not contain or is candidate not to contain monkeypox type I virus; The specific DNA fragment is SEQ ID No. 1 or the nucleic acid molecule shown in SEQ ID No. 1 from position 1 to position 224 starting from the 5' end.

[0033] The above-mentioned applications of detection or auxiliary detection of monkeypox type I virus are non-disease diagnostic and therapeutic applications.

[0034] The methods described above for detecting or assisting in the detection of monkeypox type I virus are non-disease diagnostic and therapeutic methods.

[0035] Specifically, the application and method are intended for the preparation of monkeypox type I virus drug models or for screening monkeypox type I virus therapeutic drugs.

[0036] The Cas12a protein mentioned above can specifically be the LbCas12a protein.

[0037] This invention is the first to screen out the specific sequence of monkeypox type I virus—the OPG033 sequence—and based on this, developed a CRISPR detection system for detecting monkeypox type I virus. Experiments show that this system specifically responds to monkeypox type I virus targets containing the OPG033 sequence, while showing no response to other test pathogens that do not contain the OPG033 sequence, thus achieving highly specific identification of monkeypox type I virus. This invention is simple and convenient, not only low in cost but also highly sensitive and specific, and has significant application value. Attached Figure Description

[0038] Figure 1 The results of the alignment analysis of the OPG033 sequence in Example 1 on Nextclade are shown.

[0039] Figure 2 This is the Blast alignment result of the OPG033 sequence in Example 1.

[0040] Figure 3 The results of the base alignment between the OPG033 and CPXV035 sequences in Example 1 are shown.

[0041] Figure 4 The results show the screening results for the optimal crRNA for detecting monkeypox type I virus in Example 2.

[0042] Figure 5 This is a partial screening result of the optimal RAA primer pair for detecting monkeypox type I virus in Example 2.

[0043] Figure 6 This is for the detection of the copy sensitivity of plasmid pUC57-OPG033 in Example 3.

[0044] Figure 7 This is a visual fluorescence detection of the copy sensitivity of plasmid pUC57-OPG033 in Example 3.

[0045] Figure 8 This is a specific detection of the OPG033 sequence in the clinical sample from Example 4. Detailed Implementation

[0046] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0048] In the following examples, LbCas12a protein is a product of Nanjing Genscript Biotech Co., Ltd., catalog number Z03753; NEBuffer TM r2.1 is a product of New England Biolabs, catalog number B6002S; DEPC water is a product of Beyotime Biotechnology Co., Ltd.; the standard RAA kit is a product of Hangzhou Zhongce Biotechnology Co., Ltd., catalog number S001ZC; the RAA-F1620 isothermal amplification fluorescence detection system is a product of Jiangsu Qitian Gene Biotechnology Co., Ltd.; and the LUYOR-3280 fluorescent flashlight is a product of Shanghai Luyang Instrument Co., Ltd.

[0049] Example 1: Establishment of a rapid, sensitive and specific method for detecting monkeypox type I virus I. Target sequence screening and plasmid synthesis 1. The inventors of this application obtained the genome sequences of non-branched monkeypox virus (i.e., monkeypox type I virus) and other orthopoxviruses from the NCBI database. After extensive screening, they obtained the non-branched specific sequence of monkeypox virus—the OPG033 sequence (PQ221618.1 REGION: 20404-20739). The nucleotide sequence of the OPG033 sequence is shown in SEQ ID No. 1.

[0050] SEQ ID No. 1 is: TCTGTATTACCGACTATCGTCCAATATTCTGTTCTAGGAGAGTAATGGGTTATTGTGGATATATAATCAGAGTTTTTAATGACTACTATATTATGTTTTATACATTTCGTGTCACAGCTTTGTAGATTTGGATATAGTTAATCCCAACAATGCTATAGCATTGCATA TAGCATTAGTCATAAACTTGGGATGTAAAATGTTGATGATATCTACATCGTTTGGATTTTTATGTATCCACTTTAATAATATTATAGCGTAACATCCTCATGATTTACGTTAACGTTTTCGTGTGATAAGATAGTGGTCAGTTCATCCTTTGATAATTTTCCAAATTC 2. The OPG033 sequence was subjected to bioinformatics alignment analysis in the Nextclade database. The alignment results are as follows: Figure 1 As shown, the OPG033 sequence is only present in the non-branched genome sequence of monkeypox virus. Blast sequence alignment of the OPG033 sequence is shown in the figure. Figure 2 As shown. The OPG033 sequence also exists in some vaccinia virus, smallpox virus, and camelpox virus genomes, but there are base differences of varying lengths near the 167th base. Among them, the smallest difference is compared with the CPXV035 sequence in the Cowpox virus strain CPXV / Cepad 333 genome, which is a difference of 2 consecutive bases. Figure 3 The nucleotide sequence of CPXV035 is shown in SEQ ID No. 2.

[0051] SEQ ID No.2 is: TCTGTATTACCGACTATCGTCCAATATTCTGTTCTAGGAGAGTAATGGGTTATTGTGGATATATAATCAGAGTTTTTAATGACTACTATATTATGTTTTATACATTTCGTGTCACAGGCTTTGTAGATTTGGATATAGTTAATCCCAACAATGCTATAGCATTGCGCA TAGCATTAGTCATAAACTTGGGATGTAAAATGTTGATGATATCTACATCGTTTGGATTTTTATGTATCCACTTTAATAATATTATAGCTGTAACATCCTCATGATTTACGTTAACGTTTTCGTGGGATAAGATAGTTGTTAGTTCATCCTTTGATAATTTTCCAAATTC Therefore, from a bioinformatics perspective, the OPG033 sequence, as a specific conserved sequence for non-branching monkeypox virus, can be used to specifically detect non-branching monkeypox virus.

[0052] 3. To verify the feasibility of using the OPG033 sequence as a target sequence for detection, Shanghai Sangon Biotech Co., Ltd. was commissioned to synthesize plasmids pUC57-OPG033 and pUC57-CPXV035.

[0053] The plasmid pUC57-OPG033 is a recombinant plasmid obtained by replacing a small DNA fragment between the restriction endonucleases BamHI and HindIII in the pUC57 vector (Shanghai Sangon Biotech Co., Ltd., B522201) with the nucleotide sequence OPG033 as shown in SEQ ID No. 2.

[0054] The plasmid pUC57-CPXV035 is a recombinant plasmid obtained by replacing a small DNA fragment between the restriction endonucleases BamHI and HindIII in the pUC57 vector with the nucleotide sequence CPXV035 shown in SEQ ID No. 3.

[0055] II. Preparation of a kit for detecting monkeypox type I virus 1. Based on the nucleotide sequence of the OPG033 sequence, RAA primer pairs (for amplifying the OPG033 sequence) and crRNA were designed for the detection of monkeypox type I virus. The RAA primer pairs consist of an upstream primer and a downstream primer. The design principles are as follows: (1) The length of the upstream and downstream primers is 30-40 bp, and the length of the amplification product is between 100-500 bp to achieve the best amplification efficiency; (2) The length of the crRNA is between 30-60 bp, consisting of an anchor sequence and a guide sequence for binding the Cas12a protein, and the guide sequence matches the amplification product sequence of the RAA primer pair. (3) In order to achieve high specificity recognition of the OPG033 sequence, base mismatch design was performed on the crRNA. Six base mismatch crRNAs were designed to specifically detect monkeypox type I virus.

[0056] Based on the above design principles, the nucleotide sequences of the designed upstream primers (names containing "upstream primer" in Table 1, such as OPG033-F1 and OPG033-F2), downstream primers (names containing "downstream primer" in Table 1, such as OPG033-R1, OPG033-R2, and OPG033-R3), crRNA (names containing "crRNA" in Table 1), and ssDNA fluorescent reporter groups are shown in Table 1.

[0057] Table 1

[0058] Note: The single underlined portion of crRNA is the guide sequence, which matches the amplification product sequence of the RAA primer pair; the double underlined portion is the anchoring sequence, used to bind to the Cas12a protein. In the ssDNA fluorescent reporter group, 6-FAM is the 5' end T base of the ssDNA fluorescent reporter group modified with the 6-FAM fluorescent group, and BHQ1 is the 3' end T base of the ssDNA fluorescent reporter group modified with the BHQ1 quenching fluorescent group.

[0059] The upstream primers OPG033-F1, OPG033-F2, OPG033-R1, OPG033-R2, OPG033-R3, OPG033-crRNA4(-1), OPG033-crRNA4(-2), OPG033-crRNA4(-3), OPG033-crRNA4(+1), OPG033-crRNA4(+2), OPG033-crRNA4(+3) and the ssDNA fluorescent reporter group were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0060] 2. Preparation of a kit for detecting monkeypox type I virus The kit for detecting monkeypox type I virus consists of RAA primer pairs, crRNA, and ssDNA fluorescent reporter. The RAA primer pair consists of an upstream primer (upstream primer OPG033-F1 or upstream primer OPG033-F2) and a downstream primer (downstream primer OPG033-R1, downstream primer OPG033-R2, or downstream primer OPG033-R3). The crRNA is available in OPG033-crRNA4(-1), OPG033-crRNA4(-2), OPG033-crRNA4(-3), OPG033-crRNA4(+1), OPG033-crRNA4(+2), or OPG033-crRNA4(+3). In the kit for detecting monkeypox type I virus, the upstream primer, downstream primer, crRNA, and ssDNA fluorescent reporter are packaged separately.

[0061] III. Establishment of a method for detecting monkeypox type I virus The inventors of this application have established a method for detecting monkeypox type I virus through extensive experimentation. The specific steps are as follows: 1. RAA amplification (1) Prepare the RAA reaction premix. The RAA reaction premix is ​​46.5 μL, consisting of 25 μL RAA amplification buffer (a component in a standard RAA kit), 2 μL of 10 μM aqueous solution of upstream primer (upstream primer OPG033-F1 or upstream primer OPG033-F2), 2 μL of 10 μM aqueous solution of downstream primer (downstream primer OPG033-R1, downstream primer OPG033-R2 or downstream primer OPG033-R3) and 17.5 μL of water.

[0062] (2) Add 46.5 μL of RAA reaction premix to each reaction unit of the ordinary RAA kit and dissolve it evenly. Then add 1 μL of nucleic acid of the sample to be tested, and then add 2.5 μL of MgAc (a component in the ordinary RAA kit) to the tube cap and mix well. Then react at 39°C for 20 min to obtain the RAA amplification product.

[0063] Following the steps described above, replace the nucleic acid in the sample to be tested with water, keeping all other steps unchanged, as a negative control.

[0064] 2. CRISPR cutting (1) Preparation of the cleavage reaction system. The cleavage reaction system is 20 μL, consisting of 2 μL NE Buffer. TM The reaction mixture consisted of 1 μL LbCas12a protein dilution buffer (1 μM LbCas12a protein concentration), 1 μL crRNA solution (5 μM crRNA concentration), 1 μL ssDNA fluorescent reporter group (2.5 μM ssDNA fluorescent reporter group concentration), 10 μL DEPC water, and 5 μL of the RAA amplification product obtained in step 1. In the cleavage reaction system, the concentrations of LbCas12a protein, crRNA, and ssDNA fluorescent reporter group were 50 nM, 250 nM, and 125 nM respectively.

[0065] crRNA is OPG033-crRNA4(-1), OPG033-crRNA4(-2), OPG033-crRNA4(-3), OPG033-crRNA4(+1), OPG033-crRNA4(+2), or OPG033-crRNA4(+3).

[0066] (2) The cleavage reaction system prepared in step (1) was placed in the RAA-F1620 isothermal amplification fluorescence detection system and incubated at 37°C for 20 minutes to carry out the cleavage reaction and obtain the cleavage reaction product.

[0067] 3. Fluorescence detection (1) Fluorescence detection method one During step 2 (2), the RAA-F1620 isothermal amplification fluorescence detection system reads fluorescence values ​​every 20 seconds, and the accumulated fluorescence value is used as the fluorescence value. Then, the following criteria are used for judgment: If the fluorescence intensity of the test sample is more than twice that of the negative control, then the test sample contains or is a candidate for containing monkeypox type I virus. If the fluorescence intensity of the test sample is less than twice that of the negative control, then the test sample does not contain or is a candidate sample that does not contain monkeypox type I virus.

[0068] (2) Fluorescence detection method two The cleavage reaction product was irradiated with a portable fluorescent flashlight (such as a LUYOR-3280 fluorescent flashlight) with a fluorescence emission wavelength of 440-460nm, and then visually assessed as follows: If the reaction product of the test sample emits fluorescence, the test sample contains or is a candidate for containing monkeypox type I virus. If the reaction product of the test sample does not emit fluorescence, then the test sample does not contain or is a candidate sample that does not contain monkeypox type I virus.

[0069] Optimization of the methods established in Example 2 and Example 1 I. Screening for the optimal crRNA for detecting monkeypox type I virus A. Experimental Group 1. Prepare the cleavage reaction system. The cleavage reaction system is 20 μL, consisting of 2 μL NE Buffer. TM The cleavage reaction system consisted of 1 μL LbCas12a protein dilution (1 μM LbCas12a protein concentration), 1 μL crRNA solution (5 μM crRNA concentration), 1 μL ssDNA fluorescent reporter solution (2.5 μM ssDNA fluorescent reporter group concentration), 14 μL DEPC water, and 1 μL plasmid pUC57-OPG033 aqueous solution (40 nM concentration). In the cleavage reaction system, the concentrations of LbCas12a protein, crRNA, and ssDNA fluorescent reporter group were 50 nM, 250 nM, and 125 nM respectively.

[0070] crRNA is OPG033-crRNA4(-1), OPG033-crRNA4(-2), OPG033-crRNA4(-3), OPG033-crRNA4(+1), OPG033-crRNA4(+2), or OPG033-crRNA4(+3).

[0071] 2. Place the cleavage reaction system prepared in step 1 into the RAA-F1620 isothermal amplification fluorescence detection system, incubate at 37℃ for 40 minutes to carry out the cleavage reaction, and detect the fluorescence value in real time.

[0072] B. Negative control group Following step A above, replace the aqueous solution of plasmid pUC57-OPG033 with DEPC water, keeping all other steps unchanged, as a negative control group.

[0073] C. Control Group Following step A above, replace plasmid pUC57-OPG033 with plasmid pUC57-CPXV035, keeping all other steps unchanged, as a control group.

[0074] Test results are shown Figure 4(+OPG033 represents plasmid pUC57-OPG033, i.e., the experimental group; +CPXV035 represents plasmid pUC57-CPXV035, i.e., the control group; DEPC water represents the negative control group). The results showed that OPG033-crRNA4(-2) and OPG033-crRNA4(-3) had good detection responses to plasmid pUC57-OPG033, but no response to plasmid pUC57-CPXV035 and the negative control group. Therefore, OPG033-crRNA4(-2) or OPG033-crRNA4(-3) can be used as crRNAs for the specific detection of monkeypox type I virus.

[0075] II. Screening of the optimal RAA primer pairs for detecting monkeypox type I virus 1. Dilute plasmid pUC57-OPG033 with water to obtain a dilution solution of plasmid pUC57-OPG033 with a concentration of 1000 copies / μL.

[0076] 2. RAA amplification (1) Prepare the RAA reaction premix. The RAA reaction premix is ​​46.5 μL, consisting of 25 μL RAA amplification buffer (a component in a standard RAA kit), 2 μL of 10 μM aqueous solution of upstream primer (upstream primer OPG033-F1 or upstream primer OPG033-F2), 2 μL of 10 μM aqueous solution of downstream primer (downstream primer OPG033-R1, downstream primer OPG033-R2 or downstream primer OPG033-R3) and 17.5 μL of water.

[0077] (2) Add 46.5 μL of RAA reaction premix to each reaction unit of the ordinary RAA kit and dissolve it evenly. Then add 1 μL of plasmid pUC57-OPG033 dilution solution and add 2.5 μL of MgAc (a component in the ordinary RAA kit) to the tube cap and mix well. Then react at 39°C for 20 min to obtain RAA amplification product 2.

[0078] 3. CRISPR cutting (1) Preparation of the cleavage reaction system. The cleavage reaction system is 20 μL, consisting of 2 μL NE Buffer. TMThe reaction mixture consisted of 1 μL LbCas12a protein dilution buffer (LbCas12a protein concentration was 1 μM), 1 μL crRNA solution (crRNA concentration was 5 μM), 1 μL ssDNA fluorescent reporter group (ssDNA fluorescent reporter group concentration was 2.5 μM), 10 μL DEPC water, and 5 μL of RAA amplification product 2 obtained in step 5. In the cleavage reaction system, the concentrations of LbCas12a protein, crRNA, and ssDNA fluorescent reporter group were 50 nM, 250 nM, and 125 nM respectively.

[0079] The crRNA is either OPG033-crRNA4(-2) or OPG033-crRNA4(-3).

[0080] (2) Place the cleavage reaction system prepared in step (1) into the RAA-F1620 isothermal amplification fluorescence detection system, incubate at 37°C for 20 minutes to carry out the cleavage reaction, and detect the fluorescence in real time.

[0081] When the crRNA is OPG033-crRNA4(-3), the screening results of RAA amplification primers are as follows: Figure 5 As shown (F1 is upstream primer OPG033-F1, F2 is upstream primer OPG033-F2, R1 is downstream primer OPG033-R1, R2 is downstream primer OPG033-R2, R3 is downstream primer OPG033-R3). The results showed that all primer combinations reached maximum fluorescence values ​​around 5 minutes, but the RAA primer pair composed of upstream primer OPG033-F2 and downstream primer OPG033-R3 exhibited superior amplification performance compared to other primer pairs. Therefore, the RAA primer pair composed of upstream primer OPG033-F2 and downstream primer OPG033-R3 was subsequently selected as the optimal primer pair for detecting monkeypox type I virus.

[0082] III. Based on the above experimental results, the specific steps of the method for detecting monkeypox type I virus finally established in this application are as follows: 1. RAA amplification (1) Prepare the RAA reaction premix. The RAA reaction premix is ​​46.5 μL, consisting of 25 μL RAA amplification buffer (a component in a standard RAA kit), 2 μL of 10 μM aqueous solution of upstream primer OPG033-F2, 2 μL of 10 μM aqueous solution of downstream primer OPG033-R3, and 17.5 μL of water.

[0083] (2) Add 46.5 μL of RAA reaction premix to each reaction unit of the ordinary RAA kit and dissolve it evenly. Then add 1 μL of nucleic acid of the sample to be tested, and then add 2.5 μL of MgAc (a component in the ordinary RAA kit) to the tube cap and mix well. Then react at 39°C for 20 min to obtain RAA amplification product 2.

[0084] Following the steps described above, replace the nucleic acid in the sample to be tested with water, keeping all other steps unchanged, as a negative control.

[0085] 2. CRISPR cutting (1) Preparation of the cleavage reaction system. The cleavage reaction system is 20 μL, consisting of 2 μL NE Buffer. TM The reaction mixture consisted of 1 μL LbCas12a protein dilution buffer (1 μM), 1 μL OPG033-crRNA4(-3) solution (5 μM), 1 μL ssDNA fluorescent reporter (2.5 μM), 10 μL DEPC water, and 5 μL of the RAA amplification product 2 obtained in step 4. In the cleavage reaction system, the concentrations of LbCas12a protein (50 nM), OPG033-crRNA4(-3) (250 nM), and ssDNA fluorescent reporter (125 nM) were all present.

[0086] (2) The cleavage reaction system prepared in step (1) was placed in the RAA-F1620 isothermal amplification fluorescence detection system and incubated at 37°C for 20 minutes to carry out the cleavage reaction and obtain the cleavage reaction product.

[0087] 3. Fluorescence detection (1) Fluorescence detection method one During step 5 (2), the RAA-F1620 isothermal amplification fluorescence detection system reads fluorescence values ​​every 20 seconds, and the accumulated fluorescence value is used as the fluorescence value. Then, the following criteria are used for judgment: If the fluorescence intensity of the test sample is more than twice that of the negative control, then the test sample contains or is a candidate for containing monkeypox type I virus. If the fluorescence intensity of the test sample is less than twice that of the negative control, then the test sample does not contain or is a candidate sample that does not contain monkeypox type I virus.

[0088] (2) Fluorescence detection method two The cleavage reaction product was irradiated with a portable fluorescent flashlight (such as a LUYOR-3280 fluorescent flashlight) with a fluorescence emission wavelength of 440-460nm, and then visually assessed as follows: If the reaction product of the test sample emits fluorescence, the test sample contains or is a candidate for containing monkeypox type I virus. If the reaction product of the test sample does not emit fluorescence, then the test sample does not contain or is a candidate sample that does not contain monkeypox type I virus.

[0089] Sensitivity detection of the methods for detecting monkeypox type I virus established in Examples 3 and 2 1. Plasmid pUC57-OPG033 was serially diluted 10-fold with water to obtain concentrations of 10... 3 Plasmid dilution buffer 1 at a concentration of 10 copies / μL 2 Plasmid dilution 2 with a concentration of 10 copies / μL, plasmid dilution 3 with a concentration of 10 copies / μL, and plasmid dilution 4 with a concentration of 1 copy / μL.

[0090] 2. Following the method in steps 3.1-3 of Example 2, replace 1 μL of nucleic acid in the sample to be tested with 1 μL of plasmid diluent 1 (total 10 μL). 3 1 copy), 1 μL plasmid dilution buffer 2 (total 10) 2 The steps remain the same, except that the fluorescence detection methods are selected as fluorescence detection method one and fluorescence detection method two, respectively.

[0091] The detection results of fluorescence detection method one are shown below. Figure 6 (0 is a negative control, 1 is 1 copy, 10 is 10 copies, 10) 2 10 2 Copy, 10 3 10 3 (Copy). The detection results of fluorescence detection method two are shown in [the image / copy]. Figure 7 The results showed that the detection sensitivity of the method for detecting monkeypox type I virus established in Example 2 could reach 1 copy / reaction.

[0092] Specificity detection of monkeypox type I virus established in Example 4 and Example 2 The Tiantan strain of vaccinia virus is described in the following literature: Tian, ​​L., Zhang, Y., Liu, Q., Ruan, L., Ren, F., Han, Y., Zhang, Y., Yang, L., Li, S., Sun, H., Zhang, Y., Zhou, Y., Pei, R., Deng, F., Huang, C., Chen, X., & Wang, Y. (2024). Vaccinia virus tiantan strain is inefficient in eliciting cross-reactive immunity against the emerging monkeypox virus strain. Emerging microbes & infections, 13(1), 2306967. The name of the Tiantan strain of vaccinia virus in the literature is Vaccinia virus tiantan strain.

[0093] The samples to be tested included 3 varicella-zoster virus rash fluid samples, 1 Epstein-Barr virus (EBV) serum sample, 1 cytomegalovirus (CMV) serum sample, 1 human papillomavirus (HPV) type 3 serum sample, 1 Tian Tan strain vaccinia virus vaccine sample, and 10 serum samples from healthy individuals (i.e., negative samples). The varicella-zoster virus rash fluid samples were all clinically confirmed to contain varicella-zoster virus; the EBV serum sample was clinically confirmed to contain EBV; the CMV serum sample was clinically confirmed to contain CMV; and the HPV type 3 serum sample was clinically confirmed to contain HPV type 3.

[0094] Nucleic acid was extracted from the samples to be tested, and then the detection was performed according to step three of Example 2, with all other steps remaining unchanged. The fluorescence detection method was selected as fluorescence detection method one.

[0095] Replace the nucleic acid in the sample to be tested with water, keeping all other steps unchanged, and use this as a negative control.

[0096] Replace the nucleic acid in the sample to be tested with plasmid pUC57-CPXV035, keeping all other steps unchanged, as a control.

[0097] Take plasmid pUC57-OPG033 (because the OPG033 sequence is a unique sequence of monkeypox type I virus, used to simulate the nucleic acid of monkeypox type I virus), and perform detection according to the method in step three of Example 2, with all other steps remaining unchanged. The fluorescence detection method is selected as fluorescence detection method one.

[0098] Test results are shown Figure 8As shown (ddH2O is the negative control, OPG033 is plasmid pUC57-OPG033, CPXV035 is plasmid pUC57-CPXV035, samples with "herpesvirus patient rash fluid sample" in the name are varicella-zoster virus rash fluid samples, cytomegalovirus is a cytomegalovirus serum sample, human papillomavirus type 3 is a human papillomavirus type 3 serum sample, and Epstein-Barr virus is an Epstein-Barr virus serum sample), the detection results show that the kit provided by this invention, consisting of upstream primer OPG033-F2, downstream primer OPG033-R3, OPG033-crRNA4(-3), and ssDNA fluorescent reporter group, can specifically recognize the OPG033 sequence of monkeypox type I virus and does not cross-react with varicella-zoster virus, Epstein-Barr virus, cytomegalovirus, human papillomavirus type 3, Tiantan strain vaccinia virus, etc., and the method established using it has good specificity.

[0099] Given that the bioinformatics in Example 1 also found that the OPG033 sequence is a unique sequence of monkeypox type I virus, the method established in Example 2 has high specificity for detecting monkeypox type I virus. This method provides a reliable tool for the specific identification of monkeypox type I virus.

[0100] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of the nucleic acid molecule shown in SEQ ID No. 1 or the nucleic acid molecule shown in positions 1 to 224 from the 5' end of SEQ ID No. 1 as a target sequence for detecting monkeypox type I virus in the detection or auxiliary detection of monkeypox type I virus.

2. A complete set of reagents for detecting monkeypox type I virus, including RAA primer pairs and OPG033-crRNA4(-3); The RAA primer pair consists of upstream primer OPG033-F2 and downstream primer OPG033-R3; The upstream primer OPG033-F2 is either a1) or a2) as follows: a1) The single-stranded DNA molecule shown in SEQ ID No. 4; a2) A single-stranded DNA molecule of SEQ ID No. 4 that has undergone substitution and / or deletion and / or addition of one or more nucleotides and has the same function as SEQ ID No. 4; The downstream primer OPG033-R3 is as follows (a3) ​​or (a4): a3) The single-stranded DNA molecule shown in SEQ ID No. 7; a4) A single-stranded DNA molecule of SEQ ID No. 7 that has undergone substitution and / or deletion and / or addition of one or more nucleotides and has the same function as SEQ ID No. 7; The OPG033-crRNA4(-3) comprises, from 5' to 3', RNA fragment A and RNA fragment B for binding the Cas12a protein; RNA fragment B is identical to or inversely complementary to the target sequence portion of the RAA primer pair in the monkeypox type I virus genome.

3. The complete set of reagents according to claim 2, characterized in that: The nucleotide sequence of the RNA fragment A is shown in SEQ ID No. 10 from position 1 to 21 starting from the 5' end.

4. The complete set of reagents according to claim 2, characterized in that: The nucleotide sequence of the target sequence of the RAA primer pair in the monkeypox type I virus genome is shown in SEQ ID No. 1 from position 1 to 224 starting from the 5' end.

5. The complete set of reagents according to claim 2, characterized in that: The nucleotide sequence of the RNA fragment B is shown in SEQ ID No. 10 from position 22 to 43 starting from the 5' end.

6. The complete set of reagents according to claim 2, characterized in that: The complete set of reagents for detecting monkeypox type I virus also includes an ssDNA fluorescent reporter group with a nucleotide sequence as shown in SEQ ID No. 14; one end of the ssDNA fluorescent reporter group is modified with a fluorescent group, and the other end is modified with a quenching fluorescent group.

7. The complete set of reagents according to claim 2, characterized in that: The kit for detecting monkeypox type I virus also includes the Cas12a protein.

8. The application of the kit of reagents according to any one of claims 2 to 7 is as follows: b1) or b2). b1) Prepare a kit for detecting or assisting in the detection of monkeypox type I virus; b2) Detection or auxiliary detection of monkeypox type I virus.

9. A method for detecting or assisting in the detection of whether a sample contains or is candidate for containing monkeypox type I virus, comprising the following steps: (c1) Using the nucleic acid of the sample to be tested as a template, perform RAA using the RAA primer pair described in claim 2 to obtain the RAA amplification product; (c2) The RAA amplification product obtained in step (c1) is cleaved by CRISPR using any of the OPG033-crRNA4(-3) described in claims 2 to 5, the ssDNA fluorescent reporter group described in claim 6, and the Cas12a protein to obtain the cleavage reaction product; (c3) Detect the fluorescence of the cleavage reaction product obtained in step (c2), and then make the following judgments: If fluorescence can be detected in the cleavage reaction product, the sample to be tested contains or is a candidate for containing monkeypox type I virus. If fluorescence is not detected in the cleavage reaction product, the sample to be tested does not contain or does not contain monkeypox type I virus.

10. A method for detecting or assisting in the detection of whether a sample contains or is candidate-containing monkeypox type I virus, comprising the following steps: detecting whether the total DNA of the sample contains a specific DNA fragment, and then making the following determination: If the total DNA of the sample to be tested contains a specific DNA fragment, then the sample to be tested contains or is a candidate for containing monkeypox type I virus; If the total DNA of the sample to be tested does not contain specific DNA fragments, then the sample to be tested does not contain or is candidate not to contain monkeypox type I virus; The specific DNA fragment is SEQ ID No. 1 or the nucleic acid molecule shown in SEQ ID No. 1 from position 1 to position 224 starting from the 5' end.

Images