Predictive marker of acute myelogenous leukemia for double-negative T cell treatment

Abstract

The invention particularly discloses a predictive marker for treating acute myelogenous leukemia on double-negative T cells, and relates to the technical field of biological medicines. The CD96 can be used as an intervention target point insensitive to DNT treatment of the AML patient, the killing effect of DNT on primary cells of the AML patient can be enhanced by specifically knocking out the CD96 or combining the CD96 with a CD96 specific blocking agent Nelistotug, and the insensitivity of DNT treatment of the AML patient is improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and in particular to a predictive marker of double negative T cell therapy for acute myeloid leukemia. BACKGROUND

[0002] Malignant hematopathy is a kind of malignant clonal disease of hematopoietic system, including leukemia, lymphoma, multiple myeloma, etc., with high morbidity and mortality, which seriously threatens the health of the people. Among them, acute myeloid leukemia (AML) is the type with the highest incidence in adult acute leukemia, accounting for about 60%, and accounting for about 15%-20% in children acute leukemia. At present, after standard treatment of initial AML, the first complete remission rate (CR) can reach 60-80%, but chemotherapy cannot effectively eliminate the micro residual disease (MRD), and about 70% of patients with CR eventually relapse. For relapsed and refractory AML (r / r AML), the treatment is difficult, and the prognosis is poor, and the long-term survival rate is only about 10%-20%, which is a major clinical problem to be solved.

[0003] In recent years, double negative T cells (DNT) have achieved certain results in the treatment of acute myeloid leukemia (AML). DNT cells are a special subset of T cells, accounting for only 1%-5% of peripheral blood T cells, have unique anti-tumor effects, are not limited by MHIC recognition, and allogeneic DNT cells can inhibit GVHD with small CRS reaction, and can be used as "off-the-shelf" products. However, due to the genetic differences of AML tumor cells, there are obvious differences in the killing of AML primary cells by DNT. Therefore, it is crucial to screen and verify the key genes that mediate DNT treatment of AML, explore them as key molecules for predicting the sensitivity of DNT treatment of AML, and achieve targeted enhancement of the therapeutic effect of DNT on AML treatment based on this. SUMMARY

[0004] (I) Technical problems solved In view of this, one of the main purposes of the present application is to provide a pharmaceutical composition for treating acute myeloid leukemia. CD96 can be used as an intervention target for DNT treatment of AML patients, and specific knockout of CD96 or combination with CD96 specific blocker Nelistotug can enhance the killing effect of DNT on AML patient primary cells and improve the insensitivity of DNT treatment of AML patients.

[0005] (II) Technical solutions In order to achieve the above purpose, the present application provides a pharmaceutical composition for preventing and / or treating acute myeloid leukemia, which comprises a CD96 inhibitor and double negative T cells.

[0006] In one embodiment, the CD96 inhibitor comprises an antibody, siRNA, miRNA, antisense oligonucleotide, antagonist and / or blocker against CD96 or a nucleic acid molecule encoding the protein.

[0007] In one embodiment, the CD96 inhibitor is a blocker.

[0008] In one embodiment, the blocker is Nelistotug.

[0009] In one embodiment, the double negative T cell is an autologous double negative T cell.

[0010] In one embodiment, the double negative T cell is an allogeneic double negative T cell.

[0011] In one embodiment, the pharmaceutical composition comprises Nelistotug and a double negative T cell.

[0012] In one embodiment, the pharmaceutical composition further comprises a pharmaceutically or immunologically acceptable carrier or excipient.

[0013] The present application provides, in another aspect, a pharmaceutical preparation comprising the above-mentioned pharmaceutical composition.

[0014] The present application provides, in another aspect, the use of the above-mentioned pharmaceutical composition and / or pharmaceutical preparation in the preparation of a medicament for preventing and / or treating acute myeloid leukemia.

[0015] In one embodiment, the acute myeloid leukemia is resistant to double negative T cell therapy.

[0016] In one embodiment, the CD96 inhibitor and double negative T cell are administered simultaneously.

[0017] In one embodiment, the CD96 inhibitor is administered first and the double negative T cell is administered later.

[0018] The present application provides, in another aspect, a predictive marker of double negative T cell therapy for acute myeloid leukemia, which is CD96.

[0019] The present application provides, in another aspect, a predictive agent of double negative T cell therapy for acute myeloid leukemia, which comprises a detection agent for the above-mentioned predictive marker.

[0020] The present application provides, in another aspect, a predictive kit of double negative T cell therapy for acute myeloid leukemia, which comprises the above-mentioned predictive agent.

[0021] (III) Beneficial Effects The present application provides a predictive marker of acute myeloid leukemia to double negative T cell therapy. Compared with the prior art, the following beneficial effects are possessed: 1. The killing effect of DNT on AML primary cells is enhanced by specific knockout of CD96 or combined with CD96 specific blocker Nelistotug. The specific blockade of CD96 reverses the DNT treatment resistance mediated by it, suggesting that specific blockade and intervention against CD96 are expected to further improve the effectiveness of DNT reinfusion therapy for AML patients. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0023] Figure 1 is a figure of AML primary cell transcriptome sequencing results.

[0024] Figure 2 is a figure of the correlation between the killing efficiency of DNT on AML cell lines and the CD96 expression of tumor cells.

[0025] Figure 3 is a figure of the correlation between the killing efficiency of DNT on AML primary cells and the CD96 expression of tumor cells.

[0026] Figure 4 is a figure of the correlation between the killing efficiency of DNT on AML primary cells and the CD96 expression of AML primary cells.

[0027] Figure 5 is a figure of the plasmid map.

[0028] Figure 6 is a figure of the killing efficiency of DNT on CD96 knockout AML cells.

[0029] Figure 7 is a figure of the effect of CD96 inhibitor on the killing ability of DNT. DETAILED DESCRIPTION

[0030] In order to make the objects, technical solutions and advantages of the embodiments of the present application clearer, the following will be combined with the accompanying drawings for the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts are within the scope of the present application.

[0031] Terms and definitions As used herein, the term "inhibitor" or "inhibitor of CD96 or nucleic acid molecule encoding the same" is used interchangeably to refer to an agent that can reduce the level or activity of CD96 or nucleic acid molecule encoding the same. Inhibitors useful in the present disclosure include, but are not limited to, antibodies, siRNAs, miRNAs, antisense oligonucleotides, antagonists, blockers directed against CD96 or nucleic acid molecule encoding the protein.

[0032] The disclosed inhibitors of the present application can inhibit CD96, and thus can be further used for preventing or treating diseases associated with acute myeloid leukemia and / or related symptoms.

[0033] As used herein, the term "pharmaceutically acceptable" ingredient is a substance that is suitable for use with humans and / or animals without undue adverse effects (such as toxicity, irritation, and allergic response) i.e., is reasonably safe for the patient.

[0034] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" is a carrier for the administration of therapeutic agents, including various excipients and diluents. The term refers to a carrier that is nontoxic to the subject, does not interact with the active ingredient in a deleterious manner, and does not adversely affect the therapeutic functionality of the active ingredient. Suitable carriers are well known to one of ordinary skill in the art and are described in Remington's Pharmaceutical Sciences, Mack Pub. Co., N.J. 1991, which provides an extensive list of pharmaceutically acceptable excipients.

[0035] Pharmaceutically acceptable carriers in the compositions include any and all solvents, dispersion media, preservatives, antioxidants, coatings, isotonic and absorption delaying agents, surfactants, fillers, disintegrants, binders, diluents, lubricants, glidants, pH adjusting agents, buffers, enhancers, wetting agents, solubilizing agents, surface active agents, antioxidants, and the like, compatible with pharmaceutical administration. Use of such media and agents for pharmaceutically active substances is well known in the art. The compositions can contain other active compounds providing supplemental, additional, or enhanced therapeutic functions. Solid carriers or excipients, such as lactose, starch or talc, or liquid carriers, such as water, fatty oils or liquid paraffin. Other examples of the carriers include culture media, such as DMEM or RPMI; and cryogenic storage media, including components that scavenge free radicals, provide pH buffering, osmotic / osmotic support, energy substrates, and ion concentrations that equilibrate intracellular states at cryogenic temperatures; and mixtures of organic solvents with water.

[0036] As used herein, the term "pharmaceutical composition" refers to a composition comprising a CD96 inhibitor formulated together with one or more pharmaceutically acceptable carriers.

[0037] The formulation of the pharmaceutical composition can be adjusted according to the application. In particular, the pharmaceutical composition can be formulated using methods known in the art in order to provide rapid, continuous or delayed release of the active ingredient after administration to a mammal. For example, the formulation can be any one selected from the group consisting of plasters, granules, lotions, liniments, aerosols, sprays, extracts, elixirs, ointments, emulsions, suspensions, decoctions, infusions, tablets, suppositories, injections, capsules, creams, lozenges, tinctures, pastes, pills, and soft or hard gelatin capsules.

[0038] The active substance in the product disclosed in the present application accounts for 0.001-99.9 wt% of the total weight of the composition, and the balance is a pharmaceutically acceptable carrier and other additives and the like.

[0039] As used herein, the term "therapeutically effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level includes the type and severity of the subject, age, gender, drug activity, sensitivity to drugs, administration time, administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field.

[0040] As used herein, the term "treatment" of a condition or patient refers to taking steps to acquire a beneficial or desired result, including clinical results. Beneficial or desired clinical results include, but are not limited to, or eliminating, substantially inhibiting, slowing or reversing the progression of a disease, condition, or disorder, substantially ameliorating or alleviating a clinical or aesthetic symptom of some condition, substantially preventing a clinical or aesthetic symptom of a disease, condition, or disorder, and avoiding adverse or undesirable symptoms. Treatment also refers to one or more of: (a) reducing the severity of the disorder; (b) limiting development of symptoms characteristic of the disorder being treated; (c) limiting worsening of symptoms characteristic of the disorder being treated; (d) limiting recurrence of the disorder in patients that have previously had the disorder; and / or (e) limiting recurrence of symptoms in patients that have previously had no symptoms of the disorder.

[0041] As used herein, the term "prevention" refers to reducing the likelihood of onset (or recurrence) of a disease, disorder, condition, or associated symptoms.

[0042] As used herein, "containing," "having," or "including" includes "comprising," "consisting essentially of," "consisting substantially of," and "consisting of"; "consisting essentially of," "consisting substantially of," and "consisting of" are subsumed into "containing," "having," or "including."

[0043] The experimental methods used in the following examples are routine methods unless otherwise specified, and the reagents, methods, and equipment used are routine reagents, methods, and equipment in the art unless otherwise specified.

[0044] Example 1 Analysis of DNT infusion therapy resistance Using transcriptome sequencing technology, in vitro primary cells of AML patients with effective and ineffective DNT therapy were analyzed; the results showed that the CD96 expression level was significantly different in the two groups of patients (P<0.05) Figure 1 , suggesting that high expression of CD96 molecule may be a key factor for the efficacy of DNT infusion therapy in AML patients.

[0045] Example 2 Verification of DNT infusion therapy resistance molecules Using CD96 expression different KG-1a, OCI-AML3, MV4-11, THP-1, U937 and other AML cell lines for verification.

[0046] Flow cytometry was used to detect the CD96 expression levels of different AML cell lines, and the results showed that the CD96 expression levels were in the order of: KG-1a, OCI-AML3, THP-1, U937, MV4-11 (A in Figure 2 ).

[0047] After CTV staining, the expanded DNTs in vitro were co-cultured with different AML cell lines at the effector-to-target ratios of 1:4, 1:2, 1:1, 2:1 and 4:1, respectively. After 2 hours of co-culture, the cells were stained with APC-labeled Annexin V and 7AAD, and apoptosis analysis was performed by flow cytometry. The amount of cell death was calculated according to the following formula: %Specific killing = (%Dead with DNTs − % Dead without DNTs ) / (100-% Dead without DNTs ) 100%。

[0048] The results of the killing experiments of DNTs on the above five cell lines showed that, to some extent, the lower the CD96 expression level of the AML cell line, the better the killing effect of DNTs on it (B and C in Figure 2 ); the higher the CD96 expression level of the AML cell line, the worse the killing effect of DNTs on it, i.e., the CD96 expression level was negatively correlated with the killing effect of DNTs, which further verified the results obtained in Example 1.

[0049] Example 3: In vitro verification of DNTs for reinfusion therapy of tolerance molecules q-PCR was used to detect the CD96 expression differences of primary cells from four AML patients (A in Figure 3 ), and then DNTs were co-cultured with the primary cells from the four AML patients under the same culture conditions and effector-to-target ratios, and the apoptosis of AML cells before and after co-culture was detected (B in Figure 3 ).

[0050] The experimental results showed that the drug resistance of AML primary cells to DNT intervention was positively correlated with the CD96 expression level on the surface of the AML primary cells, i.e., the higher the CD96 expression of the AML primary cells, the lower the killing efficiency of DNTs on them (C in Figure 3 ), indicating that CD96 was a drug resistance molecule for DNTs to kill AML primary cells.

[0051] Example 4: In vitro expansion verification of DNTs for reinfusion therapy of tolerance molecules Due to the large heterogeneity of AML primary cells, in order to further verify the key role of CD96 in DNT treatment resistance of AML patients, the sample size of AML patients was further expanded. After CTV staining of in vitro expanded DNT, they were co-cultured with different AML primary cells at an effector to target ratio of 1:4, 1:2, 1:1, 2:1 and 4:1, respectively. After 2 hours of co-culture, APC-labeled Annexin V and 7AAD were stained, and flow cytometry was used to analyze apoptosis and necrosis. The amount of cell death was calculated according to the following formula: %Specific killing = (%Dead with DNTs − %Dead without DNTs ) / (100-%Dead without DNTs ) 100%。

[0052] The expression of CD96 on 12 AML patient-derived primary cells was detected by flow cytometry (A in Figure 4 , and DNT was used to kill AML primary cells in vitro, and the killing efficiency was detected under the same conditions (B in Figure 4 ). The results still showed that the higher the expression of CD96 in AML primary cells, the worse the killing ability of DNT, and the expression of CD96 in AML primary cells was negatively correlated with the killing ability of DNT (C in Figure 4 ), which further confirmed the above conclusion.

[0053] Example 5: Knockout of CD96 The purpose plasmid for knocking out CD96 was constructed by CRISPR Cas9 system. The knockout site was designed by online design software, and the knockout site was marked on the genomic sequence, and the site with high knockout efficiency and low off-target effect was selected. The purpose plasmid has a green fluorescent and puromycin (pour) resistance gene (A in Figure 5 ), which is packaged into an infectable lentivirus form in 293T cells by assembling with a lentivirus helper plasmid, and is used to infect cell lines such as KG-1a and OCI-AML3 with high CD96 expression. Since the purpose plasmid has a green fluorescent and puromycin resistance gene, the infected cells also have green fluorescence and puromycin resistance. Subsequently, puromycin was used to select successfully transfected cells for purification and expansion.

[0054] The results show that the virus vector with the purpose plasmid is successfully packaged in 293T cells, and green fluorescence can be observed under a fluorescence microscope (A in Figure 6 ); the virus vector is used to infect cell lines such as KG-1a and OCI-AML3 with high CD96 expression, and puromycin is used to select successfully transfected cells for purification and expansion, and the representative figure observed under a fluorescence microscope is shown inFigure 6 B) of FIG. 1C.

[0055] The fluorescence representation after cell infection and the detection results of flow cytometry both prove that the CD96 gene is successfully knocked out in KG-1a and OCI-AML3 cells.

[0056] The genomic sequence of the target plasmid is as follows: SEQ ID No. 1 (sg1): TTACAGTTACAGCAGATGAA; SEQ ID No. 1 (sg2): AATAGAGATAAATCAGACTC.

[0057] Example 6: Effect of CD96 knockout on DNT infusion therapy: Based on the full verification of the successful knockout of CD96 in KG-1a and OCI-AML3 cells, the effect of CD96 knockout on the killing effect of DNT on AML cells was evaluated through a killing experiment. The flow cytometry results show that, under the same co-culture time and effector-target ratio, compared with the control group (NC) without CD96 knockout, the knockout of CD96 significantly improves the killing effect of DNT on OCI-AML3 cells (FIG. 1D). Figure 6 C-D of FIG. 1D), further verifying the above experimental results, and also suggesting that specific blocking of this key molecule CD96 is expected to realize the clinical application value of this target and improve the killing ability of DNT on AML cells.

[0058] Example 7: Effect of CD96 blocker on DNT infusion therapy: The CD96-specific blocker Nelistotug, which has been used in clinical trials for solid tumors, was used for blocking experiments. The blocker was pre-incubated with KG-1a, which has a high expression of CD96, for 24 h, 48 h, and 72 h, and then flow cytometry was used to detect the expression changes of CD96 every 24 h. The results show that after pre-incubation with the blocker, the expression of CD96 in KG-1a decreases sharply; with the extension of time, different concentrations of the blocker eventually make the expression of CD96 tend to a certain level (FIG. 2A). Figure 7 A of FIG. 2A).

[0059] Subsequently, after pre-incubating the CD96 blocker for 72 h, KG-1a cells were co-cultured with DNT to detect the change in killing efficiency (FIG. 2B), and compared with the control group without using the blocker, it can be seen that the blocker significantly improves the killing ability of DNT on KG-1a; when another AML cell line OCI-AML3 is used, it can also be seen that with the increase of the concentration of the blocker, the killing efficiency of DNT on OCI-AML3 cells is improved (FIG. 2C). Figure 7 B of FIG. 2B). Figure 7 C of FIG. 2C).

[0060] The above results show that specific blockade of CD96 reverses DNT treatment resistance mediated by it, suggesting that specific blockade and intervention against CD96 is expected to further improve the effectiveness of DNT infusion therapy for AML patients.

[0061] It should be noted that, in this text, relational terms such as first and second are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "contain" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method, article or equipment including a series of elements not only includes those elements, but also includes other elements not explicitly listed or inherent to such process, method, article or equipment. Without more limitations, the element defined by the statement "including a" does not exclude the presence of other identical elements in the process, method, article or equipment including the element.

[0062] The above examples are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions recorded in the foregoing examples can still be modified, or some technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A predictive marker for acute myeloid leukemia to double negative T cell therapy, characterized in that, The predictive marker is CD96.

2. A prognostic agent for acute myeloid leukemia to double negative T cell therapy, characterized in that, The predictive agent comprises a detection agent for the predictive marker of claim 1.

3. A kit for the prediction of acute myeloid leukemia to double negative T cell therapy, characterized in that, The predictive kit comprises the predictive agent of claim 2.

4. A pharmaceutical composition for the prophylaxis and / or treatment of acute myeloid leukemia, characterized by, The pharmaceutical composition comprises a CD96 inhibitor and double negative T cells.

5. The pharmaceutical composition of claim 4, wherein, The CD96 inhibitor comprises an antibody, siRNA, miRNA, antisense oligonucleotide, antagonist and / or blocker against CD96 or a nucleic acid molecule encoding the protein.

6. The pharmaceutical composition of claim 5, wherein, The CD96 inhibitor is a blocker; preferably, the blocker is Nelistotug.

7. The pharmaceutical composition of claim 4, wherein, The double negative T cells are autologous double negative T cells and / or allogeneic double negative T cells.

8. The pharmaceutical composition according to any one of claims 4 to 7, characterized in that, The pharmaceutical composition further comprises a pharmaceutically or immunologically acceptable carrier or excipient.

9. A pharmaceutical preparation, characterized by, The pharmaceutical preparation comprises the pharmaceutical composition of any one of claims 4-8.

10. Use of the pharmaceutical composition of any one of claims 4-8 and / or the pharmaceutical preparation of claim 9 for the manufacture of a medicament for the prevention and / or treatment of acute myeloid leukemia.

Images