Soybean gmago10 gene and application thereof

Abstract

The application discloses a soybean GmAGO10 gene and application thereof. The nucleotide sequence of the soybean GmAGO10 gene is shown as SEQ ID NO: 3. The application also relates to a protein coded by the soybean GmAGO10 gene, and the amino acid sequence of the protein is shown as SEQ ID NO: 4. The application also relates to application of the soybean GmAGO10 gene in cultivating single-plant high-yield soybean plants. The GmAGO10 mutant soybean plant shows obvious phenotypes of increased flowering quantity and increased branch quantity, and the single-plant yield of the GmAGO10 mutant soybean plant is increased by 79% compared with that of a wild type.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a soybean GmAGO10 gene and its applications. Background Technology

[0002] Soybean (Glycine max) is an important economic crop in China, used for grain, oil, and feed. As a major source of vegetable oil, plant protein, and animal feed protein, soybean plays a vital role in my country's agricultural production.

[0003] Argonaute (AGO) proteins are widely distributed in plants and animals and play important roles in biological development and cellular metabolism. The AGO protein family is a group of proteins that specifically bind to miRNAs during miRNA-mediated gene silencing. AGO protein family members contain four domains: N-terminus, PAZ, MID, and PIWI. The N-terminal sequence is variable and plays a crucial role in the separation of sgRNA from target genes. The PAZ and MID domains recognize the 3' and 5' ends of miRNAs, respectively. The PIWI domain has an RNaseH-like structure and performs miRNA-directed endonuclease activity on complementary mRNA targets.

[0004] The AGO protein family comprises several members, from AGO1 to AGO10. These proteins are core components of the RNA-induced silencing complex (RISC), exhibiting significant species-specificity and functional differentiation across different plant species. They are widely involved in key biological processes such as gene expression regulation, post-transcriptional silencing, and stress responses. The role of soybean AGO10 protein in soybean is currently unknown; therefore, exploring its function is of great significance for soybean breeding. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a soybean GmAGO10 gene and its application.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] This invention provides the soybean GmAGO10 gene, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0008] The present invention also provides a protein encoded by the soybean GmAGO10 gene, characterized in that its amino acid sequence is shown in SEQ ID NO: 4.

[0009] The present invention also provides a gene editing knockout vector for the soybean GmAGO10 gene.

[0010] This invention also provides the application of the soybean GmAGO10 gene in the breeding of high-yielding single soybean plants. Homozygous GmAGO10 mutant soybean plants obtained using CRISPR / Cas9 have a 1bp deletion compared to the wild type, resulting in a mutation at position 448 (leucine amino acid) and premature termination of translation.

[0011] Compared with the control soybean plants, the GmAGO10 mutant soybeans showed a significant increase in the number of flowers and branches, and the yield per plant of the mutant was significantly increased by 79% compared with the wild type.

[0012] Furthermore, during the breeding process, CAPS analysis was conducted on GmAGO10 gene-edited mutant soybean plants. The wild-type soybean GmAGO10 gene contains an MnlI restriction site and can be cleaved by MnlI; however, the GmAGO10 gene in the mutant soybean plants had its restriction site destroyed after editing and could not be cleaved by MnlI.

[0013] The beneficial effects of this invention are: (1) This invention relates to the soybean GmAGO10 gene and its application. When the soybean GmAGO10 gene is used to cultivate high-yielding soybean plants, the translation of the GmAGO10 protein in mutant soybean plants terminates prematurely and cannot perform its normal function. Compared with the control wild-type soybean plants, the GmAGO10 mutant soybean plants show a significant increase in the number of flowers and branches, and the yield per plant of the GmAGO10 mutant soybean plants is significantly increased by 79% compared with the wild type.

[0014] (2) Based on the editing site of the GmAGO10 mutant gene, the present invention designed a CAPS molecular marker digested by the restriction endonuclease MnlI, which can be used to distinguish between GmAGO10 mutant soybean plants and wild-type plants, and has good application prospects in molecular breeding. Attached Figure Description

[0015] Figure 1 This represents the expression levels of GmAGO10 in different parts of soybean;

[0016] Figure 2 These are the results of Cas9 and sgRNA detection in soybean leaves; among them, Figure 2 A represents the Cas9 detection result. Figure 2 B represents the sgRNA detection result;

[0017] Figure 3 This shows the location of the GmAGO10 target and its sequencing data.

[0018] Figure 4 This represents the relative gene expression level of GmAGO10 in gene-edited soybeans;

[0019] Figure 5 These are phenotypic diagrams of wild-type plants and mutant plants; where WT represents wild-type plants and GmAGO10 represents mutant plants.

[0020] Figure 6 This is a phenotypic analysis of wild-type and mutant plants; where WT represents wild-type plants and GmAGO10 represents mutant plants. Figure 6 A represents the flowering time of wild-type and mutant plants; Figure 6 B represents the number of flowers in the wild-type and mutant plants; Figure 6 C represents the number of branches in wild-type and mutant plants; Figure 6 D represents the internode distance between wild-type and mutant plants;

[0021] Figure 7 It represents the relative expression level of the GmLFY2 gene;

[0022] Figure 8 This refers to the yield per plant of wild-type and mutant plants;

[0023] Figure 9 This is an agarose gel electrophoresis image of CAPS-specific molecular markers. Detailed Implementation

[0024] The present invention will now be described in detail with reference to the accompanying drawings. Example

[0025] I. Sequencing of the GmAGO10 coding gene

[0026] Primers were designed based on the GmAGO10 sequence information predicted by the phytozome website. PCR amplification was performed using cDNA from leaves of soybean at the VC stage (DN50) as a template, followed by sequencing. The PCR amplification primers were:

[0027] Upstream primer: ATGAAGGATCCAGAGGAGCA, SEQ ID NO: 1;

[0028] Downstream primer: TCAACAGTAAAACATAACATTCTTCACC, SEQ ID NO: 2.

[0029] RNA was extracted from DN50 soybean leaves during the VC stage using the Trizol method. The specific steps were as follows: The mixture was pre-chilled in a refrigerated centrifuge. After centrifuging in a Phasemaker tube for 1 min, 1 mL of TRIzon Reagent and 200 µL of chloroform were added. Soybean leaf tissue was ground and added to a Phasemaker tube. After vigorous shaking, the mixture was allowed to stand at room temperature. The mixture was then centrifuged at 4 °C. After centrifugation, the supernatant was collected and an equal volume of isopropanol was added. The mixture was allowed to stand at room temperature for 30 min before centrifugation. The supernatant was discarded. 75% ethanol was added. The precipitate was washed, centrifuged, and air-dried at room temperature. ddH₂O was then added.

[0030] Reverse transcription was performed according to the instructions provided with the Takara reverse transcription kit. The system was as follows: Add 2 μL of 25×gDNA Eraser Buffer, 1 μL of 1gDNA Eraser, 1 μg of Total RNA, and 6RNase-Free dH2O to a PCR tube, bringing the total volume to 10 μL. Incubate at 42°C for 2 min. Then add 4 μL of 45×Primer Script Buffer, 1 μL of 3Primer Script RT Enzyme, 1 μg of 5RT Primer MIX, and 4 μL of 6RNase-Free dH2O to a centrifuge tube. Incubate at 37°C for 15 min; 85°C for 5 s; and 4°C ± ∞. The product was recovered and cloned into the pGEM-Teasy vector for sequencing to obtain the complete cDNA sequence.

[0031] II. Expression characteristics of GmAGO10 gene in different tissue sites

[0032] Transcriptome-level expression analysis of GmAGO10 in different tissues of DN50 soybean was performed. Soybean growth and culture conditions were: 26°C greenhouse, 14 hours light / 10 hours dark. RNA (at least 2 μg) was extracted from meristems, leaves, epicotyls, hypocotyls, and roots of DN50 soybean at the VC stage. Library construction was performed using the Illumina Truseq™ RNA sample prep Kit. mRNA was specifically isolated, purified, and fragmented using magnetic beads containing oligo dT. Single-stranded cDNA was synthesized into double strands, and end-completion repair was performed. PCR amplification was performed (PCR primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2), followed by electrophoretic recovery and purification. The target samples were then sequenced.

[0033] After sequencing, the raw data undergoes quality control analysis. The qualified data is compared with the reference genome. The comparison rate and coverage are used to determine whether the preset qualified threshold has been reached, and whether further analysis is needed. Finally, the gene expression level, i.e., RPKM (fragments-per-kilobase-per-million), is calculated using cufflinks (http: / / cole-trapnell-lab.github.io / cufflinks / ).

[0034] The results show that, Figure 1 As shown, the GmAGO10 gene has the highest expression level in the soybean apical meristem.

[0035] III. Development and Practical Application of GmAGO10 in the Field of Genetic Engineering Technology

[0036] 1. Target primer design and CRISPR / Cas9 knockout vector construction:

[0037] Using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), sgRNAs targeting the GmAGO10 gene sequence (gene ID: Glyma.06G213300) were designed.

[0038] sgRNA sequence: GCTTGCATCAGTTGAGGCT CGG, SEQ ID NO:9.

[0039] The specific steps are as follows: Add 7.5 µL of sgRNA-F (SEQ ID NO: 7), 7.5 µL of sgRNA-R (SEQ ID NO: 8), and 10 µL of ddH2O to the PCR tube. Place the PCR tube containing the reagents into a beaker containing water at 95°C and allow the water to cool to room temperature. The vector digestion system is as follows: 1 µg of vector, 3 µL of enzyme, 5 µL of 10×CutSmart Buffer, and ddH2O to a final volume of 50 µL. Incubate at 37°C for 5 hours. After the water bath, perform electrophoresis and select clear and bright bands for gel recovery to increase the vector concentration. The primer dimer was ligated to the corresponding Cas9 vector. The reaction mixture consisted of 1 µg Cas9 vector, 2 μL 10×T4 DNA Ligase Buffer, 1 μL T4 DNA Ligase, 0.5 μL primer dimer, and ddH2O to a final volume of 20 μL. The ligation reaction was carried out overnight in a 16°C metal bath. The sgRNA was initiated by GmU6.

[0040] 2. Genetic transformation of soybean GmAGO10-CRISPR / Cas9:

[0041] The recipient variety in this experiment was DN50 soybean, and the bacterial strain was Agrobacterium EHA105, purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0042] The specific steps for strain detection are as follows: After cultivation, observe the color of the bacterial solution in the test tube; an orange-yellow color is optimal. Strain viability determination: After overnight cultivation, preheat the spectrophotometer for 20 minutes before measuring the OD value. When the OD value of the bacterial solution is between 0.600 and 0.750, measure every 15 minutes; when the OD value is between 0.750 and 0.900, measure every 10 minutes. Infecting the recipient with the bacterial solution: Select plump seeds with undamaged seed coats for infection. Under a microscope, use a scalpel to cut at the apical meristem of the cotyledon. After cutting, place the seeds in an infection solution containing Agrobacterium and infect for 3 hours. Co-culturing Agrobacterium and recipient: Spread the infected cotyledons flat on a petri dish and let them stand for 20 minutes in a clean bench. Then place the cotyledons into a culture medium lined with filter paper and incubate at 24°C in the dark for 4 days. After the cotyledons have finished culturing, they are placed in recovery medium. After recovery culture, callus tissue with good growth is placed in selection medium containing selection agent. After preliminary selection, explants with good callus growth are selected and placed in elongation selection medium. After elongation selection, the explants are placed in elongation medium. Plants that test positive for PCR are selected, marked, and 20-30 ml of sterile water is added to the medium. The plants are incubated at room temperature for 24 hours. The medium is then broken up with tweezers, the plants are removed, and placed in vermiculite (which should be pre-soaked in water). The plants are then transplanted into the growth chamber: a soil-to-vermiculite ratio of 3:1 is placed in an oven at 75°C for 5 minutes, followed by transplanting.

[0043] 3. Screening and identification of GmAGO10 mutants:

[0044] After transplanting the T0 generation seedlings, 14 T0 generation soybean plants were subjected to positive testing. Genomic DNA was extracted from fresh leaves of the T0 generation soybeans. Using the pSC1 / Cas9-GmAGO10-sgRNA recombinant plasmid as a positive control and ddH2O as a negative control, PCR detection was performed on the 14 T0 generation lines, with specific amplification using Cas9-specific primers and sgRNA primers.

[0045] Cas9-F: CCCAAGAGGAACAGCGATAAG, SEQ ID NO: 5;

[0046] Cas9-R: GTCGATGGTGGTGTCAAAGTA, SEQ ID NO: 6;

[0047] sgRNA-F: AGGTCTCATGTCAAAGGCCC, SEQ ID NO: 7;

[0048] sgRNA-R:ACTTTCTGCATTAGATTTCCCAGA, SEQ ID NO:8.

[0049] Test results as follows Figure 2 As shown, sgRNA and Cas9 protein were detected in plants 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, and 14, indicating that these were positive plants. Further sequencing of these positive plants revealed the target editing site, located in exon 9. Sequencing results showed a homozygous GmAGO10 mutant with a 1bp deletion compared to the wild type, resulting in a mutation at position 448 (leucine amino acid) and premature translation termination (see...). Figure 3 ).

[0050] Terminal meristems of mutant and wild-type plants were collected. RNA was extracted from the VC stage of soybean terminal meristems using the Trizol method. The procedure was as follows: A pre-chilled refrigerated centrifuge was used; after centrifuging in a Phasemaker tube for 1 min, 1 mL of TRIzon Reagent and 200 µL of chloroform were added. Soybean leaf tissue was ground and added to a Phasemaker tube, vigorously shaken, and then allowed to stand at room temperature. Centrifugation was then performed at 4 °C. After centrifugation, the supernatant was collected and an equal volume of isopropanol was added. After standing at room temperature for 30 min, centrifugation was performed. The supernatant was discarded, and 75% ethanol was added. The precipitate was washed, centrifuged, air-dried at room temperature, and then ddH2O was added.

[0051] Reverse transcription was performed according to the instructions provided with the Takara reverse transcription kit. The system was as follows: Add 2 μL of 25×gDNA Eraser Buffer, 1 μL of 1gDNA Eraser, 1 μg of Total RNA, and 6RNase-Free dH2O to a PCR tube, bringing the total volume to 10 μL. Incubate at 42°C for 2 min. Then add 4 μL of 45×Primer Script Buffer, 1 μL of 3Primer Script RT Enzyme, 1 μg of 5RT Primer MIX, and 4 μL of 6RNase-Free dH2O to a centrifuge tube. Incubate at 37°C for 15 min; 85°C for 5 s; and 4°C ± ∞. After reverse transcription, the resulting cDNA was diluted 200-fold. The diluted cDNA was then used as a template for quantitative PCR. The system was: 6.3 μL cDNA, 0.6 μL Primer, 7.5 μL Mix, and 5.3 μL ddH2O. Each treatment was performed in triplicate. 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing / extension at 60℃ for 1 min, 40 cycles; 95℃ for 15 s. The tublin gene was used as an internal control, and relative expression levels were calculated based on the CT values ​​obtained from the reaction. Each sample was tested three times.

[0052] qGmAGO10-F:GGTACAAGTAGACCAGCACACT, SEQ ID NO: 10;

[0053] qGmAGO10-R:GTATGCTGGAGGCACTACTGA, SEQ ID NO: 11;

[0054] GmTUB-F:TCTTGGACAACGAAGCCATCT, SEQ ID NO: 12;

[0055] GmTUB-R: TGGTGAGGGACGAAATGATCT, SEQ ID NO: 13;

[0056] Quantitative real-time PCR analysis showed that the relative expression level of GmAGO10 in gene-edited soybeans was significantly reduced (see [link to data]). Figure 4 ).

[0057] 4. Phenotypic analysis of GmAGO10 mutant plants:

[0058] The greenhouse light and temperature conditions for the homozygous GmAGO10 mutant plants and the control DN50 plants were: temperature 26±2℃, and a photoperiod of 14 hours light / 10 hours dark. The flowering time, number of flowers, number of branches, and internode spacing of the mutant and DN50 plants were as follows: Figure 5 As shown.

[0059] The results showed that by day 50, the mutant plants already had obvious flower buds, but the wild-type plants had not yet entered the flowering period; by day 55, all the mutant plants had flowered, while the wild-type plants also had a few flower buds but showed no signs of flowering. Plants at this growth stage were photographed and compared with wild-type plants (see...). Figure 5 The flowering time of the wild-type plant was 66 days, while that of the mutant plant was approximately 56 days, meaning the mutant plant flowered earlier than the wild-type plant. The wild-type plant produced 132.8 flowers, while the mutant plant produced 169.3 flowers, indicating a higher number of flowers in the mutant plant. The wild-type plant had 4.4 branches, while the mutant plant had 6.2 branches. The internode distance of the wild-type plant was 3.4 cm, while that of the mutant plant was 5.0 cm (see...). Figure 6 ).

[0060] The GmAGO10 mutant plants exhibited a shortened flowering time, a significant increase in the number of flowers, internode spacing, and branch number, indicating that GmAGO10 affects the number of soybean flowers and has the potential to increase soybean yield (see...). Figure 6 ).

[0061] IV. Expression analysis of the flowering-related gene GmLFY2 in the apical meristem of the GmAGO10 mutant

[0062] Fresh apical meristems of soybean at the VC stage of the GmAGO10 mutant were collected. RNA was extracted using the Trizol method and used for reverse transcription. The resulting cDNA was diluted 200-fold and then used as a template for quantitative PCR. The reaction mixture consisted of: 6.3 μL cDNA, 0.6 μL Primer, 7.5 μL Mix, and 5.3 μL ddH2O. Each treatment was performed in triplicate. The tublin gene was used as an internal control, and the relative expression level was calculated based on the ct values ​​obtained from the reaction. Each sample was repeated three times. The reaction cycle consisted of: 95℃ for 10 min; denaturation at 95℃ for 15 s; annealing / extension at 60℃ for 1 min, for 40 cycles; 95℃ for 15 s.

[0063] qGmLFY2-F:ACATCAAGCGCCGCAATAAC, SEQ ID NO: 14;

[0064] qGmLFY2-R:TCCGACAAGCCTTCTTGAGAG, SEQ ID NO: 15;

[0065] GmTUB-F:TCTTGGACAACGAAGCCATCT, SEQ ID NO: 12;

[0066] GmTUB-R: TGGTGAGGGACGAAATGATCT, SEQ ID NO:13.

[0067] The results showed that significantly increased expression levels of the GmLFY2 gene promoted flowering (see...). Figure 7 ).

[0068] V. Yield per plant of GmAGO10 mutant

[0069] The mutant exhibited a significant increase in both flowering and branching numbers. Measurements of individual plant yield showed that the mutant's yield was 79% higher than the wild type (see...). Figure 8 ).

[0070] VI. CAPS Detection of GmAGO10 Mutant

[0071] DNA was extracted from mutant and wild-type soybean plants. Fresh plant leaves were placed in centrifuge tubes, labeled, and immediately placed in liquid nitrogen. The tubes were then vigorously shaken to thoroughly pulverize the leaves. 500 μL of 2% CTAB was added to the centrifuge tubes, and the mixture was thoroughly vortexed before being placed in a 75°C oven for 1 hour. Then, 500 μL of chloroform was added, and the mixture was thoroughly vortexed before centrifuging at 12000 rpm for 10 minutes. The supernatant was transferred to a new centrifuge tube, and 50 μL of 3M sodium acetate was added. Then, 500 μL of isopropanol was added, and the mixture was thoroughly vortexed before being allowed to stand for 50 minutes. The tubes were then centrifuged at 12000 rpm for 10 minutes, and the supernatant was discarded. 500 μL of 70% ethanol was added, and the mixture was vortexed to resuspend the precipitate. After centrifuging for 5 minutes, the supernatant was discarded, and the tubes were inverted and air-dried. When no ethanol remained in the centrifuge tubes, 50 μL of sterile deionized water was added to dissolve the precipitate. The tubes were then stored at 4°C.

[0072] CAPS primers were designed at the mutation site to identify the GmAGO10 mutant. The CAPS primers were:

[0073] CAPS-F: AGTTTTGTTTGGCCTGGCCTGC, SEQ ID NO: 16;

[0074] CAPS-R: CTAAAGGGACAAGAAGAGCC, SEQ ID NO:17.

[0075] PCR amplification was performed on the extracted DNA from mutant and wild-type soybean plants using CAPS primers. The reaction program was: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 40 s, 35 cycles; 72℃ for 5 min; 4℃ at ∞. After the PCR reaction, the mutation sites were digested with MnI-specific restriction enzyme and incubated at 37℃ for 4 h. A 3% agarose gel was then prepared and electrophoresed at 80V for 40 min.

[0076] The MnlI restriction enzyme digestion test results showed that the wild type could be digested by MnlI, while the mutant could not. This result can be used to distinguish between GmAGO10 mutant plants and wild-type plants (see...). Figure 9 It has good application potential in the field of breeding practice.

[0077] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. The application of the soybean GmAGO10 gene in the breeding of high-yielding single soybean plants, characterized by: The nucleotide sequence of soybean GmAGO10 is shown in SEQ ID NO:3; the application is to obtain homozygous GmAGO10 mutant soybean plants using CRISPR / Cas9, and the sgRNA sequence corresponding to the target site is shown in SEQ ID NO:

9. Compared with the wild type, it has a 1bp deletion, resulting in a mutation at position 448 of the leucine amino acid and premature termination of translation.

2. The application according to claim 1, characterized in that: During the breeding process, CAPS analysis was performed on GmAGO10 gene-edited mutant soybean plants. The GmAGO10 gene in wild-type soybean contains an MnlI restriction site and can be cleaved by MnlI. However, the GmAGO10 gene in mutant soybean plants had its restriction site destroyed after editing and could not be cleaved by MnlI. The CAPS primers are shown in SEQ ID NO: 16 and SEQ ID NO: 17.

Images