Characteristic nucleotide sequence, specific primer pair, kit and detection method for detecting mango bacterial black spot bacteria
By designing characteristic nucleotide sequences and specific primer pairs, combined with real-time PCR technology, the problem of rapid and accurate detection of bacterial black spot disease in mangoes has been solved, achieving highly sensitive and specific disease diagnosis and supporting early prevention and control as well as disease severity assessment.
Patent Information
- Application Number
- CN202511975085.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-25
- Publication Date
- 2026-01-27
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate detection of bacterial black spot pathogens in mangoes. Traditional methods are prone to misdiagnosis and are cumbersome to operate. Conventional PCR lacks sufficient sensitivity and specificity, making it impossible to achieve early diagnosis and effective control of the pathogen.
By designing characteristic nucleotide sequences and specific primer pairs, and combining them with quantitative real-time PCR technology, a rapid, specific, and sensitive detection method was established. Specific gene fragments of pathogens were obtained through comparative genomics screening. PCR amplification conditions and fluorescence detection were optimized to construct a detection system with high specificity and sensitivity.
It enables rapid and accurate diagnosis of bacterial black spot disease in mangoes, shortens the detection cycle, improves the sensitivity and specificity of detection, allows for early detection of pathogens, supports timely prevention and control of the disease, has quantitative analysis capabilities, and is suitable for disease severity assessment and epidemiological studies.
Smart Images

Figure CN121406809A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology detection technology, and more specifically, to a characteristic nucleotide sequence, specific primer pairs, kit, and detection method for detecting bacterial black spot disease of mango. Background Technology
[0002] Bacterial black spot disease of mango, also known as bacterial angular leaf spot or bacterial canker, is a major bacterial disease of mangoes caused by *Xanthomonas citri* pv. mangiferaeindicae (Xcm). It can occur on leaves, branches, flowers, and fruits, causing premature leaf and fruit drop, reduced yield, or rendering the fruit unmarketable, resulting in significant economic losses to mango production. In the disease cycle, the pathogen overwinters in diseased tissues (disease-affected leaves, branches, and fruits), becoming the primary source of primary infection. Additionally, weeds in or around the orchard may also serve as overwintering hosts and primary sources of infection for the pathogen. The pathogen spreads via wind, rain, water, and contact, or via infected seedlings, scions, and fruits over long distances. The pathogen primarily enters through wounds, stomata, and hydathodes, with an incubation period generally of 5–15 days. High temperature and humidity favor the occurrence and spread of diseases. Traditional diagnosis of bacterial black spot disease in mangoes relies on symptoms and pathogen culture characteristics; however, this method is prone to misdiagnosis, and the pathogen isolation and culture process is cumbersome, often hindering timely and accurate control. Once mangoes enter the disease stage, pesticide application and other control methods are no longer effective. Therefore, there is an urgent need to find a rapid, accurate, and efficient detection method to accurately diagnose bacterial black spot disease in mangoes during its latent stage, enabling timely prevention and control, and providing technical support for the effective control of this disease.
[0003] With the rapid development of molecular biology techniques, PCR technology has been widely used in the detection of plant pathogens. Currently, conventional PCR is used to detect bacterial black spot disease in mangoes, but this method has limitations in sensitivity and specificity, and can only qualitatively detect the presence of pathogens. Quantitative real-time PCR, which combines PCR technology with fluorescence detection, can achieve quantitative analysis of pathogen DNA. It has the advantages of high specificity and sensitivity, enabling earlier and more timely detection of pathogens, which is of great significance for the early diagnosis and control of bacterial black spot disease in mangoes.
[0004] To address these issues, this application proposes a characteristic nucleotide sequence, specific primer pairs, kit, and detection method for detecting bacterial black spot disease of mango. Summary of the Invention
[0005] The purpose of this invention is to solve the technical problems mentioned in the background art above, and to provide a characteristic nucleotide sequence, specific primer pairs, kit and detection method for detecting bacterial black spot disease of mango. This invention obtains specific gene fragments of the pathogen based on comparative genomics screening, and designs primers accordingly to establish a real-time PCR detection method, which has the advantages of being rapid, highly specific, highly sensitive and stable.
[0006] The above-mentioned objective of the present invention is achieved as follows:
[0007] One aspect of the present invention provides a characteristic nucleotide sequence for detecting bacterial black spot disease of mango, wherein the characteristic nucleotide sequence is selected from at least one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. These sequences originate from conserved regions of pathogen-specific genes (XCM_RS13460 and XCM_RS03200).
[0008] SEQ ID NO: 1 (229 bp):
[0009] TCGGCTTGCCATAGAGCGAACCGTACAGAAAAGAGAATGGCTCAACTAGCAGAATATCTTCGACCGGCCAGTCAAGTGTTACCAATTCCATCGACCAGCCATCTTGGGTAGAGATAGGAAGCCCGCCACCAAAGAGGCCGGATATACGGACAGTTTTCCCTTGGAGCGGGCCGATGCCGTCTACCTCAAGAAACTGCTCATTCCCATAGTACTCGTCATAGTCCCGCGC
[0010] SEQ ID NO: 2 (285 bp):
[0011] TCGTCGTTTCTAGCGCAGGGCGTGGAGTCATTGACTGCCGCTCCGGCGAGAAGGTCGCGCGGGACTATGACGAGTACTATGGGAATGAGCAGTTTCTTGAGGTAGACGGCATCGGCCCGCTCCAAGGGAAAACTGTCCGTAT ATCCGGCCTCTTTGGTGGCGGGCTTCCTATCTCTACCCAAGATGGCTGGTCGATGGAATTGGTAACACTTGACTGGCCGGTCGAAGATATTCTGCTAGTTGAGCCATTCTCTTTTCTGTACGGTTCGCTCTATGGCAAGCCGA
[0012] The specific nucleotide sequence of mango bacterial black spot disease amplified by the primer pair shown in SEQ ID NO: 6 and SEQ ID NO: 7 has a length of 285 bp.
[0013] SEQ ID NO: 3 (319 bp):
[0014] GCAACTGCGGAGAACATCGACGGATGAGTGCAGCTGAGCTGCGTAGCATGCCTAGAAAGATGCCGGTGATTCAAGTCAAGCATGCTGAGCGCGATCACAATTACGTGGTCATTGGCGATTGGCGCGACAGAGCCGTCGGCGATCACGCGGTCGTCGTTG ATCCATGGCCAATGCTGAAGAAAGTGCATACGTATGGAGAACGGCTGGAAAGTTCCGCTCCCATTCCCCTGATGTCTTATGCCCCGGACCAGCAGAGCCAAACCCCTTGCTTGCTCAAGCGCTGGCGGCTGAGCCTGCAGATAATTCAAAGATGGAGCG
[0015] The specific nucleotide sequence of mango bacterial black spot disease amplified by the primer pair shown in SEQ ID NO: 8 and SEQ ID NO: 9 has a length of 319 bp.
[0016] Another aspect of the present invention provides a specific primer pair for detecting bacterial black spot disease of mangoes, said primer pair being selected from at least one of the following:
[0017] (1) A primer pair consisting of the upstream primer shown in SEQ ID NO:4 and the downstream primer shown in SEQ ID NO:5;
[0018] That is: Primer pair 51:
[0019] Upstream primer 51-F:
[0020] 5'-TCGGCTTGCCATAGAGCGAAC-3' (SEQ ID NO: 4);
[0021] Downstream primer 51-R:
[0022] 5'-GCGCGGGACTATGACGAGTA-3' (SEQ ID NO: 5);
[0023] The amplification product was 229 bp (SEQ ID NO: 1);
[0024] (2) A primer pair consisting of the upstream primer shown in SEQ ID NO: 6 and the downstream primer shown in SEQ ID NO: 7;
[0025] That is: Primer pair 52:
[0026] Upstream primer 52-F:
[0027] 5'-TCGGCTTGCCATAGAGCGAAC-3' (SEQ ID NO: 6);
[0028] Downstream primer 52-R:
[0029] 5'-TCGTCGTTTCTAGCGCAGGG-3' (SEQ ID NO: 7);
[0030] The amplification product is 285 bp (SEQ ID NO: 2);
[0031] (3) Primer pair consisting of the upstream primer shown in SEQ ID NO: 8 and the downstream primer shown in SEQ ID NO: 9.
[0032] That is: Primer pair 56:
[0033] Upstream primer 56-F:
[0034] 5'-GCAACTGCGGAGAACATCGACGGAT-3' (SEQ ID NO: 8);
[0035] Downstream primer 56-R:
[0036] 5'-CGCTCCATCTTTGAATTATCTGC-3' (SEQ ID NO: 9);
[0037] The amplification product was 319 bp (SEQ ID NO: 3).
[0038] Another aspect of the present invention provides a real-time PCR detection kit for detecting bacterial black spot disease of mango, the kit containing at least one pair of specific primers as described in claim 2.
[0039] Furthermore, the kit contains the following components:
[0040] Solution I: TB GreenPremix Ex TaqII FAST qPCR (2×);
[0041] Solution II: Primer solution; the concentration of the single-stranded DNA shown in SEQ ID NO.4 and the single-stranded DNA shown in SEQ ID NO.5 in the primer solution is 10 μmol / L;
[0042] Solution III: Sterilized ddH2O;
[0043] Solution IV: Positive control solution; the positive control solution contains genomic DNA of mango bacterial black spot pathogen;
[0044] Solution V: Negative control solution; the negative control solution does not contain genomic DNA of mango bacterial black spot pathogen;
[0045] Solution VI: Quantitative standard solution; the quantitative standard solution contains genomic DNA of mango bacterial black spot pathogen at a concentration of 100 ng / μL.
[0046] Another aspect of the present invention provides a conventional PCR detection method for detecting whether a sample to be tested contains mango bacterial black spot pathogen, comprising the following steps:
[0047] Genomic DNA is extracted from the sample to be tested as a template, and PCR amplification is performed using at least one pair of specific primers as described in claim 2. The amplification products are then detected by electrophoresis. If a specific band corresponding to the primer pair is found in the amplification products, the sample to be tested contains mango bacterial black spot pathogen.
[0048] Furthermore, the PCR amplification reaction conditions are as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 45 s, 62℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 7 min.
[0049] Another aspect of the present invention provides a real-time PCR method for detecting the genomic DNA content of mango bacterial black spot pathogen in a test sample, comprising the following steps:
[0050] S1. Dilute the quantitative standard solution in the kit described in claim 5 to a series of concentrations, use them as templates, use the relevant solutions in the kit as detection reagents, perform real-time PCR amplification, and plot the real-time PCR standard curve.
[0051] S2. Extract total DNA from the sample to be tested and use it as a template for real-time PCR amplification using the primers described in claim 2.
[0052] S3. Based on the fluorescence quantitative PCR standard curve drawn in step S1, calculate the content of mango bacterial black spot pathogen genomic DNA in the sample to be tested.
[0053] Furthermore, the reaction conditions for the fluorescence quantitative PCR amplification are as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 58-65℃ annealing for 1 min, 72℃ extension for 30 s, for 40 cycles.
[0054] Another aspect of the present invention provides a real-time quantitative PCR detection method for detecting whether a sample contains mango bacterial black spot disease, comprising the following steps:
[0055] Total DNA was extracted from the sample to be tested and used as a template for real-time quantitative PCR amplification using the primers described in claim 2. Then, the presence of *C. truncatella* bacterial rot fungus in the sample to be tested was determined based on the Ct value and the amplification curve: if the Ct value was less than or equal to 34 and the amplification curve was positive, the sample to be tested contained *C. truncatella* bacterial rot fungus; if there was no Ct value or the Ct value was greater than or equal to 35 or there was no amplification curve, the sample to be tested did not contain *C. truncatella* bacterial rot fungus.
[0056] In the above-described solution of the present invention:
[0057] Compared with the prior art, the present invention has the following beneficial effects:
[0058] 1. The fluorescent quantitative PCR detection method for bacterial black spot disease of mango established in this invention can be completed from sample processing to obtaining results within a few hours. Compared with the traditional method of pathogen isolation and culture and 16S rDNA identification, which takes 3-4 days, the detection cycle is significantly shortened, realizing rapid diagnosis and response to the disease.
[0059] 2. Based on comparative genomics analysis, this invention screened for the unique characteristic nucleotide sequences of *Aureobasidium mangoeum*, the pathogen causing bacterial black spot disease, and designed multiple pairs of specific primers accordingly. Validation on 153 strains covering the target bacterium, closely related species, other bacteria, and fungi showed that the primers of this invention (especially primer pairs 51 and 52) could stably amplify a single target band from all 34 target bacterium strains, while showing no cross-reactivity with any of the 119 non-target strains, demonstrating excellent interspecies resolution and diagnostic specificity.
[0060] 3. The fluorescence quantitative PCR detection system provided by this invention has extremely high sensitivity, with a detection limit of 1 pg / μL for pure cultured pathogen genomic DNA. It can effectively detect early infection or low concentration of pathogens, providing a powerful technical means for monitoring the incubation period and early warning of diseases.
[0061] 4. This invention establishes a complete standard curve for quantitative real-time PCR (for example, the curve based on primer pair 51 is: Y = -3.446X + 36.587, R² = 0.987), which can accurately quantify the DNA content of pathogens in the sample to be tested. This function enables the method to be used not only for qualitative detection, but also for quantitative assessment of disease occurrence, evaluation of control effects, and research on epidemic dynamics, significantly enhancing its application value.
[0062] 5. The detection system optimized by this invention has high amplification efficiency (up to 95.1%), excellent linearity of the standard curve (R²>0.98), and consistent repeatability results across different batches, ensuring the reliability and repeatability of the detection data and meeting the requirements of standardized testing.
[0063] In summary, this invention provides multiple pairs of rigorously validated specific primers, a highly sensitive quantitative PCR detection method, and a matching kit, thus constructing a molecular detection technology system for mango bacterial black spot pathogens that is rapid, specific, sensitive, quantitative, and stable. This system has significant practical implications for the precise control of this disease. Attached Figure Description
[0064] Figure 1 In this embodiment of the invention, the quality of the template DNA of the tested strain is verified by amplifying the fungal ITS or bacterial 16S rRNA sequence.
[0065] Figure 2 The PCR products of genomic DNA amplified using primer pairs 51(A), 52(B), and 56(C) in the embodiments of this invention are PCR products of genomic DNA amplified using primer pairs 51(A), 52(B), and 56(C).
[0066] Figure 3This is a routine PCR sensitivity test of primer pairs 51(A), 52(B), and 56(C) for Xcm in this embodiment of the invention (lane M: DL2000 DNA ladder; 1: 10 ng / μL; 2: 1 ng / μL; 3: 100 pg / μL; 4: 10 pg / μL; 5: 1 pg / μL; 6: 100 fg / μL; 7: 10 fg / μL; 8: 1 fg / μL; 9: ddH2O).
[0067] Figure 4 This refers to the qPCR sensitivity detection of primer pairs 51(A), 52(B), and 56(C) for Xcm in the embodiments of this invention;
[0068] Figure 5 This invention relates to the PCR detection of bacterial load on artificially inoculated mango leaves at different time points using primer pairs 51 (A1), 52 (B1), and 56 (C1) in this embodiment (lanes M: DL2000 DNA ladder; 1: 0d; 2: 1d; 3: 2d; 4: 3d; 5: 4d; 6: 5d; 7: 6d; 8: no inoculation; 9: ddH2O (DNA concentration for lanes 1-8 is 100ng / μL).
[0069] Figure 6 This invention relates to the sensitivity PCR detection of different concentrations of artificially inoculated mango leaves using primer pairs 51 (A2), 52 (B2), and 56 (C2) in this embodiment (lane M: DL2000 DNA ladder; 1: 100 ng / μL; 2: 50 ng / μL; 3: 10 ng / μL; 4: 1 ng / μL; 5: 100 pg / μL; 6: 10 pg / μL; 7: 1 pg / μL; 8: 100 ng / μL without inoculation; 9: ddH2O).
[0070] Figure 7 This is a PCR detection of the pathogen of mango leaves naturally infected with black spot disease in this embodiment of the invention (lane M: DL2000 DNA ladder; 1-10: collected samples; 11: healthy leaves; 12: positive control Y12-1). Detailed Implementation
[0071] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0072] This invention provides a characteristic nucleotide sequence, specific primer pairs, kit, and detection method for detecting bacterial black spot fungus of mango. The invention downloads the complete genome sequences of bacterial black spot fungus GXG07 and the closely related citrus canker fungus Xcc 29-1 from the NCBI database. A BLAST program is used to perform comparative genomic analysis on the two variants to identify corresponding genes with nucleotide site polymorphisms as candidate specific genes. The candidate gene fragments are then compared with the NCBI database to verify gene specificity. Finally, specific primers capable of amplifying only the DNA of bacterial black spot fungus of mango are designed using Primer Premier 5 software to establish a real-time quantitative PCR detection method for bacterial black spot fungus of mango.
[0073] The implementation of the present invention will be described in detail below with reference to specific embodiments.
[0074] 1. Materials and Methods
[0075] 1.1 Test strains
[0076] The test strains selected in this embodiment were all isolated, identified or preserved by the laboratory of this applicant, totaling 153 strains (Table 1): 7 strains belong to different species of Xanthomonas (including Xanthomonas citrinum mangopathogenic strain Y12-1), the other 33 strains of Xanthomonas citrinum mangopathogenic strain, 66 strains belong to 66 different species of fungi, and 47 strains belong to 47 different species of bacteria.
[0077] Table 1. Information on strains used for screening by detection techniques.
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085] Note: a: ITS accession number; b: 16S rRNA accession number; N: Fungi were identified based on morphological and ITS sequence analysis, bacteria were identified based on morphological and 16S rRNA sequence analysis, and accession numbers were not uploaded.
[0086] 1.2. Main Instruments, Reagents, and Culture Media
[0087] Main instruments and reagents:
[0088] Bacterial genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.), Novel plant genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.), Taq enzyme premix (Premix Taq™, TaKaRaTaq™ Version 2.0 plus dyeTB, Green® Premix Ex Taq™ II FAST qPCR, Takara Bio Engineering (Dalian) Co., Ltd.), Centrifuge (22331 Hamburg, Eppendorf China Ltd.), Fully automated sample grinder (JXFSTPRP-24, Shanghai Jingxin Industrial Development Co., Ltd.), Electrophoresis apparatus (DYY-6C, Beijing Liuyi Instrument Factory), PCR instrument (Biometra Tone 96G, Jena Analytical Instruments AG, Germany), Ultra-micro UV-Vis spectrophotometer (ND2000C, GeneScience (Shanghai) Co., Ltd.).
[0089] Culture medium (sterilized in a 21°C autoclave for 20 min):
[0090] Potato dextrose agar (PDA): 200 g potato, 20 g glucose, 15 g agar powder, and ultrapure water to a final volume of 1 L.
[0091] Nutrient agar (NA) solid medium: 3 g beef extract, 5 g peptone powder, 18 g agar powder, 1000 mL distilled water, adjust pH to 7.
[0092] Nutrient broth (NB): 3 g beef extract, 5 g peptone powder, 1000 mL distilled water, adjusted to pH 7.
[0093] LB solid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 15 g agar powder, and ultrapure water to a final volume of 1 L, adjusting the pH to 7.
[0094] LB liquid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, ultrapure water to a final volume of 1 L, adjust pH to 7.
[0095] 1.3 Extraction of Genomic DNA
[0096] Fungal genomic DNA extraction: The tested fungal strains were inoculated onto PDA plates and cultured for 3-5 days. The hyphae were collected, and the hyphae were ground using a fully automated rapid sample grinder. Genomic DNA was extracted according to the instructions of the new plant genomic DNA extraction kit.
[0097] Bacterial genomic DNA extraction: LB culture medium inoculated with the test bacterial strain was placed at 28 °C and 180 r·min. -1 Incubate on a shaker for 12-24 h, collect the bacterial culture, and extract genomic DNA using a bacterial genomic DNA extraction kit;
[0098] Plant genomic DNA extraction: Place the plant tissue in a mortar, add liquid nitrogen, and quickly grind it into powder. Extract the genomic DNA according to the instructions of the plant genomic DNA extraction kit.
[0099] The concentration of DNA was determined using an ultra-micro UV-Vis spectrophotometer.
[0100] 1.4 Primer Design and Screening
[0101] Search for *Xanthomonas citri pv. mangiferaeindicae* in the NCBI (National Center for Biotechnology Information) (https: / / www.ncbi.nlm.nih.gov / genome) to obtain the Xcm GX07 sequence and the *Xanthomonas citri pv. citri* strain Xcc 29-1 sequence. In the TBtools software, open the BLAST option, select BLAST GUI Wrapper, and then select Two Sequence Sets. Input the GX07 and Xcc 29-1 sequences into Set Query Seqs and Set Subject Seqs respectively. Set the E-value threshold to 1e-5, NumofThreads to 2, and output the alignment results in Pairwise mode. Select genes with low similarity (E-value greater than 1e-5) from the alignment results and perform alignment with NCBI to find sites with high nucleotide polymorphism and design primers.
[0102] 1.5 Primer specificity detection
[0103] The ITS sequence (ITS1 / ITS4) of the fungal DNA template and the 16S rRNA sequence (27F / 1492R) of the bacteria were amplified to verify the quality of the template.
[0104] The designed primers were amplified in Xanthomonas strains (Table 2). Primer pairs that could amplify a single target band in Xcm but not in other Xanthomonas strains were preliminarily screened. PCR amplification was performed using DNA from the strains listed in Table 1 with the preliminarily screened primer pairs as templates. Further screening was conducted to identify primer pairs that could stably amplify the target band only in the genomic DNA of Xcm. The selected primer pairs were considered to be primer pairs that could be used for specific detection of Xcm.
[0105] Table 2. PCR primer sequences for bacterial black spot disease.
[0106]
[0107]
[0108]
[0109]
[0110]
[0111] The PCR reaction system for specific detection is 20 μL: 10 μL Premix Taq. TM (0.05 U·μL) -1 ), upstream and downstream primers (10 μmol·L -1 0.8 μL each, 1 μL template DNA (10 ng / μL) -1 Finally, sterile double-distilled water was added to bring the volume to 20 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 45 s, 62℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 7 min. After the reaction, the amplified products were detected by electrophoresis on a 2.0% agarose gel.
[0112] 1.6 Primer sensitivity detection
[0113] The XcmY12-1 genomic DNA was amplified using a micro-volume spectrophotometer at concentrations of 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL, in 10-fold increments, for both conventional PCR and real-time quantitative PCR. The real-time quantitative PCR reaction system for specific detection was 20 μL: 10 μL TBGreen Premix Ex Taq II Fast qPCR, with forward and reverse primers at 0.4 μmol·L⁻¹. -1Add 1 μL of template DNA, and finally add sterile double-distilled water to make up to 20 μL. The PCR reaction program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 58℃ annealing extension for 1 min, 40 cycles.
[0114] 1.7 PCR detection of artificially inoculated Xcm
[0115] Xcm strain Y12-1 was inoculated onto NB medium and cultured at 28℃ and 180 rpm for 24 h. The bacterial concentration was adjusted to 1×10⁻⁶ using sterile water as a control. 8 CFU·mL −1 (OD 600 =1.1), artificially punctured leaves of healthy 2-year-old mango plants grown in greenhouses were used, with eight punctures evenly distributed on each leaf. Sterile cotton soaked in bacterial solution was placed at the wounds, and the leaves were covered with bags to maintain moisture. Inoculated leaves were randomly collected daily on days 0, 1, 2, 3, 4, 5, and 6 until obvious symptoms appeared. DNA was extracted from inoculated and healthy leaves and the concentration was adjusted to 100 ng / μL for detection. The DNA concentration on day 0 was adjusted to 100 ng / μL, 50 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL for routine PCR amplification.
[0116] 1.8 Field Sample Testing
[0117] Mango samples with bacterial black spot disease were randomly collected at different time points from the Modern Agricultural Technology Research and Extension Center of Baise City, Guangxi Zhuang Autonomous Region. Ten samples were collected each time, and DNA was extracted from the samples. PCR detection was performed using primers selected from the primer pool. Genomic DNA of strain XcmY12-1 was used as a positive control, and genomic DNA from healthy mango leaves was used as a negative control. The amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0118] 2. Results and Analysis
[0119] 2.1 Primer specificity detection results
[0120] First, the quality of the genomic DNA extracted from 153 test strains (Table 1) was tested by amplifying fungal ITS and bacterial 16S rRNA sequences. Figure 1 ).
[0121] The designed primers were first used to specifically detect strains of the genus Xanthium. The primers specific to Xcm in Xanthium were used to detect all strains in Table 1. A total of 84 primer pairs were designed, and 3 primer pairs specific to Xcm were selected: primer pair 51, primer pair 52 and primer pair 56 (as shown in Table 3 below).
[0122] PCR amplification was performed using three pairs of primers on the test strains listed in Table 1, and the results are as follows: Figure 2 As shown, the primers stably amplified a single target band from all 34 Xcm strains, while no band was amplified using ddH2O (negative control) or the genomic DNA of other strains as templates. The PCR amplification products of XcmY12-1 were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the sequencing results were compared and analyzed. The results showed that the amplified PCR product sequences were consistent with the expected target fragment sequences during primer design. The amplification product length of primer pair 51 was 229 bp, primer pair 52 was 285 bp, and primer pair 56 was 319 bp, indicating that these three primer pairs are Xcm-specific primers.
[0123] Table 3 Three pairs of Xcm-specific primers
[0124]
[0125] 2.2 Primer sensitivity detection
[0126] 2.2.1 Routine PCR sensitivity detection
[0127] The sensitivity of the Xcm-specific PCR detection system established based on primer pairs 51, 52, and 56 was tested. PCR amplification was performed using 10-fold serially diluted XcmY12-1 strain genomic DNA as templates, and the results are as follows. Figure 3 As shown. For primer pair 51 and primer pair 52, when the DNA template concentration is 10 ng·μL... -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 and 1 pg·μL -1 At that time, the electrophoresis results showed that the target band was present in all samples, and the brightness of the target band decreased sequentially with the decrease of DNA template concentration; when the DNA concentration was as low as 100 fg·μL -1 At that time, no target band was observed, and the negative control also failed to amplify any band. This indicates that the minimum concentration of DNA at X cm that primer pairs 51 and 52 can detect is 1 pg·μL. -1 For primer pair 56, when the DNA template concentration was 10 ng·μL... -1 1 ng·μL -1 and 100 pg·μL -1 At that time, the electrophoresis results showed that the target band was present in all cases, and the brightness of the target band decreased sequentially with the decrease of DNA template concentration; when the DNA concentration was as low as 10 pg·μL -1At that time, no target band was observed, and the negative control also failed to amplify any band. This indicates that the lowest concentration of DNA at which primer pair 56 can detect X cm is 100 pg·μL. -1 .
[0128] 2.2.2 qPCR sensitivity detection
[0129] The mycelial DNA standard samples of serially diluted mango black spot pathogen strain XcmY12-1 (10 1 ng / μL~10 -6 The detection was performed using 10 ng / μL. For primer pair 51 and primer pair 52, the concentration in a 20 μL reaction system was 10 ng / μL. -3 When ng of genomic DNA is detected, Xcm of DNA can be detected, and the amplification curve is flat and normal, with obvious baseline, exponential growth, and plateau phases in fluorescence intensity. Therefore, the detection limit is considered to be 10. -3 In the standard curve for real-time quantitative PCR detection, the logarithmic relationship between Cq value and DNA mass concentration is good, and the linear range for real-time quantitative PCR detection of X cm of DNA is 10. 1 ~10 -3 The calculated standard curves are Y = -3.575X + 41.201 and Y = -3.640X + 41.926, respectively. Figure 4 ), correlation coefficient R 2 The values were 0.984 and 0.982; for primer pair 56, 10 μL of the mixture was used in a 20 μL reaction system. -2 When ng of genomic DNA is detected, Xcm of DNA can be detected, and the amplification curve is flat and normal, with obvious baseline, exponential growth, and plateau phases in fluorescence intensity. Therefore, the detection limit is considered to be 10. -2 ng. The result is as follows Figure 4 As shown in A in the figure. In the standard curve for real-time quantitative PCR detection, the logarithmic relationship between Cq value and DNA mass concentration is good, and the linear range for real-time quantitative PCR detection of X cm of DNA is 10. 1 ~10 -2 The calculated standard curves are Y = -3.477X + 39.157 ( Figure 4 ), correlation coefficient R 2 It is 0.972.
[0130] 2.3 PCR detection of pathogens in mango leaf tissue artificially inoculated with X cm
[0131] In a 28℃ greenhouse, mango leaf tissue samples were taken from mango leaves artificially inoculated with strain XcmY12-1 by puncture. The results showed that the target band was amplified in all diseased mango leaves, while no target band was detected in the control group mango leaves. Figure 5The results showed that the Xcm-specific detection primers and the established PCR detection system were suitable for detecting Xcm in mango leaf tissue samples. By diluting the DNA from mango leaf tissue inoculated on day 0 at different concentrations, it was found that the detection sensitivity of all three primer pairs for artificially inoculated mango leaves was 10 ng / μL. Figure 6 ).
[0132] 2.4 PCR detection of pathogens in mango anthracnose leaves from naturally occurring diseases in the field
[0133] Mango samples for bacterial black spot disease were randomly collected at different time points from the Modern Agricultural Technology Research and Extension Center of Baise City, Guangxi Zhuang Autonomous Region, in two separate collections, with 10 samples collected each time. In the first collection, 6 samples showed the target band of the same size as the positive control. In the second collection, 7 samples showed the target band of the same size as the positive control. Figure 7 The above results indicate that the three primer pairs designed in this study and the established PCR detection method can be used to detect mango black spot disease caused by Xcm.
[0134] Through the above embodiments of the present invention, the present invention has successfully constructed a detection system for mango bacterial black spot disease that integrates high specificity, high sensitivity, accurate quantification, and rapid efficiency by using original characteristic nucleotide sequences and specific primers. The technical solution of the present invention represents a technological upgrade to the diagnostic and monitoring capabilities for this disease, and has significant practical value and application prospects for promoting green prevention and control in the mango industry and ensuring the healthy development of the industry.
[0135] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A characteristic nucleotide sequence for detecting bacterial black spot disease of mango, characterized in that, The characteristic nucleotide sequence is selected from at least one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:
3.
2. A specific primer pair for detecting bacterial black spot disease of mango, characterized in that, The primer pair is selected from at least one of the following: (1) A primer pair consisting of the upstream primer shown in SEQ ID NO:4 and the downstream primer shown in SEQ ID NO:5; (2) A primer pair consisting of the upstream primer shown in SEQ ID NO: 6 and the downstream primer shown in SEQ ID NO: 7; (3) Primer pair consisting of the upstream primer shown in SEQ ID NO: 8 and the downstream primer shown in SEQ ID NO:
9.
3. The specific primer pair according to claim 2, characterized in that, The amplification product of primer pair (1) is 229 bp in length, the amplification product of primer pair (2) is 285 bp in length, and the amplification product of primer pair (3) is 319 bp in length.
4. A real-time quantitative PCR detection kit for detecting bacterial black spot fungus in mangoes, characterized in that, The kit contains at least one pair of specific primers as described in claim 2.
5. The reagent kit according to claim 4, characterized in that, The kit contains the following components: Solution I: TB GreenPremix Ex TaqII FAST qPCR (2×); Solution II: Primer solution; the concentration of the single-stranded DNA shown in SEQ ID NO.4 and the single-stranded DNA shown in SEQ ID NO.5 in the primer solution is 10 μmol / L; Solution III: Sterilized ddH2O; Solution IV: Positive control solution; the positive control solution contains genomic DNA of mango bacterial black spot pathogen; Solution V: Negative control solution; the negative control solution does not contain genomic DNA of mango bacterial black spot pathogen; Solution VI: Quantitative standard solution; the quantitative standard solution contains genomic DNA of mango bacterial black spot pathogen at a concentration of 100 ng / μL.
6. A conventional PCR detection method for detecting whether a sample contains *Mango bacterial black spot*, characterized in that, Includes the following steps: Genomic DNA is extracted from the sample to be tested as a template, and PCR amplification is performed using at least one pair of specific primers as described in claim 2. The amplification products are then detected by electrophoresis. If a specific band corresponding to the primer pair is found in the amplification products, the sample to be tested contains mango bacterial black spot pathogen.
7. The detection method according to claim 6, characterized in that, The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 45 s, 62℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 7 min.
8. A real-time quantitative PCR method for detecting the genomic DNA content of *Mango rot* fungus in a test sample, characterized in that, Includes the following steps: S1. Dilute the quantitative standard solution in the kit described in claim 5 to a series of concentrations, use them as templates, use the relevant solutions in the kit as detection reagents, perform real-time PCR amplification, and plot the real-time PCR standard curve. S2. Extract total DNA from the sample to be tested and use it as a template for real-time PCR amplification using the primers described in claim 2. S3. Based on the fluorescence quantitative PCR standard curve drawn in step S1, calculate the content of mango bacterial black spot pathogen genomic DNA in the sample to be tested.
9. The detection method according to claim 8, characterized in that, The reaction conditions for the quantitative PCR amplification were as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 58℃ annealing for 1 min, 72℃ extension for 30 s, for 40 cycles.
10. A method for detecting whether a sample contains *Mango bacterial black spot* by real-time quantitative PCR, characterized in that, Includes the following steps: Total DNA was extracted from the sample to be tested and used as a template for real-time quantitative PCR amplification using the primers described in claim 2. Then, the presence of mango bacterial black spot fungus in the sample to be tested was determined based on the Ct value and amplification curve: if the Ct value was less than or equal to 34 and the amplification curve was positive, then the sample to be tested contained mango bacterial black spot fungus. If there is no Ct value, or the Ct value is greater than or equal to 35, or there is no amplification curve, then the sample to be tested does not contain mango bacterial black spot pathogen.