Nourishing layer organ-like model and construction method and application thereof

Abstract

The invention discloses a human trophoblast organ-like model and a construction method and application thereof. The method comprises the following steps: firstly, digesting and separating trophoblast cells from human placenta villus, inoculating the trophoblast cells into matrigel, and adding an ADMEM / F12 culture medium containing specific growth factors for culturing to form trophoblast-like organs; then morphological observation is carried out, and expression of P-gp, BCRP and MRP1 / 2 is detected from mRNA and protein level to carry out model verification; a co-incubation method is adopted, a plurality of ABC transporter specific substrates are adopted, and the influence of verapamil, KO143 and probenecid on the transportation of the ABC transporter specific substrates is researched; and finally, the method is applied to evaluation of substrate transport inhibition of a clinical drug on the ABC transporter protein. The human trophoblast organ model is constructed for the first time and is applied to ABC transporter mediated drug transport research, the operation method is efficient and rapid, and the organ model can be widely applied to in-vitro high-throughput screening of clinical drugs on ABC transporter inhibitors. The method has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and specifically relates to a trophoblast organoid model and construction thereof and application thereof in placental ABC (ATP-binding cassette, ABC) transporter-mediated drug transport research. BACKGROUND

[0002] The placenta plays a crucial role in human pregnancy and fetal development. As an extraembryonic organ, the placenta exchanges nutrients, gases, and waste between the mother and the fetus, providing support for the fetus. In addition, the placenta has the function of physiological and immune barrier, which can prevent harmful substances from causing harm to the fetus. Pregnancy-related diseases such as preeclampsia, fetal growth restriction, and unexplained stillbirth are all related to placental development disorders. However, due to the very limited understanding of the human placenta, especially in the first three months of pregnancy, more in-depth research is needed to understand the role of the placenta.

[0003] After embryo implantation, a special cell type, trophoblast cells, will be generated and proliferate extremely rapidly. These trophoblast cells are divided into three different types: cytotrophoblasts (CTB), syncytiotrophoblasts (STB), and extravillous trophoblasts (EVT). These trophoblast cells will exist in the placenta and perform their own functions. After 3 weeks, the entire placenta will contain these different types of trophoblast cells. CTB is derived from the trophoblast ectoderm, which is a highly proliferative cell type with epithelial layer localization. The main function of EVT is to stabilize the placenta and the uterus on the mother, while improving the maternal blood flow and remodeling the maternal spiral arteries. STB becomes the main barrier unit of the placenta, which can organize different localization layers with efflux and influx transporters on both sides of the basement membrane (BM) and the microvillous membrane (MVM). These different transporter functions will also directly affect the drug metabolism and exposure between the mother and the fetus.

[0004] ATP-binding cassette (ABC) transporters are a group of transporters widely expressed in the placenta, playing a crucial role in the exchange of solutes between the maternal and fetal circulation. The main function of ABC transporters is to regulate the levels of drugs, exogenous and endogenous substances through active transport, consuming ATP. Among the ABC transporter superfamily, p-glycoprotein (P-gp, ABCB1), breast cancer resistance protein (BCRP, ABCG2), and multidrug resistance-associated proteins (MRPs, ABCCs) are involved in the transport of most substances and become the main transporters in the placental barrier. The placental barrier can limit the passage of many substances, such as drugs and hormones. Therefore, the role of ABC transporters is very important for protecting fetal health and preventing maternal-fetal rejection. In addition, ABC transporters also affect the effectiveness of drug therapy and the development of drug resistance.

[0005] Due to ethical and practical limitations, the study of trophoblast cells has always been a challenge. Due to the unique characteristics of human placenta, animal models are not suitable for simulating the structure of human placenta. The results of research on animal models should be cautious when extrapolated to humans. In addition, there are some limitations in the trophoblast cell model, such as short lifespan of primary cells, chromosomal abnormalities, and lack of key features of the trophoblast in some cell lines. The establishment of human trophoblast organoid 3D culture system provides great help for the study of trophoblast cells. The complex three-dimensional structure and expression of characteristic markers make the trophoblast organoid an excellent tool for studying early human placenta.

[0006] Compared with placental perfusion models, inner and outer membrane vesicle models, and human trophoblast cell models derived from highly malignant choriocarcinoma cells such as JAR, BeWo, JEG-3, the trophoblast organoid model has great advantages: (1) The cell survival rate is relatively high and can be maintained for a long time; (2) Directly differentiated from trophoblast stem cells, it can more realistically simulate the body environment; (3) The expression level of ABC transporters is more similar to the body, which can better simulate the absorption of drugs in the body. And the operation of the above reported methods is more complicated, which is not conducive to high-throughput screening of drugs. Compared with the above, human trophoblast organoids are closer to the actual situation of the human body and have more research value. SUMMARY

[0007] The purpose of the present application is to overcome the shortcomings of the prior art, and to construct a human trophoblast organoid model and apply it to the study of placental ABC transporter-mediated drug transport.

[0008] The present application provides a trophoblast organoid model. Preferably, a human trophoblast organoid model. The trophoblast organoid model is a human trophoblast organoid, derived from 6-8 weeks human placental trophoblast villi, forming a complex spherical structure via in vitro 3D culture, with irregular surface, characterized by round protrusions similar to placental villi, and hollow structure inside, which can be cultured in vitro for more than 6 months.

[0009] The present application also provides a method for constructing the trophoblast organoid model, i.e. a culture method, which comprises the steps of: inoculating human trophoblast cells obtained by digestion and separation from human placental villi into Matrigel, adding ADMEM / F12 medium containing specific growth factors for culture, to form the trophoblast organoid. Preferably, a human trophoblast organoid model.

[0010] The culture medium used in the construction method, i.e. the ADMEM / F12 medium containing specific growth factors, comprises 500nM A83-01, 2μM Y27632, 1.5μM CHIR99021, 2.5μM Prostaglandin E2, 50ng / mL EGF, 80ng / mL R-spondin-1, 100ng / mL FGF2, 50ng / mL HGF, 1.25mM N-acetyl cysteine, 2mM L-glutamine.

[0011] In a specific embodiment, preferably, the culture medium comprises 500nM A83-01, 2μM Y27632, 1.5μM CHIR99021, 2.5μM Prostaglandin E2, 50ng / mL EGF, 80ng / mL R-spondin-1, 100ng / mL FGF2, 50ng / mL HGF, 1.25mM N-acetyl cysteine, 2mM L-glutamine.

[0012] In the method, as the culture time increases, the volume of the organoid gradually increases and forms a trophoblast organoid structure; when the volume of the trophoblast organoid increases to a certain extent (e.g. 200μm in diameter), stem cells in the organoid begin to differentiate to form new trophoblast cells, showing a "budding" phenomenon.

[0013] The present application also provides a culture medium for culturing the trophoblast organoid model.

[0014] The present application also provides a method for using the trophoblast organoid model for in vitro high-throughput screening of ABC transporter inhibitors for clinical drugs, which comprises the following steps: trophoblast organoid culture, drug gradient dilution, light-free incubation, organoid collection and disruption, fluorescence detection, substrate linear plot, and inhibition evaluation.

[0015] This invention also proposes a method for real-time quantitative analysis of the expression levels of P-gp, BCRP, MRP1, and MRP2 proteins using the aforementioned trophoblast organoid model. The method includes the following steps: villous collection, organoid culture, paraformaldehyde fixation, dehydration, paraffin embedding, embedding, sectioning, immunofluorescence, and microscopic imaging.

[0016] This invention also proposes a method for detecting the mRNA expression levels of P-gp, BCRP, MRP1, and MRP2 using the aforementioned trophoblast organoid model. The method includes the following steps: villous collection, organoid culture collection, JAR cell collection, mRNA extraction, cDNA acquisition, primer design, and real-time quantitative PCR analysis.

[0017] This invention also proposes applications of the trophoblast organoid model in ABC transport protein-mediated drug transport inhibition, in in vitro high-throughput screening of ABC transport protein inhibitors for clinical use, in evaluating ABC transport protein-mediated drug transport inhibition, and in evaluating the effect of inhibitors on the transtrophoblast organoid transport of ABC transport protein fluorescent substrates. Preferably, the drugs include nifedipine, labetalol, clozapine, sertraline, and fluoxetine; and / or, the ABC transport proteins include P-gp, BCRP, MRP1, and MRP2.

[0018] This invention also proposes new sequences, as follows:

[0019] The sequence is obtained using ABCB1 primers: the upstream primer is F: 5'-AGCAGAGGCCGCTGTTCGTT-3' (SEQ ID NO.1), and the downstream primer is R: 5'-CCATTCCGACCTCGCGCTCC-3' (SEQ ID NO.2); the product length is 109 bp.

[0020] ABCG2 primers: upstream primer is F: 5'-GACTTATGTTCCACGGGCCT-3' (SEQ ID NO.3), downstream primer is R: 5'–GGCTCTATGATCTCTGTGGCTTT-3' (SEQ ID NO.4); product length is 175bp;

[0021] ABCC1 primers: upstream primer F: 5'-GCCTGTTTTGGTAAAGAACTGGAAG-3' (SEQ ID NO.5), downstream primer R: 5'–CCTTGGAACTCTCTTTCGGCTG-3' (SEQ ID NO.6); product length 110bp;

[0022] ABCC2 primers: upstream primer is F: 5'-TGCATCTAGGCAAGGTTAACGA-3' (SEQ ID NO.7), downstream primer is R: 5'–GTCCAGGAATGAGGAATTCCAAAAA-3' (SEQ ID NO.8); product length is 223bp.

[0023] This invention is the first to construct a human trophoblast organoid model and apply it to the study of placental ABC transporter-mediated drug transport. Furthermore, the invention uses PBS incubation to promote the release of Rh123, Hoechst33342, CDF, and CFDA. In this invention, trophoblast cells were first isolated from human placental villi by digestion and seeded in matrix gel. They were then cultured in ADMEM / F12 medium containing specific growth factors to form trophoblast organoids. Morphological observation was performed, and the expression of P-gp, BCRP, and MRP1 / 2 at the mRNA and protein levels was detected to validate the model. A co-incubation method was used, employing Rhodamine 123 (Rh123), Hoechst 33342, 5(6)-carboxy-2',7'-dichlorofluorescein (CDF), and 5(6)-carboxyfluorescein diacetate (CFDA) as ABC transporter-specific substrates. The effects of verapamil, KO143, and probenecid on ABC transporter-specific substrate transport were investigated. Finally, the inhibitory effects of clinical drugs nifedipine, labetalol, clozapine, sertraline, and fluoxetine on ABC transporter substrate transport were evaluated.

[0024] This invention is the first to construct a human trophoblast organoid model and apply it to the study of ABC transporter-mediated drug transport. The method is efficient and rapid, and the organoid model can be widely used for high-throughput in vitro screening of ABC transporter inhibitors in clinical practice. The advantages and beneficial effects of this invention include, but are not limited to: compared with human trophoblast cell models derived from high-grade malignant choriocarcinoma cells, such as JAR, BeWo, and JEG-3, the trophoblast organoids proposed in this invention are directly differentiated from trophoblast stem cells, making them physiologically more similar to the trophoblast and better mimicking transmembrane drug transport in placental villi. Compared with placental perfusion models and endometrial and endometrial vesicle models, the human organoid model proposed in this invention has a higher cell viability and higher cell viability, can be maintained for long-term culture, and is more suitable for evaluating drug transport in the placenta during early pregnancy. The collection method in this invention, which uses PBS incubation to induce the release of Rh123, Hoechst33342, CDF, and CFDA, requires no additional reagents or other operations, is simple, rapid, efficient, and cost-effective, making it more suitable for high-throughput drug screening. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 The morphology of human trophoblast organoids from 0 to 8 days after culture. As the number of culture days increases, the organoids gradually increase in size and exhibit a "budding" phenomenon.

[0027] Figure 2 The expression levels of P-gp, BCRP, MRP1, and MRP2 mRNA in trophoblast villi, JAR cells, and trophoblast organoids were determined.

[0028] Figure 3 Results of P-gp, BCRP, MRP1, and MRP2 protein expression in human trophoblast villi and trophoblast organoids. P-gp, BCRP, MRP1, and MRP2 were expressed on the luminal side in the organoids.

[0029] Figure 4 Standard curves for Rh123, Hoechst 33342, CFDA, and CDF are provided. Rh123 is used within the concentration range of 1-500 nM, with a weighting factor of 1 / x. 2 Linear regression showed good curve characteristics (r) 2 >0.99). Hoechst33342, within the concentration range of 20-1000 nM, was weighted by a factor of 1 / x. 2 Linear regression showed good curve characteristics (r) 2 >0.99). The CFDA uses a weighting factor of 1 / x for concentrations ranging from 1-500 nM. 2 Linear regression showed good curve characteristics (r) 2 >0.99). For CDF concentrations in the 1-200 nM range, a weighting factor of 1 / x is used. 2 Linear regression showed good curve characteristics (r) 2 >0.99).

[0030] Figure 5 The effect of inhibitors on the transport of ABC transporter fluorescent substrates across trophoblast organoids was investigated. With increasing incubation time, the concentration of fluorescent substrates increased in both the control and experimental groups; however, due to the inhibition of ABC transporters in the experimental group, the accumulation of fluorescent substrates was slow.

[0031] Figure 6This study evaluated the inhibitory effects of five drugs on drug transport mediated by ABC transporters (P-gp, BCRP, MRP1, and MRP2). Detailed Implementation

[0032] The invention will be further described in detail below with reference to the specific embodiments and accompanying drawings. Except for the contents specifically mentioned below, the processes, conditions, and experimental methods for implementing the invention are all common knowledge and general knowledge in the art, and the invention does not have any particular limitations.

[0033] Example 1: Isolation of human trophoblast cells and culture of trophoblast organoids

[0034] (1) Obtaining human trophoblastic villi: Human placental villi from surgical abortion at 6-8 weeks of gestation were appropriately washed with physiological saline containing dual antibiotics (penicillin and streptomycin).

[0035] (2) Place the fluff into a 50 mL centrifuge tube containing about 25 mL of PBS, place it on ice, and transfer it to a biosafety cabinet.

[0036] (3) Clean the placental tissue in the washing medium with a magnetic stirrer at room temperature, and gently stir for 10 minutes to remove as much contaminated blood and other maternal uterine cells as possible.

[0037] (4) Hold one end of the placenta and scrape off the villi with a scalpel. Discard the remaining fetal membranes.

[0038] (5) Place the scraped down into a 75mL preheated 0.2% trypsin-250 / 0.02% EDTA bottle, stir with a magnetic stir bar, place on a heated magnetic stirrer at 37℃, and stir gently for 3-5 minutes.

[0039] (6) Place the separated cell suspension in a funnel, filter it with sterile gauze, and immediately wash it with a digestion-stopping solution (washing medium containing 20% ​​fetal bovine serum) to inhibit trypsin digestion.

[0040] (7) Centrifuge at 400g for 5 minutes at room temperature to form spherical filtrate, and resuspend the cell particles in washing solution.

[0041] (8) Remove the undigested tissue from the gauze, add 12 ml of collagenase V solution (1.0 mg / mL, containing HAMS F12 / 10% fetal bovine serum), place in a bottle, and further digest with a magnetic stir bar. Cover and place on a heated magnetic stirrer at 37°C, and stir gently for 3-5 minutes.

[0042] (9) Place the cell suspension in a funnel, filter it with sterile gauze, and immediately wash it with a digestion-stopping solution (washing medium containing 20% ​​fetal bovine serum) to inhibit trypsin digestion.

[0043] (10) Centrifuge at 400g for 5 minutes at room temperature to form spheres from the filtrate. Resuspend the cell granules in 1ml Advanced DMEM / F12 medium, transfer to a 1.5mL Eppendorf tube, centrifuge at 600g for 6 minutes, and form spheres at room temperature.

[0044] (11) Estimate the volume of the particles. Gently tap the test tube to loosen the pellets and place them on ice for 2-3 minutes. Add 10× volume of chilled matrix gel and gently mix with a pipette.

[0045] (12) Drop 25 μL of matrix gel / cell suspension into the center of each well of a Corning 48-well tissue culture plate. Incubate for at least 15 minutes.

[0046] (13) Cover each drop of liquid with 250 μL of culture medium (prepared with Advanced DMEM / F12, containing 500 nMA83-01, 2 μMY27632, 1.5 μM CHIR99021, 2.5 μM Prostaglandin E2, 50 ng / mL EGF, 80 ng / mL R-spondin-1, 100 ng / mL LGF2, 50 ng / mL HGF, 1.25 mM N-acetylcysteine, L-glutamine), and then place it in a cell culture incubator at 37°C for culture, changing the culture medium every two days.

[0047] Example 2: Morphological observation of trophoblast organoids

[0048] Trophoblast organoids cultured for 0, 1, 2, 3, 4, 5, and 6 days were observed and photographed under an Olympus IX 71 microscope equipped with an Olympus DP 71 imaging system. The results are as follows: Figure 1 As shown in the figure, the crypt volume gradually increases and forms organoid structures as the culture time increases. When the organoid volume increases to a certain extent, the stem cells in the crypts begin to differentiate and form new crypts, exhibiting a "budding" phenomenon.

[0049] Example 3: Detection of P-gp, BCRP, MRP1, and MRP2 mRNA levels in trophoblast organoids

[0050] (1) Obtaining human trophoblastic villi: The villi of human placenta surgically aborted at 6-8 weeks are appropriately washed with physiological saline containing dual antibiotics (penicillin and streptomycin), and then the fetal membranes are removed with a scalpel, while the villi are preserved.

[0051] (2) Obtaining trophoblast organoids: After culturing trophoblast organoids for 2 days (in 48-well plates), remove them from the cell culture incubator, discard the culture medium, wash twice with PBS, add 1 mL of pre-cooled PBS to each well, gently blow away the matrix gel and transfer it to a 15 mL centrifuge tube, centrifuge at 200×g for 5 min at room temperature, and the precipitate is the trophoblast organoid. Discard the supernatant for later use.

[0052] (3) Obtaining JAR cells: After culturing JAR cells for 2 days, remove them from the cell culture incubator, discard the culture medium, wash twice with PBS, add 1 mL of pre-cooled PBS to each well, scrape off the cells with a cell scraper, centrifuge at 200×g for 5 min at room temperature, and the precipitate is the JAR cells.

[0053] (4) mRNA acquisition: Add 500 μL of Trizol to each tube containing JAR cells, trophoblast villi, and trophoblast organoids, and extract total mRNA according to standard procedures. (Human trophoblast villi were homogenized.)

[0054] (5) Obtaining cDNA: Using the extracted total mRNA as a template (template amount is 1000ng), the cDNA was reverse transcribed into cDNA using a reverse transcription kit under the action of reverse transcriptase. The reverse transcription system was 20μL.

[0055] (6) ABCB1 primer design: The upstream primer was F: 5'-AGCAGAGGCCGCTGTTCGTT-3' (SEQ ID NO.1), and the downstream primer was R: 5'-CCATTCCGACCTCGCGCTCC-3' (SEQ ID NO.2). The product length was 109 bp.

[0056] ABCG2 primer design: upstream primer F: 5'-GACTTATGTTCCACGGGCCT-3' (SEQ ID NO.3), downstream primer R: 5'–GGCTCTATGATCTCTGTGGCTTT-3' (SEQ ID NO.4). Product length is 175bp.

[0057] ABCC1 primer design: upstream primer was F: 5'-GCCTGTTTTGGTAAAGAACTGGAAG-3' (SEQ ID NO. 5), and downstream primer was R: 5'–CCTTGGAACTCTCTTTCGGCTG-3' (SEQ ID NO. 6). The product length was 110 bp.

[0058] ABCC2 primer design: upstream primer F: 5'-TGCATCTAGGCAAGGTTAACGA-3' (SEQ ID NO.7), downstream primer R: 5'–GTCCAGGAATGAGGAATTCCAAAAA-3' (SEQ ID NO.8). Product length is 223 bp.

[0059] ABCB1 product sequence: AGCAGAGGCCGCTGTTCGTTTCCTTTAGGTCTTTCCACTAAAGTC GGAGTATCTTCTTCCAAAATTTCACGTCTTGGTGGCCGTTCCAAGGAGCGCGAGGTCGGA ATGG (SEQ ID NO.9)

[0060] ABCG2 product sequence: GACTTATGTTCCACGGGCCTGCTCAGGAGGCCTTGGGATACTTTG AATCAGCTGGTTATCACTGTGAGGCCTATAATAACCCTGCAGACTTCTTCTTGGACATCAT TAATGGAGATTCCACTGCTGTGGCATTAAACAGAGAAGAAGACTTTAAAGCCACAGAGA TCATAGAGCC (SEQ ID NO. 10)

[0061] ABCC1 product sequence: GCCTGTTTTGGTAAAGAACTGGAAGAAGGAATGCGCCAAGACTA GGAAGCAGCCGGTGAAGGTCGTGTACTCCTCCAAGGATCCTGCCCAGCCGAAAGAGAGT TCCAAGG (SEQ ID NO. 11)

[0062] ABCC2 product sequence: TGCATCTAGGCAAGGTTAACGATTAAATGGTTGGGATGAAAGGTC ATCCTTTACGGAGAACATCAGAATGGTAGATAATTCCTGTTCCACTTTCTTTGATGAAACA AGTAAAGAAGAAACAACAATCATATTAATAGAAGAGTCTTCGTTCCAGACGCAGTCCA GGAATCATGCTGGAGAAGTTCTGCAACTCTACTTTTTGGAATTCCTCATTCCTGGAC (SEQ ID NO.12)

[0063] (7) The expression levels of P-gp, BCRP, MRP1, and MRP2 in trophoblast villi, trophoblast organoids, and JAR cells were analyzed by real-time quantitative PCP.

[0064] The results are as follows Figure 2 As shown, the expression levels of P-gp, BCRP, MRP1, and MRP2 mRNA in trophoblast organoids and trophoblast villi were similar, while the expression levels of ABC transporter mRNA in JAR cells differed significantly from those in trophoblast villi and organoids. Example 4: Immunofluorescence assay was used to detect the expression levels of P-gp, BCRP, MRP1, and MRP2 proteins in trophoblast organoids.

[0065] (1) Obtaining human trophoblastic villi: The villi of human placenta surgically aborted at 6-8 weeks are appropriately washed with physiological saline containing dual antibiotics (penicillin and streptomycin), and then the fetal membranes are removed with a scalpel, while the villi are preserved.

[0066] (2) Obtaining trophoblast organoids: After culturing trophoblast organoids for 2 days (in 48-well plates), remove them from the cell culture incubator, discard the culture medium, wash twice with PBS, add 1 mL of pre-cooled PBS to each well, gently blow away the matrix gel and transfer it to a 15 mL centrifuge tube, centrifuge at 200×g for 5 min at room temperature, and the precipitate is the trophoblast organoid. Discard the supernatant for later use.

[0067] (3) Fixation: The trophoblast organoids were wrapped in weighing paper and placed together with the trophoblast villous tissue in 4% paraformaldehyde and incubated overnight in a shaker at 4°C.

[0068] (4) Rinsing: Rinse the trophoblast organoids and villous tissue with tap water for one day to wash away the fixative.

[0069] (5) Dehydration: The trophoblast organoids and villous tissues were placed in 50%, 75%, 85%, 95%, and 100% ethanol for 1 hour, respectively, using the ethanol dehydration method.

[0070] (6) Transparency: First, place the trophoblast organoids and villous tissues in anhydrous ethanol:xylene (1:1, v / v) for 20 min, and then place them in xylene I and xylene II for 15 min each.

[0071] (7) Wax impregnation: Place the trophoblast organoids and small intestinal tissue in wax I for 30 min, wax II for 2 hours, and finally place them in wax III overnight.

[0072] (8) Embedding: Trim the small intestine tissue to the appropriate size before embedding. After the wax block solidifies, freeze it in a -20℃ refrigerator for 5 minutes and then gently separate it from the lead box.

[0073] (9) Sectioning: Before slicing, remove excess paraffin around the tissue block. Trim the paraffin block into a regular square or rectangle, then fix the paraffin block on the microtome and slice it. The slice thickness is 4μm. After slicing, carefully place the slice in a 42℃ water bath with a brush and spread it. Then attach it to a glass slide, mark it, and bake it in a 62℃ baking machine for 2 hours. After baking, let it cool before storing it in a slide box.

[0074] (10) Immunofluorescence:

[0075] ① Dewaxing: The sections were placed in xylene I (10 min), xylene II (10 min), xylene: 100% ethanol (1:1, v / v) (5 min), 100% ethanol (5 min), 95% ethanol (5 min), 85% ethanol (5 min), 75% ethanol (5 min), and pure water (3 min) in sequence for dewaxing.

[0076] ② Antigen retrieval: Prepare 200mL of sodium citrate (10mM) retrieval solution and pour it into the retrieval box. Insert the slides into the retrieval box one by one in a certain direction, then close the lid tightly and place it in a water bath at 100℃ for 20 minutes. Allow it to cool naturally to room temperature.

[0077] ③ Antigen site blocking: First, wipe the liquid around the slide with filter paper, then draw an oil circle of appropriate size around the slide, and then add 1-2 drops of blocking solution (5% skim milk powder) into the oil circle, and react in a humid chamber for 30 minutes.

[0078] ④ Add primary antibody: Gently shake off the blocking solution, add the prepared primary antibody (P-gp, BCRP, MRP1, MRP2) in PBS to the slide, and incubate the slide flat in a humidified chamber at 4°C overnight. (Add a small amount of water to the humidified chamber to prevent antibody evaporation.)

[0079] ⑤ Add secondary antibody: Discard the primary antibody, wash 3 times with PBST for 3-5 minutes each time, shake the sections slightly dry, add the secondary antibody of the same species as the primary antibody to the circle to cover the tissue, and incubate at room temperature in the dark for 50 minutes.

[0080] ⑥ Counterstaining cell nuclei with DAPI: Place the slide in PBS (pH 7.4) and wash three times on a destaining shaker for 5 minutes each time. After slightly drying the slide, add DAPI staining solution to the circle and incubate at room temperature in the dark for 10 minutes.

[0081] ⑦ Place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker, 5 min each time. Add autofluorescence quencher to the circle for 5 min, then rinse with running water for 10 min.

[0082] ⑧ Mounting: After slightly drying the sections, mount them with an anti-fluorescence quenching mounting medium.

[0083] (11) Microscopic examination and photography: The slides were observed and photographed under a LEICA DM4000 BLED microscope equipped with a LEICA DFC310 FX imaging system, and images were also observed and acquired under a fluorescence microscope. (DAPI was excited at 330-380 nm, emitted at 420 nm, and emitted blue light; FITC was excited at 465-495 nm, emitted at 515-555 nm, and emitted green light; CY3 was excited at 510-560 nm, emitted at 590 nm, and emitted red light. Results are as follows...) Figure 3 As shown in the figure, P-gp, BCRP, MRP1, and MRP2 are expressed on the villous side in the villous tissue, while in the trophoblast organoids, P-gp, BCRP, MRP1, and MRP2 are expressed on the inner edge of the globular organoids. These results indicate that the inner side of the trophoblast organoids mimics the villous side of the trophoblast villi, while the outer side of the organoids mimics the basal side of the trophoblast villi.

[0084] Example 5: Study on drug transport mediated by P-gp, BCRP, MRP1, and MRP2 in trophoblast organoids

[0085] (1) P-gp-mediated drug transport study: Under light-protected conditions, the P-gp fluorescent substrate Rh123 was diluted with PBS to prepare a series of concentration gradients (1, 5, 10, 20, 50, 100, 200, 500 nM) of standard solution, and 100 μL was added to each well of a 96-well plate, with three replicates for each concentration. The 96-well plates were then placed in a multi-functional microplate reader (FLUOStar OPTIMA) under light-protected conditions. ex / λ em Detection was performed at 485nm / 535nm. The graph is plotted with Rh123 concentration on the x-axis and the measured fluorescence value on the y-axis, with a weighting factor of 1 / x. 2 Perform linear regression, the results are as follows Figure 5 As shown. Correlation coefficient r 2 A value >0.99 indicates good standard curve characteristics. After 5 days of organoid culture, the organoids were removed from the cell culture incubator and counted under a microscope. After counting, group experiments were performed under light-protected conditions. The control group received medium containing only Rh123, while the experimental group received medium containing both Verapamil (a P-gp inhibitor) and Rh123. The cells were then incubated at 37°C in a cell culture incubator. The concentration of Rh123 was 5 μM, and the concentration of the inhibitor was 10 μM.

[0086] (2) BCRP-mediated drug transport study: Under light-protected conditions, the BCRP fluorescent substrate Hoechst 33342 was diluted with PBS to prepare a series of concentration gradients (20, 50, 100, 200, 500, 1000 nM) of standard solution, and 100 μL was added sequentially to each well of a 96-well plate, with three replicates for each concentration. The 96-well plates were then placed in a multi-functional microplate reader (FLUOStarOPTIMA) under light-protected conditions, and the solution was analyzed using a laser. ex / λ em Detection was performed at 350nm / 460nm. The concentration of Hoechst 33342 was plotted on the x-axis, the measured fluorescence value on the y-axis, and the weighting factor was 1 / x. 2 Perform linear regression, the results are as follows Figure 4 As shown. Correlation coefficient r 2 A value >0.99 indicates good standard curve characteristics. After 5 days of organoid culture, the organoids were removed from the cell culture incubator and counted under a microscope. After counting, group experiments were performed under light-protected conditions. The control group was given medium containing only Hoechst33342, while the experimental group was given medium containing both KO143 (a BCRP inhibitor) and Hoechst33342. The cells were then incubated at 37°C in a cell culture incubator. The concentration of Hoechst33342 was 5 μM, and the concentration of the inhibitor was 10 μM.

[0087] (3) MRP1 and MRP2-mediated drug transport studies: Under light-protected conditions, MRP1 fluorescent substrate CFDA and MRP2 fluorescent substrate CDF were diluted with PBS to prepare a series of concentration gradients (1, 5, 10, 20, 50, 100, 200, 500 nM) of standard solutions, and then added sequentially to 96-well plates, 100 μL per well, with three replicates for each concentration. The 96-well plates were then placed in a multi-functional microplate reader (FLUOStar OPTIMA) under light-protected conditions. ex / λ em Detection was performed under conditions of 490nm / 520nm. The concentrations of CFDA and CDF were plotted on the x-axis, and the measured fluorescence value on the y-axis, with a weighting factor of 1 / x. 2 Perform linear regression, the results are as follows Figure 5 As shown. Correlation coefficient r 2 A value >0.99 indicates good standard curve characteristics. After 5 days of organoid culture, the organoids were removed from the cell culture incubator and counted under a microscope. Following counting, group experiments were conducted in a dark environment. The control group received medium containing only CFDA or CDF, while the experimental group received medium containing both probenecid (an MRP1 / 2 inhibitor) and either CFDA or CDF. The groups were then incubated at 37°C in a cell culture incubator. The concentrations of CFDA and CDF were 10 μM, and the inhibitor concentration was 20 μM.

[0088] (4) At specific incubation time points (20, 40, 60, 80, 100 min), take out the corresponding 96-well plate, add 150 μL of preheated PBS to each well and wash it 5 times for 2 min each time in a dark environment.

[0089] (5) Add 150 μL of preheated PBS to each well, then place the 96-well plate in a 37°C incubator and start timing for 4 hours.

[0090] (6) After 4 hours, the organoids ruptured, releasing the accumulated fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) into PBS. At this point, 80 μL of the supernatant was transferred to a new 96-well plate under light-protected conditions, then wrapped in aluminum foil and placed on a multi-functional microplate reader for fluorescence measurement. The measured sample fluorescence value was substituted into the standard curve to obtain the total concentration of the fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) in the sample. The total concentration was then divided by the number of organoids per well to obtain the average concentration of the fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) per organoid, thus eliminating the influence of the number of organoids and experimental errors caused by individual differences in organoids. The experimental results are as follows: Figure 5 As shown in the figure, the concentrations of fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) increased in both the control and experimental organoids with increasing incubation time. Due to the addition of inhibitors in the experimental group, the efflux of fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) was suppressed, resulting in slow accumulation of fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) in the experimental organoids.

[0091] Example 6: Evaluation of ABC transport inhibition of commonly used drugs during clinical pregnancy based on trophoblast organoids

[0092] (1) After culturing trophoblast organoids for 5 days, they were removed from the cell culture incubator and counted under a microscope. After counting, group experiments were conducted under light-protected conditions. The control group was given a culture medium containing only Rh123, Hoechst33342, CFDA, and CDF. The experimental group was given a culture medium containing nifedipine, labetalol, clozapine, sertraline, fluoxetine, and Rh123, Hoechst33342, CFDA, and CDF. The cells were then incubated in a 37°C cell culture incubator. The concentrations of Rh123, Hoechst33342, CFDA, and CDF were 5 μM, 10 μM, 10 μM, and 10 μM, respectively, and the concentration of the drug to be tested was 10 μM.

[0093] (2) At the incubation time of 100 min, take out the corresponding 96-well plate and add 150 μL of preheated PBS to each well for 5 consecutive washes, each time for 2 min, in a dark environment.

[0094] (3) Add 150 μL of preheated PBS to each well, then place the 96-well plate in a 37°C incubator and start timing for 4 hours.

[0095] (4) After 4 hours, the organoids ruptured, releasing the accumulated fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) into PBS. At this point, 80 μL of the supernatant was transferred to a new 96-well plate under light-protected conditions, then wrapped in aluminum foil and placed on a multi-functional microplate reader for fluorescence measurement. The measured sample fluorescence value was substituted into the standard curve to obtain the total concentration of the fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) in the sample. The total concentration was then divided by the number of organoids per well to obtain the average concentration of the fluorescent substrates (Rh123, Hoechst33342, CFDA, CDF) per organoid, thus eliminating the influence of the number of organoids and experimental errors caused by individual differences in organoids. The experimental results are as follows: Figure 6 As shown in the figure, labetalol inhibits drug transport mediated by P-gp and MRP1, nifedipine inhibits drug transport mediated by P-gp and BCRP, fluoxetine inhibits drug transport mediated by P-gp and MRP2, sertraline inhibits drug transport mediated by P-gp, BCRP and MRP2, and clozapine inhibits drug transport mediated by BCRP and MRP2.

[0096] The scope of protection of this invention is not limited to the above embodiments. Any variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.

Claims

1. A trophoblast organoid model, characterized in that, The trophoblast organoid model is a human trophoblast organoid; it is a complex spherical structure formed by in vitro 3D culture from 6-8 week human placental trophoblast villi, with irregular surface; it is a circular protrusion of placental villi, and the inside is a hollow structure.

2. The method for constructing a trophosphere organoid model according to claim 1, wherein It comprises the following steps: Trophoblast cells separated from human placental villi digestion are inoculated in Matrigel, and ADMEM / F12 medium containing specific growth factors is added for culture to form the trophoblast organoid; wherein the ADMEM / F12 medium containing specific growth factors comprises 500nM A83-01, 2μM Y27632, 1.5μM CHIR99021, 2.5μM Prostaglandin E2, 50ng / mL EGF, 80ng / mL R-spondin-1, 100ng / mL FGF2, 50ng / mL HGF, 1.25mM N-acetyl cysteine, 2mM L-glutamine.

3. The construction method of claim 2, wherein, In the method, as the culture days increase, the organoid volume gradually increases and forms a trophoblast organoid structure; when the trophoblast organoid volume increases to a diameter of 200μm, stem cells in the organoid begin to differentiate to form new trophoblast cells, showing a "budding" phenomenon.

4. A culture medium for culturing the trophoblast organoid model of claim 1, characterized by, The culture medium comprises 500nM A83-01, 2μM Y27632, 1.5μM CHIR99021, 2.5μM Prostaglandin E2, 50ng / mL EGF, 80ng / mL R-spondin-1, 100ng / mL FGF2, 50ng / mL HGF, 1.25mM N-acetyl cysteine, 2mM L-glutamine.

5. The method for in vitro high-throughput screening of clinical drugs for ABC transporter inhibitors using the trophoblast organoid model according to claim 1, characterized in that, The method comprises the following steps: trophoblast organoid culture, drug gradient dilution, light-free incubation, organoid collection and crushing, fluorescence detection, substrate linear drawing, and inhibition evaluation.

6. A method for real-time quantitative analysis of P-gp, BCRP, MRP1, MRP2 protein expression levels using the model of the trophozoite organoid according to claim 1, characterized in that, The method comprises the following steps: villus collection, organoid culture, paraformaldehyde fixation, dehydration, wax immersion, embedding, sectioning, immunofluorescence, and microscopic examination and photography.

7. A method for detecting the mRNA expression level of P-gp, BCRP, MRP1, MRP2 using the trophoblast organoid model according to claim 1, characterized by, The method comprises the following steps: villus collection, organoid culture collection, JAR cell collection, mRNA extraction, cDNA acquisition, primer design, and real-time quantitative PCR analysis.

8. The trophoblast organoid model of claim 1 for use in inhibition of ABC transporter-mediated drug transport, for use in in vitro high-throughput screening of clinical drugs for ABC transporter inhibitors, for use in evaluation of ABC transporter-mediated drug transport inhibition, and for use in evaluating the effect of inhibitors on the transport of ABC transporter fluorescent substrates across the trophoblast organoid.

9. The use of claim 8, wherein the drugs comprise nifedipine, labetalol, clozapine, sertraline, fluoxetine; and / or the ABC transporters comprise P-gp, BCRP, MRP1, MRP2; and / or ​ In the application, labetalol inhibits P-gp and MRP1-mediated drug transport, and / or nifedipine inhibits P-gp and BCRP-mediated drug transport, and / or fluoxetine inhibits P-gp and MRP2-mediated drug transport, and / or sertraline inhibits P-gp, BCRP and MRP2-mediated drug transport, and / or clozapine inhibits BCRP and MRP2-mediated drug transport.

10. A sequence, wherein, The sequences respectively include the following: The sequence of the ABCB1 primer: the upstream primer is F: 5'-AGCAGAGGCCGCTGTTCGTT-3', the downstream primer is R: 5'-CCATTCCGACCTCGCGCTCC-3'; the product length is 109 bp; the ABCB1 product sequence is: AGCAGAGGCCGCTGTTCGTTTCCTTTAGGTCTTTCCACTAAAGTCGGAGTATCTTCTT CCAAAATTTCACGTCTTGGTGGCCGTTCCAAGGAGCGCGAGGTCGGAATGG; The ABCG2 primer: the upstream primer is F: 5'-GACTTATGTTCCACGGGCCT-3', the downstream primer is R: 5'-GGCTCTATGATCTCTGTGGCTTT-3'; the product length is 175 bp; the ABCG2 product sequence is: GACTTATGTTCCACGGGCCTGCTCAGGAGGCCTTGGGATACTTTGAATCAGCTGGTTATCACTGTGAGGCCTATAATAACCCTGCAGACTTCTTCTTGGACATCATTAATGGAGATTCCACTGCTGTGGCATTAAACAGAGAAGAAGACTTTAAAGCCACAGAGATCATAGAGCC; The ABCC1 primer: the upstream primer is F: 5'-GCCTGTTTTGGTAAAGAACTGGAAG-3', the downstream primer is R: 5'-CCTTGGAACTCTCTTTCGGCTG-3'; the product length is 110 bp; the ABCC1 product sequence is: GCCTGTTTTGGTAAAGAACTGGAAGAAGGAATGCGCCAAGACTAGGAAGCAGCCGGT GAAGGTCGTGTACTCCTCCAAGGATCCTGCCCAGCCGAAAGAGAGTTCCAAGG; ABCC2 primers: the upstream primer is F: 5'-TGCATCTAGGCAAGGTTAACGAG-3', the downstream primer is R: 5'-GTCCAGGAATGAGGAATTCCAAAAA-3'; the product length is 223bp; the ABCC2 product sequence is TGCATCTAGGCAAGGTTAACGATTAAATGGTTGGGATGAAAGGTCATCCTTTACGGAGAACATCAGAATGGTAGATAATTCCTGTTCCACTTTCTTTGATGAAACAAGTAAAGAAGAAACAACACAATCATATTAATAGAAGAGTCTTCGTTCCAGACGCAGTCCAGGAATCATGCTGGAGAAGTTCTGCAACTCTACTTTTTGGAATTCCTCATTCCTGGAC.

Images