Antiviral application of punicalagin
By disrupting the phase separation of viral N protein with pungent glycosides, the problem of the lack of broad-spectrum antiviral drugs in existing technologies has been solved, achieving effective inhibition and treatment of a variety of viruses.
Patent Information
- Application Number
- CN202411043278.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-31
- Publication Date
- 2026-02-03
AI Technical Summary
Current technologies lack effective broad-spectrum antiviral drugs, especially against viruses containing the N protein, such as coronaviruses, making it difficult to inhibit viral assembly and enhance the host's antiviral immune response.
Punica granatum is used to disrupt the RNA-induced separation of viral N protein phases, thereby inhibiting the activity of various viruses, including RNA and DNA viruses. It can be used for prevention or treatment by preparing pharmaceutical compositions containing punica granatum.
Punic glycosides exhibit broad-spectrum antiviral effects, inhibiting various viruses containing N proteins, including coronaviruses and influenza viruses, and alleviating or curing diseases caused by these viruses, demonstrating significant inhibitory and therapeutic effects.
Smart Images

Figure CN121445752A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of antiviral drugs, specifically involving the application of pomegranate glycoside in broad-spectrum antiviral activity. Background of the Invention
[0002] Punicalagin (PU) is a natural compound found in pomegranates, belonging to the polyphenol class, specifically a large-molecule plant tannin. Its CAS number is 65995-63-3, and its chemical structure is as follows:
[0003]
[0004] Punicin is mainly found in pomegranate peel, fruit, and juice. It is one of the important components of pomegranate with various biological activities such as antioxidant, anti-inflammatory, and antimicrobial activity, and has important physiological functions. Studies have shown that punicin has the following characteristics and potential health benefits.
[0005] Puniculin possesses strong antioxidant properties, acting as a powerful antioxidant that neutralizes free radicals, reduces cell damage, and thus helps prevent chronic diseases including cardiovascular disease and cancer. Puniculin also exhibits anti-inflammatory effects, reducing inflammation by inhibiting the production of inflammatory mediators and helping to regulate inflammation-related diseases such as arthritis and cardiovascular disease. Furthermore, puniculin helps improve cardiovascular health by lowering blood pressure, reducing vascular inflammation, and inhibiting the oxidation of low-density lipoprotein. Additionally, puniculin possesses anti-tumor activity; some studies have indicated that it can affect the proliferation of tumor cells.
[0006] Protein phase separation is the spontaneous condensation of biomolecules into membrane-free organelles. These organelles are highly dynamic, and numerous cellular biological processes occur within them, such as protein and RNA quality control, signal transduction, and immune responses. Abnormalities in protein phase separation are closely related to the development of many diseases, such as neurodegenerative diseases, cancer, and immune-related diseases. Phase separation is also widely involved in viral biological processes.
[0007] Nucleocapsid proteins in coronaviruses and other viruses share similar structure and function with capsid proteins in other viruses; both are responsible for encapsulating the viral genome and assembling the virus. These proteins are called N proteins. N proteins often facilitate viral assembly and evade the host's immune response through phase separation.
[0008] Taking the novel coronavirus as an example, the N protein is one of its four structural proteins and an important structural protein in many viruses. It contains two domains: an N-terminal RNA recognition domain and a C-terminal dimerization domain, as well as three IDR sequences. The N protein recognizes the viral genome through its N-terminal RNA recognition domain, and its C-terminus mediates protein dimerization. Subsequently, the IDRs mediate the formation of phase-separation droplets and encapsulate the genome, initiating viral packaging, a crucial step in viral assembly. After viral infection of cells, the N protein is the first protein to undergo transcription and translation, and it is also the most abundant protein in the virus. The N protein recognizes and encapsulates the viral genome through phase separation, preventing it from being recognized by intracellular nucleic acid receptors and escaping the immune response. At the same time, the coronavirus N protein also inhibits its phase separation process by interacting with the mitochondrial antiviral signaling protein (MAVS), weakening the antiviral response, and binds to interferon regulatory factor 3 (IRF3) to reduce the interferon response.
[0009] Therefore, phase separation targeting the viral N protein plays a crucial role in inhibiting viral assembly and enhancing the host's antiviral immune response, offering a novel antiviral strategy and a new approach for the development of broad-spectrum antiviral drugs. Identifying substances acting on the N protein can provide effective antiviral drugs, thus offering new and effective antiviral candidates. Summary of the Invention
[0010] The inventors have discovered that pungent glycosides possess excellent broad-spectrum antiviral effects. As demonstrated in the examples below through cell and animal experiments, pungent glycosides can disrupt RNA-induced viral N protein phase separation, thereby inhibiting various viruses containing N protein in their structure, exhibiting broad-spectrum antiviral activity.
[0011] In a first aspect, this disclosure provides the use of pungent glycoside in the preparation of medicaments for the prevention or treatment of viral infections caused by viruses containing N protein or for the inhibition of viruses containing N protein.
[0012] In a second aspect, this disclosure provides a method for preventing or treating viral infection caused by a virus containing an N protein in an individual, or for inhibiting a virus containing an N protein in an individual, the method comprising administering an effective amount of pungent glycoside to the individual.
[0013] In a third aspect, this disclosure provides a method for in vitro inhibition of a virus containing an N protein, the method comprising contacting the virus with an effective amount of pungent glycoside.
[0014] In a fourth aspect, this disclosure provides a pharmaceutical composition comprising punicin, optionally comprising a pharmaceutically acceptable carrier, said pharmaceutical composition for inhibiting viruses containing N protein or for preventing or treating viral infections caused by viruses containing N protein.
[0015] In some embodiments, the virus containing the N protein described in the above aspects is an RNA virus or a DNA virus, preferably an RNA virus.
[0016] In some embodiments, the virus containing the N protein includes, but is not limited to, the following viruses: Coronaviridae, Flaviviridae, Orthomyxoviridae, Rhabdoviridae, Herpesviridae, Retroviridae, Paramyxoviridae, Bunyaviridae, Picornaviridae, Hepadnaviridae, Arenaviridae, and Hepeviridae.
[0017] In some embodiments, the virus containing the N protein comprises viruses selected from the following: coronavirus, flavivirus, influenza virus, vesicular stomatitis virus (VSV), herpes simplex virus, human immunodeficiency virus, rabies virus, measles virus, Hantavirus, and hepatitis virus.
[0018] The coronavirus family can be selected from the subfamilies Coronavirinae and Torovirinae. In some embodiments, the coronavirus subfamily is selected from the genera Alphacoronavirus, Betacoronavirus, and Gammacoronavirus. In some embodiments, the genus Alphacoronavirus includes the following species: Human coronavirus 229E, Human coronavirus NL63, Porcine epidemic diarrhea virus, Alphacoronavirus 1, Rhinolophus bat coronavirus HKU2, Scotophilus bat coronavirus 512, Miniopterus bat coronavirus 1, and Miniopterus bat coronavirus HKU8. In some implementations, the genus *Betacoronavirus* includes the following species: Human coronavirus HKU1, Murine coronavirus, Betacoronavirus 1, Rousettus bat coronavirus HKU9, Tylonycteris bat coronavirus HKU4, Pipistrellus bat coronavirus HKU5, and Severe Acute Respiratory Syndrome-related coronavirus (SARS-related coronavirus (SARSr-CoV)). In some implementations, SARSr-CoV is selected from Civet SARS-CoV, Bat SARS-like coronavirus WIV1, SARS-CoV-1, and SARS-CoV-2.
[0019] In some embodiments, the coronavirus may be selected from HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, MERS-CoV, SARS-CoV, and SARS-CoV-2. In some embodiments, the coronavirus is a SARS-CoV-2 mutant strain, preferably selected from the WIV04 mutant strain, Alpha mutant strain, Beta mutant strain, Gamma mutant strain, Delta mutant strain, Lambda mutant strain, Omicron mutant strain, Deltacron mutant strain, mouse-adapted strain C57MA14 or its mutant strain, Epsilo mutant strain, Eta mutant strain, Iota mutant strain, Kappa mutant strain, Zeta mutant strain, Mu mutant strain, or any other mutant strain. In some implementations, SARS-CoV-2 mutant strains include, but are not limited to, BA.2.86, XBB.1.9.1, XBB.1.9.2, XBB.2.3, XBB.1.16, XBB.1.5, CH.1.1, BA.2.74, B.1.1.7, B.1.351, P.1, B.1.617.2, B.1.427, B.1.429, B.1.525, B.1.526, B.1.617.1, B.1.617.3, B.1.1.529, B.1.1.529.2, P.2, B.1.621, B.1.621.1, JN.1.7, KP.2, KP.3, JN.1.18, XBB.1.5, or EG.5 in the Pango lineage system.
[0020] The flavivirus can be selected from yellow fever virus, Japanese encephalitis virus (JEV), dengue virus, West Nile virus, and Zika virus.
[0021] The influenza virus may be selected from influenza A virus, influenza B virus, influenza C virus, and influenza D virus. In some embodiments, the influenza virus is selected from influenza A virus. In some embodiments, the influenza virus is H1N1, H2N2, H3N2, H5N1, H7N7, or H9N2, preferably H1N1, and more preferably the H1N1-PR8 mutant strain.
[0022] The vesicular stomatitis virus mentioned can be selected from Carajas virus, Chandipura virus, Cocal virus, Isfahan virus, Maraba virus, Piry virus, Alagoas vesicular stomatitis virus, Indiana vesicular stomatitis virus, New Jersey vesicular stomatitis virus, BeAn 157575 virus, Boteke virus, Calchaquivirus, Eel virus American, Gray Lodge virus, Jurona virus, Klamath virus, Kwatta virus, La Joya virus, and Malpais Spring virus. The following viruses are listed: Mount Elgon bat virus, Perinet virus, Pike fryrhabdovirus, Grass carp rhabdovirus, Porton virus, Radi virus, Spring viremia of carp virus, Tupaia virus, Ulcerative disease rhabdovirus, and Yug Bogdanovac virus.
[0023] The hepatitis virus may be selected from hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, hepatitis E virus, hepatitis G virus, and hepatitis delta virus.
[0024] In some embodiments, the virus of this disclosure comprises a mutant of the N protein. In some embodiments, the mutant of the N protein comprises amino acid mutations (e.g., substitution, deletion, or addition), such as conserved amino acid mutations (e.g., conserved substitution). For example, the conserved mutation, at the protein structure or function level or at the viral structure or function level, does not cause significant changes or remains substantially consistent with the original protein compared to the parent. In some embodiments, the mutant of the N protein with the conserved mutation has one or more (e.g., 1-20, 1-10, or 1-5) amino acid mutations compared to the parent, such as conserved amino acid mutations (e.g., conserved amino acid substitution). In some embodiments, the mutation is not located at the C-terminus of the N protein.
[0025] In some embodiments, the viruses containing the N protein described in the above aspects are selected from SARS-CoV-2 or its mutant strains (such as WIV04 mutant, Alpha mutant, Beta mutant, Gamma mutant, Delta mutant, Lambda mutant, or Omicron mutant); mouse-adapted strain C57MA14 or its mutant strain; HCoV-OC43 or its mutant strain; HCoV-229E or its mutant strain; influenza A virus or its subtypes or mutant strains (such as H1N1, preferably H1N1-PR8); and VSV virus or its mutant strains.
[0026] The pharmaceutical compositions containing punicalin described in this disclosure may contain 1-1000 mg (e.g., 1-800 mg, 1-500 mg, 1-200 mg, 1-100 mg, 1-50 mg, 1-20 mg, or 1-10 mg) of punicalin. The pharmaceutical compositions comprising punicalin described herein optionally include a pharmaceutically acceptable carrier selected from fillers (e.g., starch, lactose, microcrystalline cellulose, etc.), absorbents, humectants, binders (e.g., hydroxypropyl methylcellulose, sodium carboxymethyl cellulose, starch paste), disintegrants (e.g., sodium carboxymethyl starch, croscarmellose, etc.), flow aids (e.g., silica), lubricants (e.g., stearic acid and its salts such as magnesium stearate), preservatives (e.g., ethylparaben, propylparaben), stabilizers (e.g., antioxidants such as ascorbic acid, chelating agents such as ethylenediaminetetraacetic acid or sodium ethylenediaminetetraacetic acid), flavoring agents, pH adjusters (e.g., hydrochloric acid and sodium hydroxide), surfactants, emulsifiers, suspending agents, and any combination thereof; the pharmaceutically acceptable carrier may constitute 1% to 99% of the pharmaceutical composition by weight, for example 10% to 70%, 30% to 60%.
[0027] The punicalin or pharmaceutical compositions containing punicalin described herein can be administered in any suitable manner, including oral, topical (including oral and sublingual), rectal, vaginal, transdermal, parenteral, subcutaneous, intraperitoneal, intrapulmonary, intradermal, intrathecal, epidural, and intranasal administration. Parenteral infusion includes intramuscular, intravenous, intraarterial, intraperitoneal, intracerebral, intraocular, intralesional, or subcutaneous administration. In some embodiments, the punicalin of the present invention is administered orally. In other embodiments, the punicalin of the present invention is administered intravenously. Therefore, the pharmaceutical compositions of the present invention can be formulated into any convenient form of administration by conventional methods known in the art, such as tablets, powders, capsules, solutions, dispersants, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. The term "individual" as used in this disclosure refers to both mammals and non-mammals. Mammals are any member of the mammal family, including but not limited to: humans; non-human primates such as chimpanzees and other ape and monkey species; farm animals such as cattle, horses, sheep, goats, and pigs; livestock such as rabbits, dogs, and cats; laboratory animals, including rodents such as rats, mice, and guinea pigs; and so on. Examples of non-mammals include, but are not limited to, birds. The term "individual" is not limited to a specific age or sex. In some implementations, an individual is a human being.
[0028] As used in this disclosure, the term "effective amount" refers to the amount of pungent glycoside of the present invention that can significantly inhibit viruses containing the N protein and / or alleviate or cure diseases (e.g., viral infections) or symptoms caused by viruses containing the N protein in an individual. The effective amount of pungent glycoside of the present invention can be determined by conventional methods (e.g., modeling, dose-escalation studies, or clinical trials) combined with conventional influencing factors (e.g., route of administration, pharmacokinetics of the compound, severity and duration of the disease, individual medical history, individual health status, individual response to the drug, etc.). Typically, for a person weighing 70 kg, pungent glycoside of the present invention can be administered at a daily dose of 1 mg to 1000 mg, for example, 5 mg to 500 mg daily or 10 mg to 200 mg daily, said daily dose may be administered as a single dose or divided into multiple doses.
[0029] In some embodiments, the viral infection described in this disclosure is one or more of the following: nasal tissue, bronchi, lungs, kidneys, spleen, esophagus, ileum, colon, rectum, heart, thymus, liver, and blood, preferably a lung infection or a spleen infection.
[0030] In some embodiments, the infection described in this disclosure is selected from influenza, uncomplicated infection, pneumonia (including severe pneumonia), acute or severe acute respiratory infection, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, septic shock, or severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS), and pneumonia caused by novel coronavirus infection (COVID-19). In some embodiments, the uncomplicated infection is fever, cough, or sore throat. In some embodiments, the infection is COVID-19.
[0031] In some embodiments, the punicalin inhibits RNA-induced phase separation of the viral N protein, preferably the RNA being a double-stranded RNA mimic poly(I:C).
[0032] The inventors discovered that pungent glycosides can disrupt RNA-induced viral N protein phase separation, thereby inhibiting the virus.
[0033] Puniculin has a broad-spectrum antiviral effect in inhibiting viruses containing N proteins. It can inhibit a variety of viruses. For example, puniculin has a significant inhibitory effect on H1N1-PR8 mutant strain, VSV or SARS-CoV-2, preferably WIV04 mutant strain, Alpha mutant strain, Beta mutant strain, Gamma mutant strain, Delta mutant strain, lambda mutant strain, Omicron mutant strain, mouse-adapted strain C57MA14, etc.
[0034] As used in this disclosure, the term "RNA virus" refers to a virus that has ribonucleic acid (RNA) as its genetic material. RNA viruses can be single-stranded (ssRNA) or double-stranded (dsRNA). Single-stranded RNA viruses include the class (phylum) "negative-sense ssRNA viruses" (Negarnaviricota), which includes, in particular, the orders Single-stranded Antisense Viriorder and Segmented Viriorder (including the Orthomyxoviridae family, which includes influenza viruses), and the class "positive-sense ssRNA viruses," such as the families Coronaviridae, Flaviviridae, and Enteroviridae. Negative-sense ssRNA viruses, particularly those in the order Single-stranded Antisensevirales, include Bonaviridae (Bonavirus (BDV)), Niamiviridae (NYMV)), Rhabdoviridae (rabies virus, vesicular stomatitis virus (VSV), Malaba virus), Filoviridae (Ebola virus, including EBOV), Paramyxoviridae (measles virus (MeV), Newcastle disease virus (NDV)), and Pneumoviridae (e.g., human respiratory syncytial virus (HRSV)). In the context of this invention, Rhabdoviridae and Paramyxoviridae are preferred, and RNA viruses of the genus *Vesicavipira* are more preferred.
[0035] Coronaviruses belong to the order Nidovirales, family Coronaviridae, and genus Coronavirus. They are enveloped RNA viruses with a linear, single-stranded, positive-sense genome, ranging in diameter from 80-120 nm. Their nucleic acid is non-segmented, single-stranded (+) RNA, 27-31 kb in length. Coronaviruses have the longest RNA nucleic acid chains among RNA viruses, possessing important structural features characteristic of positive-sense RNA: a methylated "cap" at the 5' end and a PolyA "tail" at the 3' end. Coronaviruses are excreted through respiratory secretions and transmitted via saliva, sneezing, contact, and airborne droplets, infecting vertebrates and humans, such as humans, rats, horses, pigs, cats, dogs, and poultry, causing various diseases including respiratory infections and acute gastroenteritis.
[0036] In this application, SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2) can be used interchangeably with Severe Acute Respiratory Syndrome Coronavirus 2 or Novel Coronavirus. SARS-CoV-2 mainly encodes four structural proteins: spike protein, membrane protein, envelope protein, and nucleocapsid protein. The nucleocapsid protein can bind to viral genomic RNA to form a ribonucleocapsid complex, and it also participates in viral genome protection, viral RNA replication, and assembly. The nucleocapsid protein is highly conserved and is also the structural protein with the highest expression abundance on SARS-CoV and SARS-CoV-2. Novel Coronavirus is currently the seventh known coronavirus that can infect humans. This virus is characterized by a long incubation period, high infectivity, high replication rate, and difficulty in prevention and control. After humans are infected with the novel coronavirus, the clinical manifestations include fever, fatigue, dry cough, and gradually developing dyspnea. In severe cases, it can manifest as acute respiratory distress syndrome, septic shock, uncorrectable metabolic acidosis, and coagulation dysfunction.
[0037] Influenza viruses are the main viruses that cause acute respiratory infectious diseases, resulting in influenza. Belonging to the Orthomyxoviridae family, influenza viruses are RNA viruses, primarily including influenza A, influenza B, and influenza C viruses. Influenza A viruses exhibit high variability, transmissibility, and pathogenicity, making them highly susceptible to causing seasonal epidemics. Human infection with influenza viruses can lead to severe pneumonia, acute respiratory distress syndrome, sepsis with shock, and other complications, resulting in a very high mortality rate.
[0038] Vesicular stomatitis virus (VSV) is a negative-sense single-stranded RNA virus. Specifically, VSV belongs to the family Rhabdoviridae and has an unsegmented, negative-sense, single-stranded RNA genome. The VSV RNA genome consists of five viral genes, in the following order from 3' to 5': nucleoprotein (N protein), followed by a phosphoprotein (P protein), a matrix protein (M protein), a glycoprotein (G protein), and finally a polymerase or large protein (L-protein). The first viral protein, the N protein, covers the viral RNA genome and interacts with the viral polymerase complex, which is formed by the P and L proteins. The M protein forms the viral capsid and hinders cell translation by blocking nuclear pores. The G protein promotes cell attachment and entry, and its fusion signature constitutes another pathogenic factor. VSV infects pigs, cattle, and horses, causing vesicular disease around the mouth and feet. Human infections caused by VSV have also been reported.
[0039] In this disclosure, N protein may refer to nucleocapsid protein, capsid protein, or nucleoprotein (NP). In some embodiments of this disclosure, N protein, N protein, nucleocapsid protein, capsid protein, or NP protein are used interchangeably. The N protein described in this disclosure can generally comprise any protein that has a protective function against viral nucleic acids (such as DNA or RNA). The N protein is one of the structural proteins of some viruses, such as coronaviruses, and is involved in viral replication and the formation of the ribonucleoprotein (RNP) complex, and is highly conserved.
[0040] In coronaviruses, the N protein, as one of their important structural proteins, is mainly composed of an N-terminal domain (NTD), a C-terminal domain (CTD), and three intrinsically disordered regions (IDRs). This protein is abundant and highly conserved in coronaviruses, playing a crucial role in the coronavirus life cycle, including forming a ribonucleoprotein (RNP) complex with the novel coronavirus's genetic material RNA, participating in viral genome transcription, replication, and regulation of cell signaling pathways. After the novel coronavirus infects the host, the N protein, through interaction with host proteins, can recruit key kinases TAK1 and IKKβ in the NF-κB pathway, promoting the interaction between TAK1 and IKKβ and activating IKKβ phosphorylation. The interaction between TAK1 and IKKβ can promote the activation of the host NF-κB pathway, thereby inducing cells to secrete a large number of pro-inflammatory cytokines, including IL-6, IL-1β, IL-8 and TNFα, which cause an inflammatory response in the host. This may be related to the cytokine storm caused by the novel coronavirus.
[0041] In influenza viruses, the NP protein, encoded by gene 5 and composed of 498 amino acids, is an important structural protein, accounting for approximately 25% of the viral particle. The NP protein is highly conserved across different subtypes of influenza A viruses, exhibiting high amino acid homology with differences not exceeding 11%, demonstrating population and type specificity. The conservation of the influenza virus NP protein is far greater than that of the surface membrane proteins HA and NA.
[0042] As used herein, the term "treatment" for any disease refers to improving the disease or condition (i.e., slowing or preventing or reducing the progression of the disease or at least one of its clinical symptoms). In other embodiments, "treatment" refers to reducing or improving at least one physical parameter, including those parameters not identified by the patient. In still other embodiments, "treatment" refers to regulating the disease or condition from a bodily (e.g., stabilization of a noticeable symptom) or physiological (e.g., stabilization of a physical parameter) perspective, or both. Attached Figure Description
[0043] Figure 1A and Figure 1B The experimental results show that pungent glycoside inhibits the phase separation of RNA-induced SARS-CoV-2 N protein. Figure 1A High-content microscopy images of the phase separation of the SARS-CoV-2 virus N protein induced by different concentrations of pungent glycosides in the test groups. Figure 1B A bar chart showing the phase separation of the SARS-CoV-2 virus N protein induced by different concentrations of pungent glycosides in the test groups.
[0044] Figure 2A -D represents the experimental results of pungent glycoside and the control group in inhibiting the replication of different mutant strains of SARS-CoV-2 at the cellular level. Figure 2A Bar chart showing the inhibition of SARS-CoV-2 Delta mutant replication by the pomegranate glycoside test group. Figure 2B Bar chart showing the inhibition of SARS-CoV-2 Alpha mutant replication by the pomegranate glycoside test group. Figure 2C A bar chart showing the inhibition of SARS-CoV-2 Lambda mutant replication by the pomegranate glycoside test group. Figure 2D Bar chart showing the inhibition of SARS-CoV-2 Omicron mutant replication by the pomegranate glycoside test group. Figure 2A-2D In the image, the left column "Ctrl" represents the negative control, and the right column "PU" represents pungent glycoside.
[0045] Figure 3A -D represents the experimental results of pungent glycoside and the control group inhibiting SARS-CoV-2 replication at the animal level. The left bar "Ctrl" represents the negative control, the middle bar "PF" represents the positive control, and the right bar "PU" represents pungent glycoside.
[0046] Figures 4A-4D This study presents experimental results on the phase separation of various viral N proteins induced by pungent glycosides and the control group, as well as the results of viral replication at the cellular and animal levels. Figure 4A High-content microscopy image of phase separation of HCoV-OC43 N protein induced by pungent glycoside in the test group; Figure 4B A bar chart showing the phase separation of RNA-induced HCoV-OC43 N protein in the pomegranate glycoside test group. Figure 4C High-content microscopy image of phase separation of HCoV-229E N protein inhibited by punicin test group; Figure 4D A bar chart showing the phase separation of HCoV-229E N protein inhibited by the pungent glycoside test group.
[0047] Figure 4E-4G The experimental results of pungent glycoside and the control group on the inhibition of different viral replications at the cellular level were used to evaluate its efficacy. Figure 4E A bar chart showing the inhibition of HCoV-229E replication by the pomegranate glycoside test group; Figure 4F A bar chart showing the inhibition of HCoV-OC43 replication by the pomegranate glycoside test group; Figure 4G A bar chart showing the inhibition of H1N1-PR8 replication by the pungent glycoside test group.
[0048] Figure 4H and 4IThe results of experiments on the inhibition of different VSV replication by pungent glycosides and control groups at the animal level. Figure 4E-4I The left column "Ctrl" represents the negative control, and the right column "PU" represents pungent glycoside.
[0049] Figure 5 A schematic diagram illustrating the construction of a virus containing a mutant N protein. Example
[0050] Example 1: Punicin inhibits RNA-induced phase separation of SARS-CoV-2 N protein
[0051] Experimental methods:
[0052] (1) Expression of the fusion protein Flag-N-mEGFP
[0053] The coding sequence of the full-length N protein of SARS-CoV-2 was conjugated to the mEGFP green fluorescent tag via its C-terminus. The conjugated fragment was then constructed into the pLVX-CMV-MCS-PGK-Puro lentiviral vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., catalog number P0247). Subsequently, the fusion protein Flag-N-mEGFP was stably expressed in H1299 cell line (purchased from ATCC Biostandard Resource Center, catalog number CRL-5803) through lentiviral infection.
[0054] The amino acid sequence (Sequence ID NO.1) of the fusion protein Flag-N-mEGFP is as follows:
[0055] MDYKDDDDKSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGF YAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQV
[0056]
[0057] The nucleotide sequence (Sequence ID NO.2) of the gene encoding the fusion protein Flag-N-mEGFP is as follows:
[0058]
[0059] GCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAG
[0060] CGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGG
[0061] ACGAGCTGTACAAGTGA
[0062] The recombinant vector was transferred into H1299 cells to obtain transfected cells, namely H1299-Flag-N-mEGFP cells.
[0063] (2) Spread the cells in a 96-well culture dish 12 hours in advance and use RPMI 1640 medium containing 10% FBS to allow them to adhere and grow evenly. Do not perform any operations before step (3).
[0064] (3) Dissolve pungent glycoside (Shanghai Taoshu Biotechnology Co., Ltd., T3921) in DMSO to prepare a 1 mM (i.e. 1 mmol / L) pungent glycoside stock solution. Then, divide the cells treated in step (2) into 6 groups and pretreat them for 1 hour with DMSO (i.e., the final concentration of pungent glycoside is 0 nM) and the above pungent glycoside solutions with final concentrations of 200 nM, 400 nM, 600 nM, 800 nM, and 1000 nM (wherein, the pungent glycoside stock solution is diluted with RPMI 1640 medium containing 10% FBS and added to the cells, the stock solution dilution ratio is 1:1000, that is, 1 mL of medium is added with 1 μL of 1 mM pungent glycoside solution to make the final concentration 1000 nM).
[0065] (4) RNA was transfected into cells using Lipofectamine 2000 (from Thermo, catalog number 11668019), which is a double-stranded RNA mimic poly(I:C) (purchased from InvivoGen, catalog number tlrl-pic-5). The ratio of RNA to Lipofectamine was 2:1. Both were dissolved in Opti-mem (Thermo Fisher Scientific China Co., Ltd., catalog number 31985070). Cells were treated for 3 hours to simulate the release of RNA during viral infection.
[0066] (5) Dilute Hoechst (Thermo Fisher Scientific China Co., Ltd., catalog number H3570) with RPMI 1640 medium containing 10% FBS to a concentration of 100 ng / mL, and add 10 μL of the diluted Hoechst to the cells treated in step (4) to a final concentration of 10 ng / mL. Stain the cell nuclei for 20 minutes.
[0067] (6) Scanning imaging and statistical analysis were performed using a high-content microscope.
[0068] The experimental results are shown in Figure 1.
[0069] exist Figure 1A In the figure, cells not treated with pungent glycosides (line 1A, first row) showed obvious punctate aggregation of N protein under RNA treatment; cells treated with pungent glycosides ( Figure 1A (Second to sixth channels) Under RNA treatment, the point-like aggregation of N protein was significantly reduced.
[0070] exist Figure 1B More specific statistical results are provided. The mean number of punctate clusters per cell in the Ctrl (PU 0nM) group was 1.68, and the mean number of punctate clusters per cell in the PU 200nM group was 0.92. Analysis using an unpaired two-tailed t-test showed a statistically significant difference (p < 0.0001). The mean area of punctate clusters per cell in the Ctrl (PU 0nM) group was 109.91, and the mean area of punctate clusters per cell in the PU 200nM group was 54.25. Analysis using an unpaired two-tailed t-test showed a statistically significant difference (p < 0.0001). The mean fluorescence intensity of punctate clusters per cell in the Ctrl (PU 0nM) group was 1025627.2, and the mean fluorescence intensity of punctate clusters per cell in the PU 200nM group was 449313.77. Analysis using an unpaired two-tailed t-test showed a statistically significant difference (p < 0.0001).
[0071] The above results indicate that pungent glycoside can inhibit RNA-induced phase separation of the SARS-CoV-2 N protein.
[0072] Example 2: Punicin inhibits SARS-CoV-2 replication at the cellular level
[0073] Experimental principle:
[0074] like Figure 5As illustrated in the diagram, a complete SARS-CoV-2 particle contains a genome and four structural proteins: S, E, M, and N. We replaced the nucleic acid sequence encoding the N protein in the genome with the luciferase gene, obtained the full-length viral RNA through in vitro transcription, and transfected it into Vero-N cells (i.e., cells that stably express the N protein; Vero-N cells are those that stably express the N protein based on wild-type Vero cells; the N protein can have different sources, such as N proteins from different viruses or N proteins from different mutant strains of the same virus). For example, Vero-N cells can include cells that stably express the N protein of Alpha, Delta, Lambda, and Omicron mutant strains based on wild-type Vero cells, and are named Vero-Flag-N, respectively. alpha Cells, Vero-Flag-N delta Cells, Vero-Flag-N lambda Cells and Vero-Flag-N omicron In cells, RNA replicates and is translated, but because it lacks an N protein-coding sequence, it needs to be packaged with the help of N proteins in the cell to form complete viral particles (first-round viruses).
[0075] We stably expressed N protein with different mutation sites in Vero cells, so that the cells expressed N protein of different mutant strains. When the cells were infected with the first round of virus, the virus that was amplified was a virus with N protein mutation, and only the N protein was mutated.
[0076] Experimental methods:
[0077] (1) The N protein coding sequences of various mutant strains of SARS-CoV-2, including Alpha, Delta, Lambda, and Omicron mutants, were constructed into the pLVX-CMV-MCS-PGK-Puro lentiviral vector (purchased from Wuhan Miaoling Biotechnology Co., Ltd., catalog number P0247) via their C-terminus. Subsequently, the Flag-N protein was injected via lentiviral infection. alpha Flag-N delta Flag-N lambda Flag-N omicron The protein was stably expressed in the Vero cell line (purchased from ATCC Biostandard Resource Center, catalog number CCL-81), resulting in transfected cells, namely Vero-Flag-N. alpha Vero-Flag-N delta Vero-Flag-N lambda Vero-Flag-N omicron cell.
[0078] Fuse protein Flag-N alpha The amino acid sequence (Sequence ID NO.3) is as follows:
[0079]
[0080] Fuse protein Flag-N delta The amino acid sequence (Sequence ID NO.4) is as follows:
[0081]
[0082]
[0083] Fuse protein Flag-N lambda The amino acid sequence (Sequence ID NO.5) is as follows:
[0084]
[0085] Fuse protein Flag-N omicron The amino acid sequence (Sequence ID NO.6) is as follows:
[0086]
[0087] Fuse protein Flag-N alpha The nucleotide sequence (Sequence ID NO.7) encoding the gene is as follows:
[0088]
[0089]
[0090] Fuse protein Flag-N delta The nucleotide sequence (Sequence ID NO.8) encoding the gene is as follows:
[0091]
[0092] Fuse protein Flag-N lambda The nucleotide sequence (Sequence ID NO.9) encoding the gene is as follows:
[0093]
[0094]
[0095] Fuse protein Flag-N omicronThe nucleotide sequence (Sequence ID NO.10) encoding the gene is as follows:
[0096]
[0097] The recombinant vector was transferred into Vero cells to obtain transfected cells, namely Vero-Flag-N. alpha Cells, Vero-Flag-N delta Cells, Vero-Flag-N lambda Cells, Vero-Flag-N omicron cell.
[0098] (2) 12 hours in advance, Vero-N cells are spread in 12-well plates (100,000 cells / well, density of about 60%). The cells are grown naturally in DMEM medium (containing 10% FBS) without any operation before step (3).
[0099] (3) Dissolve pungent glycoside in DMSO to prepare a 10 mM pungent glycoside solution. Divide the cells treated in step (2) into two groups and pretreat them for 1 hour with DMSO and a pungent glycoside solution with a final concentration of 10 μM (1 mL of culture medium was mixed with 1 μL of pungent glycoside solution to make the final concentration 10 μM). The wells with DMSO added are called control wells, and the wells with pungent glycoside added are called test wells.
[0100] (4) Infect cells that have completed step (3) with SARS-CoV-2 (i.e., strain WIV04, the prevalent strain at the time of the initial outbreak) virus solution (1 μL / well, the viral load of SARS-CoV-2 virus solution is 100,000 PFU / μL, MOI is 1). After 1 h, replace the control wells with 1 mL of fresh medium (DMEM containing 10% FBS), and replace the test wells with 1 mL of fresh medium (DMEM containing 10% FBS) containing 10 μM (1 mL of medium, with 1 μL of punicalin solution added to make the final concentration 10 μM). Collect the supernatant of the medium after 24 h. Lyse the cells with the lysis buffer in the kit and extract the RNA from the supernatant. RT-qPCR was used to detect the replication level of SARS-CoV-2 RNA, and the viral titer and the antiviral effect of punicalin were further calculated.
[0101] The primer and probe set used for SARS-CoV-2 RT-qPCR is as follows (the target sequence is located in the SARS-CoV-2 ORF1ab protein gene):
[0102] Upstream primer (Sequence ID NO.11): 5'-CCCTGTGGGTTTTACACTTAA-3'
[0103] Downstream primer (Sequence ID NO.12): 5'-ACGATTGTGCATCAGCTGA-3'
[0104] Required fluorescent probe for detection (Sequence ID NO.13): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3'
[0105] The experimental results are shown in Figure 2.
[0106] exist Figure 2A In the bar chart, the left bar represents the DMSO control, with a mean relative viral RNA copy number of 0.85. The right bar represents the test wells for pungent glycosides, with a mean relative viral RNA copy number of 0.06, which is significantly lower than the control group. Using a two-tailed unpaired t-test, the statistical difference was p = 0.0005.
[0107] exist Figure 2B In the bar chart, the left bar represents the DMSO control, with a mean relative viral RNA copy number of 0.80. The right bar represents the test wells for pungent glycosides, with a mean relative viral RNA copy number of 0.01, which is significantly lower than that of the control group. Using a two-tailed unpaired t-test, the statistical difference was *p = 0.0473.
[0108] exist Figure 2C In the bar chart, the left bar represents the DMSO control, with a mean relative viral RNA copy number of 0.85. The right bar represents the test wells for pungent glycosides, with a mean relative viral RNA copy number of 0.06, which is significantly lower than that of the control group. Using a two-tailed unpaired t-test, the statistical difference was **p = 0.0095.
[0109] exist Figure 2D In the bar chart, the left bar represents the DMSO control, with a mean relative viral RNA copy number of 0.85. The right bar represents the test wells for pungent glycosides, with a mean relative viral RNA copy number of 0.09, which is significantly lower than that of the control group. Using a two-tailed unpaired t-test, the statistical difference was **p = 0.0012.
[0110] The above results indicate that pungent glycosides can inhibit the replication of multiple mutant strains of SARS-CoV-2 at the cellular level.
[0111] Example 3: Punicin inhibits SARS-CoV-2 replication in animals
[0112] Experimental methods:
[0113] (1) BALB / c mice (animals were obtained from Vital River Biotechnology Co., Ltd., 6-8 months old mice, about 30g) were randomly divided into three groups: A, B and C, with 5 mice in each group. On day 0, group A was given 300 μL of punicalin by gavage (wherein punicalin was dissolved in PBS to prepare a concentration of 1 mg / mL), with a dose of 10 mg / kg. Group B was given an equal volume of phosphate buffered solution (PBS) by gavage. Group C was given an equal volume of Nirmatrelvir (PF-07311332, Pfizer) orally, with a dose of 10 mg / kg.
[0114] (2) On day 1, 50 μL of SARS-CoV-2 (mouse adaptive mutant strain C57MA14, TCID50 = 10) was administered intranasally to BALB / c mice in groups A and B. 5.6 / 100μL, diluted 1000 times before inoculation), while Group A was given 300μL of punicalin by gavage (wherein punicalin was dissolved in PBS and prepared at a concentration of 1mg / mL), with a dosage of 10mg / kg. Group B was given an equal volume of PBS by gavage, and Group C was given an equal volume of Nirmatrelvir (PF-07311332, Pfizer) orally, with a dosage of 10mg / kg.
[0115] (3) On the 2nd and 3rd days, Group A was given 300 μL of pungent glycoside by gavage (the pungent glycoside was dissolved in PBS and prepared at a concentration of 1 mg / mL), with a dosage of 10 mg / kg. Group B was given an equal volume of PBS by gavage, and Group C was given an equal volume of Nirmatrelvir (PF-07311332, Pfizer) orally, with a dosage of 10 mg / kg.
[0116] (4) Mice were sacrificed on day 4, and lung and tracheal tissues were collected. RNA was extracted from the lung and tracheal tissues by TRIZOL lysis, and the replication level of SARS-CoV-2 RNA was detected by RT-qPCR.
[0117] The primer and probe set used for SARS-CoV-2 RT-qPCR is as follows (the target sequence is located in the N protein gene of SARS-CoV-2):
[0118] Upstream primer (Sequence ID NO.14): 5'-GACCCCAAAATCAGCGAAAT-3'
[0119] Downstream primer (Sequence ID NO.15): 5'-TCTGGTTACTGCCAGTTGAATCTG-3'
[0120] The required fluorescent probe for detection (Sequence ID NO.16):
[0121] 5'-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 -3'
[0122] The primer and probe set used in SARS-CoV-2 RT-qPCR (target sequence located in the ORF1ab protein gene of SARS-CoV-2) is the same as in Example 2.
[0123] The experimental results are shown in Figure 3.
[0124] exist Figure 3A In the bar chart, the left bar represents the PBS control group, with a mean relative viral RNA copy number of 1.06; the middle bar represents the Nirmatrelvir (PF-07311332, Pfizer) positive control group (denoted as PF in the chart), with a mean relative viral RNA copy number of 0.55; and the right bar represents the punicalin test group, with a mean relative viral RNA copy number of 0.36. A two-tailed unpaired t-test was used for statistical analysis, and the statistical difference was p < 0.0001.
[0125] exist Figure 3B In the bar chart, the left bar represents the PBS control group, with a mean relative viral RNA copy number of 0.98; the middle bar represents the Nirmatrelvir (PF-07311332) positive control group, with a mean relative viral RNA copy number of 0.75; and the right bar represents the punicalin test group, with a mean relative viral RNA copy number of 0.52. A two-tailed unpaired t-test was used for statistical analysis, and the statistical difference was p < 0.0001.
[0126] exist Figure 3C In the bar chart, the left bar represents the PBS control group, with a mean relative viral RNA copy number of 1.00; the middle bar represents the Nirmatrelvir (PF-07311332) positive control group, with a mean relative viral RNA copy number of 0.65; and the right bar represents the punicalin test group, with a mean relative viral RNA copy number of 0.50. A two-tailed unpaired t-test was used for statistical analysis, and the statistical difference was p < 0.0001.
[0127] exist Figure 3DIn the bar chart, the left bar represents the PBS control group, with a mean relative viral RNA copy number of 1.00; the middle bar represents the Nirmatrelvir (PF-07311332) positive control group, with a mean relative viral RNA copy number of 0.64; and the right bar represents the punicalin test group, with a mean relative viral RNA copy number of 0.42. A two-tailed unpaired t-test was used for statistical analysis, and the statistical difference was p < 0.0001.
[0128] The above results indicate that pungent glycoside can inhibit the replication of SARS-CoV-2 at the animal level.
[0129] Example 4: Punicin inhibits RNA-induced phase separation of multiple viral N proteins at the cellular level.
[0130] Experimental methods:
[0131] (1) The N protein coding sequences of various viruses, including HCoV-OC43 and HCoV-229E, were conjugated to an mEGFP green fluorescent tag via their C-terminus, and the conjugate was constructed into the pLVX-CMV-MCS-PGK-Puro lentiviral vector. Subsequently, Flag-N was stably expressed in the H1299 cell line through lentiviral infection. HCoV-OC43 -mEGFP and Flag-N HCoV -229E -mEGFP protein.
[0132] Fuse protein Flag-N HCoV-OC43 The amino acid sequence (Sequence ID NO.17) of -mEGFP is:
[0133]
[0134] Fuse protein Flag-N HCoV-229E The amino acid sequence (Sequence ID NO.18) of -mEGFP is:
[0135]
[0136]
[0137] Fuse protein Flag-N HCoV-OC43 The nucleotide sequence (Sequence ID NO.19) encoding the -mEGFP gene is as follows:
[0138]
[0139] Fuse protein Flag-N HCoV-229EThe nucleotide sequence (Sequence ID NO.20) encoding the -mEGFP gene is as follows:
[0140]
[0141] The recombinant vector was transferred into H1299 cells to obtain transfected cells, namely H1299-Flag-N. HCoV-OC43 -mEGFP,H1299-Flag-N HCoV-229E -mEGFP.
[0142] (2) Spread the cells in a 96-well culture dish 12 hours in advance and use RPMI 1640 medium containing 10% FBS to allow them to adhere and grow evenly. Do not perform any operations before step (3).
[0143] (3) Dissolve pungent glycoside in DMSO to prepare eight groups of 1mM pungent glycoside stock solutions. Divide the cells treated in step (2) into two groups and pretreat them for 1 hour with DMSO and the above pungent glycoside solution with a final concentration of 1μM. The pungent glycoside stock solution is diluted with RPMI 1640 medium containing 10% FBS and added to the cells. The stock solution dilution ratio is 1:1000.
[0144] (4) Use Lipofectamine 2000 to transfect RNA into cells, namely double-stranded RNA mimic poly(I:C) (purchased from InvivoGen, catalog number tlrl-pic-5). The ratio of RNA to Lipofectamine is 2:1. Both are dissolved in Opti-mem and the cells are treated for 3 hours to simulate the release of RNA during viral infection.
[0145] (5) Dilute Hoechst with RPMI 1640 medium containing 10% FBS to a concentration of 100 ng / mL, and add 10 μL of the diluted Hoechst to the cells treated in step (4) to a final concentration of 10 ng / mL. Stain the cell nuclei for 20 minutes.
[0146] (6) Scanning imaging and statistical analysis were performed using a high-content microscope.
[0147] Experimental results are as follows Figures 4A-4D As shown.
[0148] exist Figure 4A In the figure, cells not treated with pungent glycosides (line 1, 4A) showed obvious punctate aggregation of N protein under RNA treatment; cells treated with pungent glycosides (… Figure 4A (Second step) Under RNA treatment, the point-like aggregation of N protein was significantly reduced; Figure 4B More specific statistical results are given below. The mean number of punctate aggregates per cell in the Ctrl(TA 0nM) group was 0.76, and the mean number of punctate aggregates per cell in the TA 1000nM group was 0.19. Analysis was performed using an unpaired two-tailed t-test, and the statistical difference was p < 0.0001. The mean area of punctate aggregates per cell in the Ctrl(TA 0nM) group was 44.12, and the mean area of punctate aggregates per cell in the TA 1000nM group was 12.57. Analysis was performed using an unpaired two-tailed t-test, and the statistical difference was p < 0.0001. The mean fluorescence intensity of punctate aggregates per cell in the Ctrl(TA 0nM) group was 148626.13, and the mean fluorescence intensity of punctate aggregates per cell in the TA 1000nM group was 29040.71. Analysis was performed using an unpaired two-tailed t-test, and the statistical difference was p < 0.0001.
[0149] exist Figure 4C In the figure, cells not treated with pungent glycosides (line 1, 4C) showed significant punctate aggregation of N protein under RNA treatment; cells treated with pungent glycosides (… Figure 4C (Second step) Under RNA treatment, the point-like aggregation of N protein was significantly reduced; Figure 4D More specific statistical results are provided. The mean number of punctate aggregates per cell in the Ctrl(TA 0nM) group was 1.79, and the mean number of punctate aggregates per cell in the TA 1000nM group was 1.24. Analysis using an unpaired two-tailed t-test showed a statistically significant difference (p < 0.0001). The mean area of punctate aggregates per cell in the Ctrl(TA 0nM) group was 106.96, and the mean area of punctate aggregates per cell in the TA 1000nM group was 72.22. Analysis using an unpaired two-tailed t-test showed a statistically significant difference (p < 0.0001). The mean fluorescence intensity of punctate aggregates per cell in the Ctrl(TA 0nM) group was 884612.54, and the mean fluorescence intensity of punctate aggregates per cell in the TA 1000nM group was 319703.32. Analysis using an unpaired two-tailed t-test showed a statistically significant difference (p < 0.0001).
[0150] The above results indicate that pungent glycoside can inhibit RNA-induced phase separation of the N protein in HCoV-OC43 and HCoV-229E at the cellular level.
[0151] Example 5: Punicin inhibits the replication of multiple viruses at the cellular level
[0152] Experimental methods:
[0153] (1) 24 hours in advance, A549 cells (purchased from ATCC Biostandard Resource Center, catalog number CCL-185) were plated in 96-well plates (15,000 cells / well, density of about 40%), and HeLa cells (purchased from ATCC Biostandard Resource Center, catalog number CCL-2) were plated in 96-well plates (16,000 cells / well, density of about 40%). The cells were cultured in DMEM (containing 10% FBS) medium and allowed to adhere naturally without any treatment before drug administration.
[0154] (2) Dissolve pungent glycoside in DMSO to prepare a 10 mM pungent glycoside solution. Divide the cells treated in step (1) into two groups and pretreat them for 1 hour with DMSO and a pungent glycoside solution with a final concentration of 10 μM (0.1 mL of culture medium, with 0.1 μL of pungent glycoside solution added to make the final concentration 10 μM). The wells with DMSO added are called control wells, and the wells with pungent glycoside added are called test wells.
[0155] (3) Infect the A549 cells that completed step (2) with H1N1-PR8 virus solution (30 μL / well, viral load of H1N1-PR8 virus solution is 2,000,000 PFU / mL, MOI is 1.5). Infect the HeLa cells that completed step (3) with HCoV-229E virus solution (30 μL / well, viral load of HCoV-229E virus solution is 2,000,000 PFU / mL, MOI is 1.5) and HCoV-OC43 virus solution (30 μL / well, viral load of HCoV-OC43 virus solution is 33,000 PFU / mL, MOI is 0.03). After 1 h, replace the control wells with 0.1 mL of fresh culture medium (containing 2% PFU / mL). The test wells were replaced with 0.1 mL of fresh medium (containing 2% FBS in DMEM) containing 10 μM pungent glycoside solution (0.1 mL of medium was added, followed by 0.1 μL of pungent glycoside solution to make a final concentration of 10 μM). Supernatants were collected 24 h after HCoV-229E infection, 36 h after HCoV-OC43 infection, and 14 h after H1N1-PR8 infection. Viral nucleic acid was extracted from the supernatants using a viral nucleic acid extraction kit, and the viral replication level was detected by RT-qPCR. The viral titer and the antiviral effect of pungent glycoside were further calculated.
[0156] The primer set used for HCoV 229E RT-qPCR is as follows:
[0157] Upstream primer (Sequence ID NO.21): 5′-TTCCGACGTGCTCGAACTTT-3′;
[0158] Downstream primer (Sequence ID NO.22): 5′-CCAACACGGTTGTGACAGTGA-3′
[0159] The primer set used for HCoV OC43 RT-qPCR is as follows:
[0160] Upstream primer (Sequence ID NO.23): 5′-GCTCAGGAAGGTCTGCTCC-3′;
[0161] Downstream primer (Sequence ID NO.24): 5′-TCCTGCACTAGAGGCTCTGC-3′
[0162] The primer set used for H1N1 PR8 RT-qPCR is as follows:
[0163] Upstream primer (Sequence ID NO.25): 5′-CTTCTAACCGAGGTCGAAACGTA-3′;
[0164] Downstream primer (Sequence ID NO.26): 5′-GGTGACAGGATTGGTCTTGTCTTTA-3′
[0165] Experimental results are as follows Figure 4E -G is shown.
[0166] exist Figure 4E In the bar chart, the left bar represents the DMSO control, with a mean viral RNA copy number of 1.06. The right bar represents the test wells for pungent glycosides, with a mean viral RNA copy number of 0.05, which is significantly lower than that of the control group. Using a two-tailed unpaired t-test, the statistical difference was p = 0.0009.
[0167] exist Figure 4F In the bar chart, the left bar represents the DMSO control, with a mean viral RNA copy number of 0.98. The right bar represents the test wells for pungent glycosides, with a mean viral RNA copy number of 0.48, which is significantly lower than the control group. Using a two-tailed unpaired t-test, the statistical difference was *p = 0.0032.
[0168] exist Figure 4GIn the bar chart, the left bar represents the DMSO control, with a mean viral RNA copy number of 1.03. The right bar represents the test wells for pungent glycosides, with a mean viral RNA copy number of 0.62, which is significantly lower than the control group. Using a two-tailed unpaired t-test, the statistical difference was p = 0.0003.
[0169] The above results indicate that pungent glycoside can inhibit the replication of multiple viruses at the cellular level, including HCoV-229E, HCoV-OC43, and H1N1-PR8.
[0170] Example 6: Punicin inhibits VSV replication in animals
[0171] Experimental methods:
[0172] (1) BALB / c mice (the animals were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd., male, 8 weeks old, about 20g) were randomly divided into two groups, A and B, with 5 mice in each group.
[0173] (2) On day 0, 200 μL of pungent glycoside (in which pungent glycoside was dissolved in PBS and prepared to a concentration of 1.0 mg / mL) was administered to group A by gavage, and the dosage was 10 mg / kg. An equal volume of phosphate buffer solution (PBS) was administered to group B by gavage.
[0174] (3) On day 1, group A was administered 200 μL of punicalin (dissolved in PBS to a concentration of 1.0 mg / mL) by gavage, with a dosage of 10 mg / kg. Group B was administered an equal volume of PBS by gavage. Simultaneously, both groups of BALB / c mice were intraperitoneally injected with 20 μL of VSV (10... 7 PFU / mL).
[0175] (4) On day 2 (24 hours after VSV infection), mice were sacrificed, and lung and spleen tissues were collected. RNA was extracted from the lung and spleen tissues by TRIZOL lysis, and the replication level of VSV RNA was detected by RT-qPCR.
[0176] The primer and probe set used for VSV RT-qPCR is as follows:
[0177] Upstream primer (Sequence ID NO.27):
[0178] 5′-TGATACAGTACAATTATTTTGGGAC-3′;
[0179] Downstream primer (Sequence ID NO.28):
[0180] 5′-GAGACTTTCTGTTACGGGATCTGG-3′
[0181] The required fluorescent probe for detection (Sequence ID NO.29):
[0182] 5′-FAM-ATGATGCATGATCCAGC-BHQ1-3′.
[0183] Experimental results are as follows Figure 4H -I is shown.
[0184] exist Figure 4H In the bar chart, the left bar represents the PBS control, with a mean relative viral RNA copy number of 0.97. The right bar represents the test wells for pungent glycosides, with a mean relative viral RNA copy number of 0.23, which is significantly lower than the control group. Using a two-tailed unpaired t-test, the statistical difference was p = 0.0003.
[0185] exist Figure 4I In the bar chart, the left bar represents the PBS control, with a mean relative viral RNA copy number of 1.20. The right bar represents the test wells for pungent glycosides, with a mean relative viral RNA copy number of 0.46, which is significantly lower than the control group. Using a two-tailed unpaired t-test, the statistical difference was p < 0.0001.
[0186] The above results indicate that pungent glycoside can inhibit VSV replication at the animal level.
Claims
1. Use of pungent glycoside in the preparation of a drug for the prevention or treatment of viral infections caused by viruses containing N protein or for the inhibition of viruses containing N protein.
2. The use of claim 1, wherein the virus is an RNA virus, such as the virus selected from coronavirus, flavivirus, influenza virus, vesicular stomatitis virus, herpes simplex virus, human immunodeficiency virus, rabies virus, measles virus, Hantavirus, and hepatitis virus.
3. Use of any of the preceding claims, wherein the virus is a coronavirus, preferably selected from HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, MERS-CoV, SARS-CoV and SARS-CoV-2 or mutant strains thereof; more preferably SARS-CoV-2 or mutant strains thereof, wherein the mutant strain is selected from WIV04 mutant strain, Alpha mutant strain, Beta mutant strain, Gamma mutant strain, Delta mutant strain, Lambda mutant strain, Omicron mutant strain, Deltacron mutant strain, mouse-adapted strain C57MA14 or mutant strains thereof, Epsilo mutant strain, Eta mutant strain, Iota mutant strain, Kappa mutant strain, Zeta mutant strain, Mu mutant strain or any other mutant strain.
4. Use of any of the preceding claims, wherein the virus is a virus of the family Rhabdoviridae, preferably a virus of the genus Vesicular Virus, and most preferably Vesicular Stomatitis Virus (VSV).
5. The use of any of the preceding claims, wherein the virus is selected from influenza viruses, preferably H1N1, H2N2, H3N2, H5N1, H7N7 or H9N2, more preferably H1N1, more preferably H1N1-PR8 mutant strain, and most preferably H1N1-PR8 mutant strain.
6. The use of any of the preceding claims, wherein the virus is selected from SARS-CoV-2 or its mutant strains (such as WIV04 mutant, Alpha mutant, Beta mutant, Gamma mutant, Delta mutant, Lambda mutant, or Omicron mutant); mouse-adapted strain C57MA14 or its mutant strain; HCoV-OC43 or its mutant strain; HCoV-229E or its mutant strain; influenza A virus or its subtype or mutant strain (such as H1N1, preferably H1N1-PR8); and VSV virus or its mutant strain.
7. A method for preventing or treating viral infection caused by a virus containing an N protein in an individual, or for inhibiting a virus containing an N protein in an individual, the method comprising administering an effective amount of pungent glycoside to the individual.
8. A method for in vitro inhibition of a virus containing an N protein, the method comprising contacting the virus with an effective amount of pungent glycoside.
9. A pharmaceutical composition comprising punicin, optionally comprising a pharmaceutically acceptable carrier, said pharmaceutical composition for inhibiting viruses containing N protein or for preventing or treating viral infections caused by viruses containing N protein.
Citation Information
Cited By
Application of punicalagin in preparation of composition for preventing and treating porcine envelope virus infection, composition for preventing and treating porcine envelope virus infection and use method of composition
CN121102257A