Polynucleotide with effect of resisting intracellular replication virus and application of polynucleotide

Abstract

The invention discloses polynucleotide with an effect of resisting an intracellular replication virus and application of the polynucleotide, and belongs to the technical field of biotechnology and genetic engineering. The invention provides an application of polynucleotide or an accelerant thereof in preparation of a product for resisting an intracellular replication virus. The molecular fragment containing the polynucleotide has high specificity, can effectively inhibit the replication of various intranuclear replication viruses, and has wide application prospects in the development of drugs for preventing and treating related virus infectious diseases.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology and genetic engineering, and particularly relates to a polynucleotide with an anti-nuclear replication virus effect and use thereof. BACKGROUND

[0002] Viral infection seriously threatens human health, especially some DNA viruses and RNA viruses that rely on host cell nucleus to complete genome replication and transcription, such as herpes simplex virus (HSV), human immunodeficiency virus (HIV), influenza virus, etc. For a long time, because the life cycle of these viruses involves key steps in the nucleus, higher requirements have been put forward for antiviral therapeutic drugs [1] . Type I herpes simplex virus (HSV-1) is a widely transmitted neurotropic DNA virus. If pregnant women have active HSV-1 infection during delivery, they can transmit it to newborns through the birth canal, leading to severe neonatal herpes, including disseminated infection and central nervous system infection, with a high mortality rate [2] .

[0003] Such "nuclear replication viruses" need to enter the cell nucleus through the host nuclear transport pathway during the infection process to achieve viral replication, transcription and assembly, and the key steps are limited by the host nuclear pore complex (NPC) and related transport factors [3;4] . Therefore, it is necessary to explore new antiviral mechanisms, such as regulating host-specific viral restriction factors, to develop more effective methods against nuclear replication viruses.

[0004] Importin family as a nuclear transport protein plays an important role in the life cycle of viruses. Importin-β family member IPO5 (Importin 5) is widely reported to mediate the nuclear transport of various viral proteins and is an important dependent factor for multiple nuclear replication viruses [5] . However, there is currently a lack of new intervention means that is efficient, safe and specific to regulate such nuclear transport pathways.

[0005] Traditional miRNA regulates viruses by targeting mRNA with seed sequences. For viruses, miRNA directly targets viral RNA to inhibit viral replication through the RNA interference (RNAi) mechanism. For example, some miRNAs can play an antiviral role, such as miR-323, miR-491 and miR-654 targeting influenza A virus (IAV) PB1 gene RNA, miR-188 targeting influenza virus PB2 gene RNA, resulting in viral RNA degradation and inhibition of replication [6; 7]In addition, miR-28, miR-125b, and others are reported to inhibit viral replication by binding to the 3' UTR of the human immunodeficiency virus (HIV-1) gene through seed sequence, while also promoting latent infection [8] .

[0006] Current miRNA molecules have the following problems in antiviral strategies:

[0007] 1. High target specificity and dependence on seed sequence, making it difficult to achieve broad-spectrum antiviral effects

[0008] Traditional miRNA antiviral mechanisms mainly rely on the direct binding of their seed sequences (7-8 nt) to viral RNA, and promote viral RNA degradation or inhibit protein translation through the RNA interference (RNAi) mechanism [9] . For example, the binding of miR-29s to the 5' UTR of HCV has high specificity, which allows it to inhibit HCV viral replication

[10] . At the same time, due to the high mutation rate of RNA viruses, the target sequence of viral RNA may mutate, reducing or losing the binding ability of miRNA, thereby reducing the antiviral effect.

[0009] 2. The influence of miRNA on multiple host targets is difficult to accurately control

[0010] miRNAs usually have multi-target regulation ability, one miRNA can target dozens to hundreds of genes, which may not only target antiviral factors, but also affect normal physiological functions

[11] . miR-9 promotes HSV-1 genome heterochromatinization by inhibiting Oct-1 and ONECUT family, maintaining latent infection. At the same time, in neurons, miR-9 inhibits viral lytic gene expression, reducing viral replication

[12] . Therefore, host miRNA-mediated antiviral strategies may have non-specific targeting problems in certain cases, leading to side effects.

[0011] Therefore, it is of great scientific significance and broad application prospects for developing a new class of miRNA molecules that can specifically recognize and interfere with viral nuclear transport mechanisms to resist nuclear replication viruses.

[0012] [1] Lucic B, De Castro I J, Lusic M. Viruses in the Nucleus[J]. Cold Spring Harb Perspect Biol, 2021, 13(8).

[0013] [2] Everett R D. HSV-1 biology and life cycle[J]. Methods Mol Biol,2014, 1144: 1-17.

[0014] [3] Kobiler O, Afriat A. The Fate of Incoming HSV-1 Genomes Enteringthe Nucleus[J]. Curr Issues Mol Biol, 2021, 41: 221-266.

[0015] [4] Ahmad I, Wilson D W. HSV-1 Cytoplasmic Envelopment and Egress[J].Int J Mol Sci, 2020, 21(17).

[0016] [5] Patouret R. The Nuclear Transport Protein Importin-5: A PromisingTarget in Oncology and Virology[J]. Chimia (Aarau), 2021, 75(4): 319-322.

[0017] [6] Cui H, Zhang C, Zhao Z, et al. Identification of cellularmicroRNA miR-188-3p with broad-spectrum anti-influenza A virus activity[J].Virology Journal, 2020, 17(1): 12.

[0018] [7] Song L, Liu H, Gao S, et al. Cellular microRNAs inhibitreplication of the H1N1 influenza A virus in infected cells[J]. Journal ofVirology, 2010, 84(17): 8849-8860.

[0019] [8] Huang J, Wang F, Argyris E, et al. Cellular microRNAs contributeto HIV-1 latency in resting primary CD4+ T lymphocytes[J]. Nature Medicine, 2007, 13(10): 1241-1247.

[0020] [9] Diener C, Keller A, Meese E. Emerging concepts of miRNAtherapeutics: from cells to clinic[J]. Trends Genet, 2022, 38(6): 613-626.

[0021]

[10] Ono C, Fukuhara T, Motooka D, et al. Characterization of miR-122-independent propagation of HCV[J]. PLoS Pathog, 2017, 13(5): e1006374.

[0022]

[11] Xu W, San Lucas A, Wang Z, et al. Identifying microRNA targetsin different gene regions[J]. BMC Bioinformatics, 2014, 15 Suppl 7(Suppl 7):S4.

[0023]

[12] Deng Y, Lin Y, Chen S, et al. Neuronal miR-9 promotes HSV-1epigenetic silencing and latency by repressing Oct-1 and Onecut family genes[J]. Nature Communications, 2024, 15(1). SUMMARY

[0024] Problem to be solved by the invention

[0025] The present application aims to provide a polynucleotide with anti-intranuclear replication virus effect and its use, aiming to overcome the lack of precise intervention in the viral nucleic transport link in the prior art, expand the antiviral function of host natural immune factors, and develop new, efficient and specific antiviral means and RNA drugs.

[0026] Solution for solving the problem

[0027] The present application systematically studies the regulatory effect of miR-29b and its target gene IPO5 in the process of intranuclear replication virus infection at in vitro and in vivo levels. Specifically, the present application first determines that the 3' end six-nucleotide nuclear localization element (AGUGUU) of miR-29b can specifically bind to IPO5 and thereby block the competitive interaction of viral proteins with IPO5. This functional fragment can exist in the complete sequence of miR-29b (SEQ ID NO: 1) to play a role, and can also combine with other miRNAs such as let-7a and miR-34a to obtain antiviral activity (SEQ ID NO: 11, SEQ ID NO: 12). In HeLa cells with high expression of miR-29b and HeLa and iBMM treated with a miR-29b inhibitor, HSV-1 and PR8 virus infection is performed respectively, and the virus replication level and virus titer are detected, while it is determined that miR-29b does not inhibit the replication of HSV-1 through the seed sequence; next, it is determined that miR-29b regulates the replication of HSV-1 virus by targeting IPO5; further, by using a miR-29b six-nucleotide element mutant mouse, the present application verifies the key role of the functional element in anti-HSV-1 infection at in vivo and cellular levels.

[0028] Specifically, the following technical solutions are provided:

[0029] [1]. Use of a polynucleotide derived from miR-29b or a promoter thereof in the preparation of a product for resisting intranuclear replication viruses, wherein,

[0030] The polynucleotide comprises a nuclear localization element sequence AGUGUU consisting of six nucleotides, and the sequence is located at the 3' end of miR-29b;

[0031] The anti-intranuclear replication virus includes reducing the level of viral gene transcription and / or reducing the virus titer.

[0032] [2]. The use according to [1], wherein the polynucleotide is selected from any one of the following (i)-(iii):

[0033] (i) a polynucleotide comprising a sequence as shown in SEQ ID NO: 1;

[0034] (ii) a mutant of a polynucleotide comprising the sequence as set forth in SEQ ID NO: 1, the mutant comprising a substitution, a deletion, a duplication, or an addition of 1-5 nucleotides at one or two positions of the sequence as set forth in SEQ ID NO: 1, and the mutant having an anti-endoreplicating virus activity;

[0035] (iii) a polynucleotide having at least 90%, alternatively at least 93%, preferably at least 95%, most preferably at least 99% sequence identity to the nucleotide sequence as set forth in (i) or (ii), and having an anti-endoreplicating virus activity.

[0036] [3]. The use according to any one of [1] or [2], wherein the promoter is selected from a substance that increases the level of the polynucleotide, stabilizes the polynucleotide, or promotes the function of the polynucleotide; alternatively, the promoter is selected from at least one of an overexpression vector of the polynucleotide, an exogenously isolated and purified polynucleotide, an in vitro transcribed RNA of the polynucleotide, and a cell that highly expresses the polynucleotide.

[0037] [4]. The use according to any one of [1] to [3], wherein the endoreplicating virus comprises a herpes virus, an adenovirus, and an influenza virus.

[0038] [5]. The use according to [4], wherein the herpes virus comprises a herpes simplex virus;

[0039] alternatively, the herpes simplex virus comprises a herpes simplex virus type I (HSV-1);

[0040] the influenza virus comprises PR8.

[0041] [6]. The use according to any one of [1] to [5], wherein the product comprises a drug and a pharmaceutical composition.

[0042] alternatively, the pharmaceutical composition further comprises one or more drugs clinically anti-endoreplicating virus and / or one or more pharmaceutically acceptable carriers;

[0043] alternatively, the pharmaceutically acceptable carrier comprises one or more than two combinations of a solvent, a solubilizer, a cosolvent, an emulsifier, a flavoring agent, an odorant, a coloring agent, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure adjusting agent, a pH adjusting agent, a stabilizer, a surfactant, and a preservative.

[0044] [7]. The use according to any one of [1] to [6], wherein the anti-endoreplicating virus comprises:

[0045] (a1) protecting a host from a viral infection;

[0046] (a2) enhancing the host's resistance to viral infection;

[0047] (a3) reducing the host's tissue organ damage caused by viral infection;

[0048] Optionally, the anti-nucleic replication virus comprises reducing the viral RNA level and / or the viral particle number in the host;

[0049] Optionally, the anti-nucleic replication virus comprises reducing the cell damage caused by viral infection;

[0050] Optionally, the cell damage comprises karyopyknosis.

[0051] [8]. The use according to [6] or [7], wherein the host is an animal that can be infected by a nucleic replication virus.

[0052] Optionally, the host comprises a mammal.

[0053] Optionally, the mammal comprises mouse, rat, guinea pig, cow, sheep, cat, dog, horse, rabbit, pig, monkey and human.

[0054] [9]. Use of a polynucleotide derived from miR-29b in the manufacture of an inhibitor of IPO5, wherein the polynucleotide comprises a nuclear localization element sequence AGUGUU consisting of six nucleotides, and the sequence is located at the 3' end of miR-29b.

[0055]

[10] . The use according to [9], wherein the polynucleotide is selected from any one of the group consisting of (i)-(iii):

[0056] (i) a polynucleotide comprising the sequence as set forth in SEQ ID NO: 1 ;

[0057] (ii) a mutant of the polynucleotide comprising the sequence as set forth in SEQ ID NO: 1, which mutant comprises a substitution, a deletion, a duplication or an addition of 1-5 nucleotides at one or two positions of the sequence as set forth in SEQ ID NO: 1, and which mutant has anti-nucleic replication virus activity;

[0058] (iii) a polynucleotide having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to the nucleotide sequence as set forth in (i) or (ii), and having anti-nucleic replication virus activity.

[0059] Effects of the invention

[0060] This invention is the first to discover that the host miRNA miR-29b can directly bind to the nuclear transporter IPO5 via its nuclear localization sequence “AGUGUU” (a hexanucleotide element (6nt)), thereby competitively blocking the interaction between viral proteins and IPO5. This significantly inhibits the nuclear transport of proteins and subsequent replication processes of intranuclear replicating viruses such as HSV-1. This hexanucleotide element plays an important role in combating intranuclear replicating viruses. miR-29b effectively inhibits viral replication in both HeLa cells and mouse iBMM cells, exerting its effect by inhibiting the function of the viral promoter IPO5.

[0061] This invention is based on the non-classical regulatory mechanism of endogenous miRNAs, which has advantages such as high targeting, low toxicity, and broad-spectrum antiviral activity against nuclear replication viruses. At the same time, the synthesis and delivery platform of miRNA drugs is becoming increasingly mature and has good industrialization prospects. The applications provided by this invention are expected to be used in the prevention and treatment of various virus-related diseases (such as viral pneumonia, herpetic encephalitis, etc.) such as HSV-1 and influenza virus, providing new tools for public health emergencies. Attached Figure Description

[0062] Figure 1 The binding of miR-29b specifically to IPO5 was demonstrated: HEK293T cells were transfected with pcDNA3.1-IPO5 for 24 hours, followed by cell lysis. Immunoprecipitation was performed using IgG and FLAG magnetic beads, respectively, and the level of miR-29b binding to IPO5 was detected by qPCR. Figure 1 A); Immunoprecipitation was performed on HeLa cell lysates using IgG and IPO5 antibodies, respectively, and the levels of miR-29b and miR-29a bound to IPO5 were detected by qPCR. Figure 1 B); In HeLa cell lysate, immunoprecipitation was performed using biotinylated miR-29b and NC, respectively, followed by enrichment using streptavidin magnetic beads. Figure 1 C); After transfecting HEK293T cells with pcDNA3.1-IPO5 for 24 h, the cells were lysed, and IPO5 protein was enriched using FLAG magnetic beads and then replaced with FLAG peptides; biotinylated miR-29b was coated onto streptavidin plates, and FLAG peptides and the replaced IPO5 protein were used to bind to the coated plates, respectively. The results were obtained by colorimetric analysis using HRP and TMB. Figure 1 D).

[0063] Figure 2This demonstrates that miR-29b inhibits PR8 and HSV-1 viral replication in HeLa cells: After transfecting HeLa cells with miR-29b (10 nM) or NC (10 nM) for 12 h, the cells were infected with PR8 (MOI=1) and HSV-1 (MOI=1) viruses for 6 and 12 h, respectively. 0 h was considered uninfected. RT-qPCR was used to detect PR8 viral RNA (…). Figure 2 A), HSV-1 viral RNA ( Figure 2 B); Collect cell supernatant from HeLa cells 12 and 24 h after HSV-1 infection and use TCID50. 50 Method for detecting viral titer ( Figure 2 C). HeLa cells were transfected with miR-29a (10 nM or 20 nM) or NC (10 nM or 20 nM) for 12 h, followed by infection with HSV-1 (MOI=1) virus for 6 and 12 h. HSV-1 viral RNA was detected by RT-qPCR. Figure 2 D); HeLa cells were transfected with 10 nM of NC, miR-29b, let-7a, miR-34a, let-7a-6nt, and miR-34a-6nt, respectively. After 12 h, the cells were infected with HSV-1 virus (MOI=1) for 6 and 12 h, respectively. HSV-1 viral RNA was detected by RT-qPCR. Figure 2 E).

[0064] Figure 3 The study demonstrated that miR-29b inhibitors promoted PR8 and HSV-1 viral replication: HeLa cells were treated with 5 nM miR-29b inhibitor for 12 h, followed by infection with PR8 (MOI=1) and HSV-1 (MOI=1) viruses for 6 and 12 h, respectively. 0 h was considered uninfected. HSV-1 viral RNA was detected by RT-qPCR. Figure 3 A), PR8 viral RNA ( Figure 3 B).

[0065] Figure 4 This study demonstrated that IPO5 promotes viral replication: IPO5 was overexpressed in HeLa cells, and HSV-1 (MOI=1) and PR8 (MOI=1) were infected for 6 h and 12 h, respectively. RT-qPCR was used to detect HSV-1 viral RNA (…). Figure 4 A), PR8 viral RNA ( Figure 4 B); IPO5 was knocked down in HeLa cells using siRNA, and HSV-1 (MOI=1) and PR8 (MOI=1) were infected for 6 h and 12 h, respectively. HSV-1 viral RNA was detected by RT-qPCR. Figure 4 C), PR8 viral RNA ( Figure 4D).

[0066] Figure 5 This demonstrates that miR-29b inhibits the binding of IPO5 to the nuclear translocation protein of the virus replicating in the nucleus: After transfecting HEK293T cells with IPO5 and influenza virus PB1 for 12 h, followed by transfection with miR-29b (10 nM) for 12 h, the binding of PB1 to IPO5 was detected by Co-IP. Figure 5 A); After transfecting HEK293T cells with IPO5 and HSV-1 virus UL47 for 12 h, they were transfected with miR-29b (10 nM) for 12 h. UL47 binding to IPO5 was detected by Co-IP. Figure 5 B); After transfecting HEK293T cells with IPO5 and influenza virus UL47 for 12 h, they were transfected with miR-29a (10 nM) for 12 h. UL47 binding to IPO5 was detected by Co-IP. Figure 5 C).

[0067] Figure 6 This study demonstrated that miR-29b replication requires IPO5: After overexpressing IPO5 for 24 h in HeLa cells, followed by treatment with a 5 nM miR-29b inhibitor for 12 h, HSV-1 infection (MOI=1) was performed for 6 h and 12 h. HSV-1 viral RNA was detected by RT-qPCR. Figure 6 A); After knocking down IPO5 with siRNA for 36 h in HeLa cells, transfecting with miR-29b (10 nM) for 12 h, followed by infection with HSV-1 (MOI=1) for 6 h and 12 h, HSV-1 viral RNA was detected by RT-qPCR ( Figure 6 B); In the IPO5 knockout HeLa cell line sgIPO5, after transfection with miR-29b (10 nM) for 12 h, HSV-1 was infected (MOI=1) for 6 h and 12 h, and HSV-1 viral RNA was detected by RT-qPCR. Figure 6 C).

[0068] Figure 7 The hexanucleotide element mutation of miR-29b showed that it lost its antiviral activity: transfection of miR-29b (10 nM) into HeLa cells, miR-29b AGCGUU (10 nM), miR-29b AGCGCU HSV-1 viral RNA was detected by RT-qPCR 6 and 12 h after infection with either 10 nM or NC (10 nM) for 12 h (MOI=1). 0 h was considered uninfected. Figure 7 A); in miR-29b11mut _b2 1mut miR-29b1 2mut _b2 1mut Infecting WT iBMM cells with HSV-1 (MOI=1) for 6 and 12 hours, HSV-1 viral RNA was detected by RT-qPCR. Figure 7 B), collect cell supernatant 12 and 24 h after HSV-1 infection and use TCID45. 50 Method for detecting viral titer ( Figure 7 C); in WT, miR-29b1 1mut _b2 1mut miR-29b1 2mut _b2 1mut PR8 virus RNA was infected in iBMM cells (MOI=1) for 6 h, and PR8 viral RNA was detected by RT-qPCR. Figure 7 D).

[0069] Figure 8 The study showed that mice with a hexanucleotide element mutation in miR-29b lost their antiviral activity: at 8 weeks, miR-29b-WT and miR-29b1... 1mut _b2 1mut miR-29b1 2mut _b2 1mut C57BL / 6 mice (n=6) were intracranially injected with 1000 pfu of HSV-1 virus or an equal volume of physiological saline. Serum IFN-β levels were measured 12 h after infection using ELISA. Figure 8 A), 72-hour serum IFN-β level ( Figure 8 B) and CXCL 10 level ( Figure 8 C); ELISA was used to detect IFN-β levels in brain tissue 72 hours after infection ( Figure 8 D) and CXCL 10 level ( Figure 8 E); RT-qPCR detection of HSV-1 viral RNA in brain tissue infected for 72 h ( Figure 8 F), using hematoxylin-eosin staining to detect brain tissue cell damage (F) Figure 8 G); due to miR-29b1 1mut _b2 1mut miR-29b1 2mut _b2 1mut In mice, miR-29b1 showed similar antiviral effects against HSV-1 infection compared to WT mice in vivo; therefore, miR-29b1 was used. 1mut _b2 1mut miR-29b1 2mut _b2 1mutAfter mixing, randomly select mice as miR-29b-mut group, intracranially inject 500 pfu of HSV-1 virus or equal volume of normal saline into 8-week-old miR-29b-WT, miR-29b-mut C57BL / 6 mice (n=10), and count the survival of mice within 14 days Figure 8 H}. DETAILED DESCRIPTION

[0070] Various exemplary embodiments, features, and aspects of the present application will be described in detail below. The word "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.

[0071] In addition, for the purpose of better illustrating the present application, numerous specific details are set forth in the following detailed description. Those skilled in the art will appreciate that the application can be practiced without some or all of the specific details. In other instances, well known methods, apparatuses, materials and steps have not been described in detail in order to avoid obscuring the application.

[0072] Unless otherwise stated, all measurements, values, ratings, positions, magnitudes, sizes, and other specifications that are not otherwise qualified are understood to be at the international system of units (SI) unit. The numerical values, numerical ranges, and other values expressed in the present application should be understood to include system errors that are inevitable in industrial production.

[0073] In the present application, the term "microRNA" (miRNA) refers to a class of endogenous small non-coding RNA molecules widely present in eukaryotes, usually 18 to 25 nucleotides in length (common range 20-24 or 21-25 nucleotides), encoded by the genome and transcribed by RNA polymerase II. They guide the RNA-induced silencing complex (RISC) to act by base complementary pairing with the 3' untranslated region of the target messenger RNA (mRNA), resulting in degradation, translation inhibition or de-adenylation of the target mRNA, thereby down-regulating gene expression. miRNA is highly conserved in species evolution, with tissue specificity and developmental timing, involved in regulating cell differentiation, proliferation, apoptosis, development process, metabolism and the occurrence of various diseases (such as cancer and heart disease), and a miRNA can target multiple genes, and a gene can be co-regulated by multiple miRNAs, forming a complex gene regulation network.

[0074] In the present application, the term "miR-29b" refers to a single-stranded non-coding RNA of about 22 nucleotides in length, belonging to the microRNA family, highly conserved in a variety of organisms, mainly playing a tumor suppressor role in tumor occurrence, and the 3' end sequence has a nuclear localization function.

[0075] In the present invention, the term "polynucleotide" refers to a polymer composed of nucleotides. A polynucleotide can be in the form of a separate fragment, or can be a component of a larger nucleotide sequence structure, which is derived from a nucleotide sequence isolated at least once in quantity or concentration, and can be identified, manipulated, and recovered by standard molecular biology methods (e.g., using cloning vectors) and its component nucleotide sequences. When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), it also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T". In other words, "polynucleotide" refers to a nucleotide polymer removed from other nucleotides (either separate fragments or entire fragments), or can be a component or ingredient of a larger nucleotide structure or composition, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences. In some specific embodiments of the present invention, the polynucleotide refers to a polynucleotide derived from miR-29b.

[0076] In the present invention, the term "herpes virus" is a group of enveloped double-stranded DNA viruses with similar biological characteristics, which are classified as Herpesviridae. More than 100 types have been found, which can be divided into three categories (subfamilies) of α, β, and γ. They infect a wide range of hosts, mainly affecting skin, mucosa, and neural tissue, and seriously affect the health of humans and other animals. Currently, eight types of herpes viruses that can infect humans have been found, including herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), varicella-zoster virus (VZV), Epstein-Barr virus (EBV), human cytomegalovirus (HCMV), human herpes virus 6 (HHV-6), human herpes virus 7 (HHV-7), and Kaposi's sarcoma-associated herpesvirus (KSHV).

[0077] In the present application, the term "adenovirus" is a double-stranded DNA virus without envelope, belonging to the family of adenoviruses, which was first isolated from human adenoid or tonsil tissue in 1953. The virus particle is icosahedral structure, with a diameter of about 70-110 nm, and the genome size is 30-38 kb. At present, at least 47 human serotypes have been found, which are divided into seven subgroups (or subgroups) A-G. Different serotypes have tissue tropism and can infect respiratory tract, digestive tract, ocular mucosa and lymphoid tissue. The replication of adenovirus is strictly dependent on the host cell nucleus environment. After the genome is transported into the nucleus through the nuclear pore, it is finally assembled into a virus particle in the nucleus. After infection, it can cause various diseases, including respiratory diseases (such as fever, pneumonia), conjunctivitis, gastroenteritis, cystitis, etc.

[0078] In the present application, the term "influenza virus" (Influenza A Virus) is a single-stranded negative-strand RNA virus belonging to the family of Orthomyxoviridae, which can cause acute respiratory infectious diseases such as influenza (commonly known as influenza). The virus particle is spherical or filamentous, the core is composed of 8 segmented RNA genome and nucleoprotein (NP) with helical symmetry nuclear capsid, and the outer envelope is inlaid with two key glycoprotein spikes of hemagglutinin (HA) and neuraminidase (NA). According to the virus nucleoprotein and matrix protein, it is divided into four types of A, B, C and D (or A, B, C and D).

[0079] In the present application, the term "PR8" refers to a laboratory adapted strain of H1N1 subtype of influenza A virus (A / Puerto Rico / 8 / 34), which was first isolated from a patient in Puerto Rico in 1934, and became a high-yield candidate vaccine backbone virus after continuous passage in chicken embryos. It belongs to the family of Orthomyxoviridae, single-stranded negative-strand RNA virus, and the genome is composed of 8 independent segments (total length of about 13.6 kb), which encodes at least 10 functional proteins. The envelope surface is distributed with hemagglutinin (HA) and neuraminidase (NA) glycoprotein protrusions, and the inside is a ribonucleoprotein complex (RNP) and matrix protein.

[0080] In the present application, the term "IPO5 protein" (Importin-5), also known as Ran-binding protein 5 (RANBP5) or karyopherin beta 3 (KPNB3), is a key nuclear transport receptor belonging to the importin beta superfamily. Its main function is to mediate the selective transport of proteins and RNA molecules between the nucleus and cytoplasm, and to regulate the nuclear-cytoplasmic transport process of the substrate by recognizing the nuclear localization signal (NLS) or nuclear export signal (NES) of the substrate protein, depending on the RanGTPase system. IPO5 contains a typical HEAT repeat domain in structure, which can specifically bind to the nuclear pore protein of the nuclear pore complex (NPC), and complete the transmembrane transport of the substrate using the energy generated by RanGTP hydrolysis. Abnormal expression of IPO5 is related to viral infection, and as a nuclear transport carrier for viral proteins, its function is hijacked by viruses such as influenza and HIV to complete the life cycle.

[0081] As used herein, the terms "sequence identity" and "percent identity" refer to the percentage of nucleotides that are identical (i.e., identical) between two or more polynucleotides. The sequence identity between two or more polynucleotides can be determined by aligning the polynucleotide sequences and scoring the number of positions of the aligned polynucleotides that contain different nucleotides, and comparing it to the number of positions of the aligned polynucleotides that contain identical nucleotides. A polynucleotide can differ at one position by containing a different nucleotide (i.e., a substitution or mutation) or by lacking a nucleotide (i.e., an insertion or deletion of a nucleotide in one or both polynucleotides). Exemplarily, two or more sequences or subsequences have "sequence identity" or "percent identity" of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleotides when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In certain embodiments, the sequences are substantially identical over the entire length of either or both of the biological polymers (e.g., polynucleotides) being compared.

[0082] The guide RNA (sgRNA) described in the present application refers to an sgRNA compatible with the CRISPR nuclease. The sgRNA can generally comprise a scaffold sequence and a guide sequence (also known as a seed sequence or a spacer sequence). The guide sequence is arranged to have sufficient sequence identity (preferably 100% identity) with the target sequence, so as to be able to bind to the complementary strand of the target sequence through base pairing, achieving sequence-specific targeting. The scaffold sequence is generally dependent on the CRISPR nuclease used.

[0083] As used herein, the term "viral infection" refers to the process by which a virus invades the body through various routes and multiplies in susceptible host cells, and the pathogenicity of the virus begins from the invasion of the host, the infected cells, and the pathogenic effect is manifested in the whole body and cells.

[0084] The term "treatment" refers to: after suffering from a disease, the subject is contacted (for example, administered) with the IPO5 inhibitor of the present application or its pharmaceutical composition, etc., so that the symptoms of the disease are partially or completely alleviated, improved, relieved, inhibited, delayed, reduced in severity and / or reduced in incidence of one or more symptoms or characteristics of a specific disease, disorder and / or condition compared with not being contacted, and it does not mean that the symptoms of the disease must be completely inhibited. Suffering from a disease means that the body has symptoms of the disease.

[0085] The present application systematically studies the regulatory role of miR-29b and its target gene IPO5 in the process of infection of DNA viruses and RNA viruses that replicate in the nucleus at the in vitro and in vivo levels. Specifically, in HeLa cells with high expression of miR-29b and HeLa and iBMM treated with miR-29b inhibitors, HSV-1 and PR8 virus infections are performed respectively, the virus replication level and virus titer are detected, and it is determined that miR-29b does not inhibit the replication of HSV-1 through the seed sequence; next, it is determined that miR-29b regulates the replication of HSV-1 virus through IPO5; further, the function of miR-29b in anti-HSV-1 is explored at the in vivo and cellular levels by using miR-29b-6nt mutant mice. Further, the inventors randomly select two miRNAs that have not been reported to be involved in the inhibition of HSV-1 virus replication, and through experimental verification, it is found that let-7a and miR-34a do not regulate the replication of HSV-1 virus, and after replacing the 3' end 6 bases with the 6nt sequence of miR-29b, the anti-HSV-1 virus replication effect appears.

[0086] The present application not only discloses the inhibitory effect of miR-29b in the process of resisting viruses that replicate in the nucleus, but also systematically clarifies the mechanism of miR-29b inhibiting virus replication through nuclear transport protein IPO5, thereby providing a theoretical basis and experimental support for developing a new anti-viral strategy based on miRNA.

[0087] In the present application, the miR-29b and its inhibitors contained therein are selected from: tools for regulating the expression level of miR-29b, miR-29b mimics, miR-29b inhibitors, including but not limited to:

[0088] (a) having the nucleotide sequence shown in SEQ ID NO: 1, the sequence of the miR-29b mimic is modified by phosphorylation at the 5' end of the RNA;

[0089] (b) a six-nucleotide element of miR-29b having the nucleotide sequence of SEQ ID NO: 2.

[0090] In the present application, the viral infection includes DNA virus and RNA virus infection, such as infection caused by one or more of the following viruses: Herpes Simplex Virus-1 (HSV-1), Influenza A virus A / PR / 8 / 34 (H1N1, PR8), etc.

[0091] <Polynucleotide or promoter thereof>

[0092] In some embodiments of the present application, a polynucleotide derived from miR-29b is provided, which comprises a nucleolar localization element sequence AGUGUU consisting of six nucleotides, and the sequence is located at the 3' end of miR-29b.

[0093] In some alternative embodiments, the polynucleotide is selected from any one of the group consisting of (i)-(iii) below:

[0094] (i) a polynucleotide comprising the sequence as shown in SEQ ID NO: 1;

[0095] (ii) a mutant of the polynucleotide comprising the sequence as shown in SEQ ID NO: 1, which comprises substitution, deletion, duplication or addition of 1-5 nucleotides at one or two positions of the sequence as shown in SEQ ID NO: 1, and the mutant has anti-intranuclear replication virus activity;

[0096] (iii) a polynucleotide having at least 90%, alternatively at least 93%, preferably at least 95%, most preferably at least 99% sequence identity to the nucleotide sequence as shown in (i) or (ii), and having anti-intranuclear replication virus activity.

[0097] In some exemplary embodiments, the polynucleotide comprises miR-29b having the sequence as shown in SEQ ID NO: 1, i.e., SEQ ID NO: 1 is the complete sequence of miR-29b. In some embodiments of the present application, the promoter is selected from substances that increase the level of the polynucleotide, stabilize the polynucleotide or promote the function of the polynucleotide; alternatively, the promoter is selected from at least one of the following: an overexpression vector of the polynucleotide, exogenously isolated and purified polynucleotide, in vitro transcribed RNA of the polynucleotide and cells with high expression of the polynucleotide.

[0098] <Use of polynucleotide in the preparation of a product for resisting intranuclear replication virus>

[0099] In some embodiments, the present application provides use of the above-mentioned <polynucleotide> in the preparation of a product for anti-intracellular replication virus.

[0100] In some embodiments, the anti-intracellular replication virus comprises reducing the level of viral gene transcription and / or reducing viral titer.

[0101] In some embodiments, the anti-intracellular replication virus comprises:

[0102] (a1) protecting the host from viral infection;

[0103] (a2) enhancing the host's resistance to viral infection;

[0104] (a3) reducing the damage to the host's tissue and organs caused by viral infection.

[0105] In some alternative embodiments, the anti-intracellular replication virus comprises reducing the level of viral RNA and / or the number of viral particles in the host.

[0106] In some alternative embodiments, the anti-intracellular replication virus comprises reducing the damage to the cell caused by viral infection.

[0107] In some alternative embodiments, the cell damage comprises karyopyknosis.

[0108] In some embodiments, the product comprises a sequence as shown in SEQ ID NO: 1, an expression vector carrying a sequence as shown in SEQ ID NO: 1.

[0109] In some embodiments, the intracellular replication virus comprises herpes virus, adenovirus, and influenza virus.

[0110] In some alternative embodiments, the herpes virus comprises herpes simplex virus.

[0111] In some alternative embodiments, the herpes simplex virus comprises herpes simplex virus type I (HSV-1).

[0112] In some alternative embodiments, the influenza virus comprises PR8.

[0113] In some alternative embodiments, the product comprises a drug and a pharmaceutical composition.

[0114] In some alternative embodiments, the pharmaceutical composition further comprises one or more drugs clinically resistant to the intracellular replication virus and / or one or more pharmaceutically acceptable carriers.

[0115] In some alternative embodiments, the pharmaceutically acceptable carrier comprises one or more than one combination of a solvent, a solubilizer, a co-solvent, an emulsifier, a flavoring agent, an odorant, a colorant, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a pH regulator, a stabilizer, a surfactant, and a preservative.

[0116] In some preferred embodiments, the pharmaceutically acceptable carrier is a stabilizer. By co-combining the stabilizer with the polynucleotide or its facilitator, the polynucleotide or its facilitator can have clinically applicable pharmaceutical stability.

[0117] In some embodiments, the polynucleotide or its facilitator is mixed with one or more pharmaceutically acceptable carriers to be prepared as a solid preparation, a semi-solid preparation, or a liquid preparation. Among them, the applicable solid preparation forms mainly include tablets, capsules, granules, pills, etc.; the applicable semi-solid preparation forms mainly include gels, suppositories, ointments, etc.; the applicable liquid preparation forms mainly include emulsions, mixtures, suspensions, solutions, injections, etc.

[0118] <Use of polynucleotide in preparing IPO5 inhibitor>

[0119] In some embodiments, the present application provides a use of the above-mentioned <polynucleotide> in preparing an IPO5 inhibitor, in some embodiments, the polynucleotide comprises a nucleic localization element sequence AGUGUU consisting of six nucleotides, and the sequence is located at the 3' end of miR-29b.

[0120] In some preferred embodiments, the polynucleotide is selected from any one of the group consisting of (i)-(iii):

[0121] (i) a polynucleotide comprising a sequence as shown in SEQ ID NO: 1;

[0122] (ii) a mutant of the polynucleotide comprising a sequence as shown in SEQ ID NO: 1, the mutant comprising a substitution, a deletion, a duplication, or an addition of 1-5 nucleotides at one or two positions of the sequence as shown in SEQ ID NO: 1, and the mutant having antiviral activity;

[0123] (iii) a polynucleotide having at least 90%, alternatively at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to the nucleotide sequence as shown in (i) or (ii), and having antiviral activity.

[0124] In some embodiments, the IPO5 inhibitor can inhibit the nuclear transport function of IPO5.

[0125] In some exemplary embodiments, the IPO5 inhibitor can inhibit the binding of IPO5 to nuclear replication viral proteins.

[0126] EMBODIMENTS

[0127] Other objects, features and advantages of the present application will become apparent from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating specific embodiments of the application, are given by way of illustration only, since various changes and modifications within the spirit and scope of the application will become apparent to those skilled in the art from this detailed description.

[0128] The experimental techniques and experimental methods used in the present embodiments are all conventional techniques and methods, and for example, the experimental methods not specifically mentioned in the following examples are generally performed according to the conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturers. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0129] Example 1: Experimental methods involved in Examples 2 to 8

[0130] 1. Transfection of miRNA:

[0131] The synthesized RNA dry powder (sequences shown in SEQ ID NO: 1, 2, 3, 4, 10, 11, 12) was centrifuged at room temperature and 10,000 g for 2 min, and dissolved in DEPC water to a concentration of 20 μM. The cells in good growth condition were inoculated in a 12-well plate, and 1 h before transfection, 500 μL of DMEM complete medium was replaced. Each well was prepared with 200 μL of Opti-MEM, 1 μL of INTERFERin transfection reagent (Polyplus, PT-409-10), and the corresponding volume of RNA, vortexed for 3-5 s, centrifuged, and allowed to stand for 15 min. After standing, slowly drop into the well plate and shake evenly. 8 h after transfection, the culture medium was removed, washed once with PBS, and 1 mL of DMEM complete medium was added for continuous culture. The miRNA can be used for the corresponding experiment at 12 h after transfection, and the siRNA can be used for the corresponding experiment at 36 h after transfection.

[0132] 2. Treatment of miR-29b inhibitor (Inhibitor):

[0133] Centrifuge miR-29b Inhibitor (sequence as SEQ ID NO: 5) dry powder at room temperature, 10000 g for 2 min, and dissolve in DEPC water to 20 μM concentration for stock solution. When used, dissolve miR-29b Inhibitor stock solution in DMEM medium to a final concentration of 5 nM, and incubate HeLa cells or iBMDM cells for 12 h before use in subsequent infection experiments.

[0134] 3. RNA extraction and real-time fluorescent quantitative PCR

[0135] (1) TRIzol method for extracting total RNA from cells

[0136] Discard the culture medium in the cell culture plate, wash once with PBS, add 500 μL TRIzol reagent to each well, and lyse the cells for 5 min. Then transfer to a 1.5 mL EP tube. Add 100 μL chloroform to each tube, shake vigorously for 20-30 s to mix the chloroform and TRIzol reagent evenly, and let stand at room temperature for 5 min. After standing, centrifuge at 12000 g and 4 ℃ for 15 min. The liquid is divided into three layers, the uppermost transparent liquid is the aqueous phase containing RNA, the middle white layer is DNA, and the bottommost organic phase contains protein. Carefully pipette the uppermost aqueous phase into a new RNase-free 1.5 mL EP tube, add an equal volume of pre-cooled isopropanol solution, mix well by inverting, and let stand at room temperature for 15 min or on ice for 1 h. Centrifuge at 12000 g and 4 ℃ for 15 min. A white precipitate appears at the bottom of the EP tube, which is the extracted RNA. Wash the white precipitate with 75 % ethanol, centrifuge at 12000 g and 4 ℃ for 5 min, and repeat twice. Carefully aspirate the 75 % ethanol in the centrifuge tube, and centrifuge again for 10 s. Open the EP tube in a fume hood and dry until the precipitate becomes transparent and no liquid remains. Add 20-50 μL DEPC water to each tube and heat in a metal bath at 60 ℃ for 5 min to accelerate RNA dissolution. Dissolved RNA is placed on ice to prevent degradation, and the RNA concentration is determined using a Nanodrop 2000.

[0137] (2) Reverse transcription

[0138] Take 500 ng RNA into 200 μL PCR tube, add 2 μL 5×HiScript III qRT SuperMix (Vazyme, R323-01), add DEPC water to 10 μL, and add 1 μL 2 μM reverse primer if miRNA reverse. Centrifuge the sample to the bottom of the tube, and place the PCR tube in the PCR instrument for reverse transcription. The reverse transcription conditions are 37 ℃, 15 min; 85 ℃, 5 s; 4 ℃. The obtained cDNA can be directly used for RT-qPCR, or stored in a -20 ℃ refrigerator for standby.

[0139] (3) RT-qPCR

[0140] Dilute the cDNA with DEPC water by 9 times, then add 5 μL TaqPro UniversalSYBR qPCR Master Mix (Vazyme, Q712-02), 0.5 μL mixed primer (0.25 μL of forward and reverse primers in Table 1), and 4.5 μL diluted cDNA in a 10 μL reaction system to prepare the reaction. After the reaction is completed, the relative expression amount of the target gene is calculated according to the Ct value and 2 -ΔΔCt

[0141] Table 1: RT-qPCR primers

[0142]

[0143] 4, Virus infection

[0144] Prepare the pretreated (such as transfected) cells, calculate the required virus amount according to the preset MOI (Multiplicity of Infection), and dilute the virus stock solution in Opti-MEM medium. Remove the original cell culture medium, wash the cells with PBS once, and add an appropriate amount of virus dilution. Incubate in a 37 ℃, 5% CO2 incubator for 1 h, and gently shake to promote uniform adsorption. After 1 h of infection, aspirate the virus solution, and add fresh complete medium for continuous culture.

[0145] 5, Western blotting experiment

[0146] ​(1) Preparation of protein sample: discard the culture medium in the cell culture plate, slowly add pre-cooled PBS along the wall, wash once, then add pre-cooled PBS again, use a pipette gun to blow or a cell scraper to gently scrape the cells off, transfer to a new 1.5 mL EP tube, add a small amount of PBS to wash the culture plate and transfer to the corresponding EP tube, centrifuge at 3000 g for 5 min at 4 ℃, and discard the supernatant. Blow the cell pellet to disperse, and lyse on ice for 30 min, vortex every 5 min for 5 s. After lysis, centrifuge at 16000 g for 10 min at 4 ℃, and transfer the lysate supernatant to a new 1.5 mL EP tube.

[0147] (2) Protein concentration determination: follow the instructions of the BCA protein concentration determination kit, finally add 4x protein loading buffer, mix well, denature in a 100 ℃ metal bath for 10 min, and use on ice or store at -80 ℃ for standby.

[0148] (3) Polyacrylamide gel electrophoresis: preparation of protein gel: after cleaning the glass plate, dry it in an oven, align the glass plates horizontally, install them on the gel preparation frame, and prepare the gel according to the instructions of the rapid PAGE gel preparation kit. According to the experimental requirements, prepare the gel with the corresponding concentration.

[0149] Loading: install the prepared PAGE gel in the electrophoresis tank, add the diluted 1x electrophoresis buffer, and carefully pull out the comb vertically. According to the BCA protein concentration determination results, use a 20 μL pipette gun to take the corresponding volume of sample and carefully add it to the well. Finally, add protein markers on both sides of the sample as an indicator.

[0150] Electrophoresis: pre-run at a constant voltage of 80 V for about 30 min, until the sample runs to the lower gel and the protein marker is clearly dispersed. Increase the voltage to 120 V, and terminate the electrophoresis when the bromophenol blue is about to run out of the gel.

[0151] (4) Membrane transfer (semi-dry transfer): soak the PVDF membrane in methanol for about 30 s, and soak the filter paper in 1x transfer buffer. Clean the membrane transfer instrument with a clean non-woven cloth, and place it in the order of filter paper-membrane-gel-filter paper, one layer after another, on the membrane transfer instrument. Note that each layer is rolled repeatedly with a roller to remove air bubbles. Finally, transfer the membrane at a constant voltage of 18 V for 2 h.

[0152] (5) Blocking: prepare 5% skimmed milk powder with PBST, take out the membrane after transfer and place it in 5% skimmed milk powder, and block on a shaker at room temperature for at least 1 h.

[0153] (6) First antibody incubation: wash the membrane with PBST, cut the required position according to the protein marker, put it into the first antibody diluted with the first antibody diluent, and incubate it in the shaker at 4°C overnight.

[0154] (7) Second antibody incubation: dilute the second antibody with PBST, recover the first antibody, wash the membrane with PBST for 3 times, 15 min each time, and incubate the second antibody at room temperature for 1-2 hours after washing.

[0155] (8) Chemiluminescence imaging: after recovering the second antibody, wash the membrane with PBST for 3 times, 15 min each time. After preparing the luminescent solution, develop and image under the development.

[0156] 6, miR-29b-6nt mutant mouse construction:

[0157] (1) miR-29b nuclear localization sequence mutant mouse construction: The miR-29b nuclear localization sequence mutant mouse was designed by the animal center of Suzhou System Medical Research Institute of Chinese Academy of Medical Sciences, and the 6nt element sequence of miR-29b1 and miR-29b2 was mutated by scanning mutation technology. C57BL / 6J and ICR mice are from the Institutional Animal Care and Use Committee (IACUC) of Suzhou System Medical Research Institute. The mice are bred in a specific pathogen-free environment, maintained in a 12-hour light / dark cycle, and provided with free food. C57BL / 6J mice are used as zygote donors, and ICR mice are used as foster mothers. Most of the primary mice (F0) are heterozygotes, and more offspring are obtained by crossing with wild-type C57BL / 6J mice. The heterozygous mutant mice of the offspring are further bred, and finally the homozygous mutant mice mir-29b1 2mut _b2 1mut mouse and mir-29b1 1mut _b2 1mut mouse.

[0158] 7, Establishing a mouse HSV-1 encephalitis model

[0159] (1) Dilute the virus solution: dilute the HSV-1 virus concentrate to 2x10 5 pfu / mL using sterile PBS.

[0160] (2) Anesthesia: use 10% chloral hydrate solution, according to the weight of the mouse, inject 5 μL / g into the mouse.

[0161] (3) Inject HSV-1: after the mouse is completely anesthetized, use a microsyringe to slowly inject 5 μL of diluted virus solution at 5 mm from the midline and 3 mm from the mouse orbit, keep it in place for 30 s, and slowly remove the syringe.

[0162] (4) Sampling: At 12 h, a capillary glass tube was inserted from the mouse inner canthus between the eyeball, rotated about 4 mm along the posterior wall of the orbit to the throat, and 5 μL of blood was dropped. The capillary glass tube was removed and pressed to stop bleeding. At 72 h, the eyeball was removed with forceps, and the mouse blood was collected. After decapitation, the mouse brain tissue was taken. The mouse brain posterior and cerebellum were separated and stored in liquid nitrogen, and the mouse brain anterior was fixed in 4% paraformaldehyde.

[0163] 8. IPO5 overexpression plasmid (pcDNA3.1-IPO5-Flag) construction

[0164] (1) Primer design: The IPO5 (Gene ID: 3843) gene sequence was searched on NCBI, and the primers were designed according to the principles of homologous recombination.

[0165] Forward primer:

[0166] 5'-TAGGGAGACCCAAGCTGGCTAGCATGGCGGCGGCCGCGGCGGAGCAGCAACAGTTCTACCT-3',

[0167] Reverse primer:

[0168] 5'-TAGTCCAGTGTGGTGGAATTCCTACTTGTCATCGTCGTCCTTGTAATCCGCAGAGTTCAGGAGCTCCTGAATGGCG-3';

[0169] (2) Linearization of vector: The vector pcDNA3.1(-) was double digested with restriction endonuclease NheI and EcoRI. The following table system was prepared.

[0170] Table 2: Double enzyme digestion system of pcDNA3.1(-)

[0171]

[0172] After preparation, the nucleic acid electrophoresis was performed in the PCR instrument at 37 ℃ for 2 h, and the correct band was cut off for gel recovery to obtain the linearized vector.

[0173] (3) Amplification of target gene: Human cDNA extracted from HeLa cells was used as a template, and 2 × Phanta Flash Master Mix(Dye Plus) (Vazyme, P520) was used for amplification. The PCR reaction system was as follows.

[0174] Table 3: 2 x Phanta Flash Master Mix PCR reaction system

[0175]

[0176] After the above components are mixed, PCR reaction is carried out in a PCR instrument according to the following reaction conditions:

[0177] Table 4: 2 x Phanta Flash Master Mix PCR reaction program

[0178]

[0179] After the PCR is completed, the PCR product is subjected to nucleic acid electrophoresis, and the band at the target base number position is cut off for gel recovery to obtain the target gene IPO5 fragment.

[0180] (4) Recombination reaction: After the linearized vector and the target fragment are recovered, the concentration is determined, and the recombination reaction (Vazyme, C113) is carried out, and the reaction system is as follows:

[0181] Table 5: MultiS One Step Cloning Kit ligation system

[0182]

[0183] After the above reaction reagents are mixed uniformly, the reaction is carried out in a PCR instrument at 37°C for 30 min to obtain the ligation product.

[0184] (5) Transformation: 30 μL of DH5a is taken on ice, 3 μL of the ligation product obtained in (4) is added, and the ice is placed for 30 min, 42°C metal bath heat shock for 45 s, ice for 2 min, 500 μL of non-resistant LB medium is added, 220 rpm shaking bed at 37°C for 40 min. After taking out, 2500 g centrifugation for 3 min, remove 400 μL of LB medium, blow the remaining 100 μL of LB medium to disperse the precipitate, and spread on an ampicillin-resistant LB plate, 37°C incubator inverted culture for 12-16 h, obtain the plate with single colony.

[0185] (6) Pick single clone and bacterial liquid PCR: pick a single colony on the plate with 10 μL white small gun head, put it in a 1.5 mL sterile centrifuge tube together with the gun head, add 20 μL LB medium containing corresponding ampicillin resistance, blow it apart, take 1 μL for bacterial liquid PCR, and the remaining 19 μL is added to 500 μL LB medium containing ampicillin resistance, incubate at 37 °C, 220 rpm on a shaking bed for 3-4 h, and the obtained bacterial liquid is used as a template. The forward primer of the bacterial liquid PCR is CMV-F: GAGGTCTATATAAGCAGAGC; BGH-R: GCAACTAGAAGGCACAG. The reaction system of the bacterial liquid PCR is as follows (Vazyme, P213):

[0186] Table 6: 2x Taq Master Mix bacterial liquid PCR reaction system

[0187]

[0188] After mixing the above components uniformly, perform the PCR reaction with the following program:

[0189] Table 7: 2x Taq Master Mix bacterial liquid PCR reaction program

[0190]

[0191] After the PCR reaction, run the nucleic acid gel to verify whether the band is correct. If there is no band, the PCR reaction fails; if the band size is 200 bp, the PCR reaction is successful but the gene is not successfully inserted; if the band size is the base number corresponding to the inserted gene plus 200 bp, the PCR reaction is successful and the gene is successfully inserted. Take 100 μL of the bacterial liquid with the correct band for sequencing.

[0192] Through the above method, the plasmid pcDNA3.1-IPO5-Flag is finally constructed and obtained.

[0193] 9. CRISPR-Cas9 constructs knock-out cell lines

[0194] 9.1 Construction of LentiCRISPRv2-sgIPO5 plasmid

[0195] (1) sgRNA design: IPO5 (Gene ID: 3843) genome sequence was downloaded from NCBI website, and sgRNA design website CRISPick (https: / / portals.broadinstitute.org / gppx / crispick / public) was used for design. The designed sgRNA sequence was aligned to the genome sequence of all subtypes of IPO5 using Snapgene, and the sgRNA sequence that can target all subtypes was selected. The guide sequence of sgRNA is shown in SEQ ID NO: 6 and SEQ ID NO: 7.

[0196] (2) Linearization of LentiCRISPRv2: LentiCRISPRv2 plasmid was digested with BsmBI (Esp3I) restriction endonuclease, and the following reaction system was used for reaction:

[0197] Table 8: LentiCRISPRv2 digestion system

[0198]

[0199] The prepared digestion system was centrifuged and reacted at 55°C for 2h on a PCR instrument. After the PCR was completed, the nucleic acid gel was run, and the linearized LentiCRISPRv2 fragment was recovered by gel recovery. The concentration of linearized LentiCRISPRv2 was detected using Nanodrop 2000.

[0200] (3) sgRNA phosphorylation and annealing: The synthesized oligonucleotide was dissolved into 100 μM using ddH2O, and the reaction system was configured according to the following table for phosphorylation (NEB, M0201) and annealing.

[0201] SEQ ID NO: 6 corresponds to primer sgIPO5-1-F: 5'-CACCCCTGCTCAGCCCCGACAATG-3'; sgIPO5-1-R: 5'-AAACCATTGTCGGGGCTGAGCAGG-3'.

[0202] SEQ ID NO: 7 corresponds to primer sgIPO5-2-F: 5'-CACCAAATACAACAGCTGCTGAAG-3'; sgIPO5-2-R: 5'-AAACCTTCAGCAGCTGTTGTATTT-3'.

[0203] Table 9: sgRNA phosphorylation system

[0204]

[0205] The prepared system was reacted at 37 °C for 30 min and at 95 °C for 5 min on a PCR instrument, and then reduced by 25 °C every 5 min to 4 °C.

[0206] (4) Ligation: Linearized LentiCRISPRv2 and annealed sgRNA were ligated using T4 DNA ligase (T4, 2011A), and the annealed sgRNA was diluted 200 times with ddH2O, and the reaction system was prepared according to the following table.

[0207] Table 10: sgRNA ligation system

[0208]

[0209] The prepared system was centrifuged and reacted at room temperature for 15 min.

[0210] (5) Transformation, plating, picking clones, and bacterial liquid PCR were the same as the steps described in "1. IPO5 overexpression plasmid construction" above. The primers for bacterial liquid PCR were U6-F (5'-TGGACTATCATATGCTTACCGTAAC-3') and sgIPO5-R (5'-TCAAGTTGATAACGGACTAGCC-3'), and if the PCR band was about 150 bp, it could be sent to the company for sequencing.

[0211] 9.2 Packaging lentivirus

[0212] (1) Preparation of cells: HEK293T cells in good growth condition were plated in a 10 cm dish, and when the cells grew to about 60%, transfection was performed.

[0213] (2) Transfection: Transfection reagent PEI was used to transfect LentiCRISPRv2-sgIPO5, pMD.2G, pRSV-REV and pMDlg / p-RRE plasmids in proportion. After 8 h of transfection, fresh DMEM complete medium was replaced.

[0214] (2) Virus sampling: After 48 h of transfection, the cell supernatant was collected in a 15 mL centrifuge tube, centrifuged at 2000 rpm and room temperature for 5 min to remove cell debris. The supernatant was filtered through a 45 μm filter membrane, and then frozen at -80 °C after aliquoting.

[0215] 9.3 Infection of lentivirus

[0216] (1) Preparation of cells: HeLa cells in good growth condition were plated in a 10 cm dish, and when the cells grew to about 70%, infection was performed.

[0217] (2) Infection: Before infection, replace the culture medium with 7 mL of DMEM complete medium containing 6 μg / mL Polybrene, and add 1 mL of packaged LentiCRISPRv2-sgIPO5 lentivirus liquid. At 10 h after infection, add 8 mL of DMEM complete medium, and at 24 h, replace it with fresh DMEM complete medium.

[0218] (3) Screening and verification: On the third day after infection, replace the culture medium with DMEM complete medium containing 4 μg / mL of puromycin, and screen for successfully infected cells. Continue to use this medium for culture until the cells no longer die, indicating that all uninfected cells have been eliminated. When the cells grow to a certain number, take a small amount for WB detection to verify the gene editing effect.

[0219] 10. RNA immunoprecipitation

[0220] (1) Collect cells: RIP experiment uses 10 cm dish cultured cells, wash the cells twice with 2 mL of pre-cooled PBS, add new 3 mL of PBS to scrape or blow the cells, collect into 15 mL centrifuge tube, centrifuge at 2000 g for 5 min at 4 ℃, discard the supernatant.

[0221] (2) Lysis of cells: Add RIPA weak lysis buffer 400 μL (containing 100 U RNase inhibitor), lyse on ice for 30 min, vortex every 5 min. 16000 g, 4 ℃ centrifuge for 10 min, transfer the supernatant to a new EP tube, take 40 μL for subsequent total protein detection.

[0222] (3) Antibody-protein binding: Add 5 μg of corresponding antibody to 360 μL of cell lysate, rotate at 4 ℃ overnight.

[0223] (4) Magnetic bead-antibody binding: The next day, add pre-washed 50 μL of Protein A / G magnetic beads, and incubate at 4 ℃ for 2 h. Place the EP tube in the magnetic stand, and wash with RIPA weak lysis buffer (containing RNase inhibitor) for 5 times. During the last wash, take 0.2 times the volume of the magnetic bead mixture for WB detection, and the rest of the magnetic beads are added to TRIzol reagent for RNA extraction.

[0224] 11. RNA pull-down

[0225] (1) Prepare probe: According to NC-biotin probe, miR-29b-biotin probe, centrifuge the probe dry powder at 10000 g at room temperature for 2 min, and dissolve it into 10 μM concentration with DEPC water.

[0226] (2) Pre-wash magnetic beads: vortex the magnetic beads, and take 25 μΐ of streptavidin magnetic beads (MCE, HY-K0208) in an EP tube for each sample. Place the EP tube on the magnetic stand, and discard the supernatant. Take the tube off the magnetic stand, and wash the magnetic beads with 1 mL of 0.1 M NaOH, 50 mM NaCl, and 100 mM NaCl, respectively. Finally, place the tube on the magnetic stand, and discard the supernatant. Add 100 μΐ of RNA Capture Buffer (Thermo Scientific, 20164) and reserve.

[0227] (3) Lysis of cells: the experimental cells were cultured in a 10 cm cell culture dish, and the cells were washed twice with 2 mL of pre-cooled PBS. The cells were scraped or blown down with 3 mL of fresh PBS, and collected in a 15 mL centrifuge tube. The tube was centrifuged at 2000 g for 5 min at 4 °C, and the supernatant was discarded. RIPA weak (containing protease inhibitors and PMSF) was added at 400 μΐ, and the cells were lysed on ice for 30 min. The tube was vortexed for 5 min. After lysis, the tube was centrifuged at 15000 g for 5 min at 4 °C, and the supernatant was transferred to a new EP tube. 100 U of RNase inhibitor was added to each tube, and 40 μΐ of the lysate of each sample was taken to a new EP tube for detection of total protein. The remaining lysate was placed on ice.

[0228] (4) Magnetic bead-RNA probe binding: the pre-washed magnetic beads were washed twice with 20 mM Tris (pH 7.5), and 100 μΐ of RNA Capture Buffer was added to disperse the magnetic beads. 50 pmol of biotin-RNA was added, and the mixture was rotated at room temperature for 30 min. At this time, the magnetic beads were combined with the biotin-RNA to form a complex.

[0229] (5) RNA probe-protein binding: the EP tube was placed on the magnetic stand, and the supernatant was discarded. The magnetic beads were washed twice with 20 mM Tris (pH 7.5) (without vortexing, using a yellow needle, cutting the front end with a clean pair of scissors, and expanding the suction port). After the supernatant was discarded, 1x protein RNA Binding Buffer was added. The system was prepared at 500 μΐ, 10x protein RNA Binding Buffer was 50 μΐ, 50 % Glycerol was 150 μΐ, and the cell lysate was 300 μΐ. The mixture was incubated overnight at 4 °C.

[0230] (6) The next day, place the EP tube in the magnetic stand and aspirate the supernatant, blow 200 μL of 1x Wash Buffer (do not vortex, use a yellow tip, cut the front end with a clean pair of scissors, and transfer to a new EP tube. Wash twice more with 200 μL of 1x Wash Buffer. Place the tube in the magnetic stand and aspirate the supernatant, add 35 μL of 1x protein loading buffer, and denature at 100°C for 10 min.

[0231] 12. RNA-protein binding development experiment

[0232] (1) Protein extraction: well-grown HEK293T cells were seeded in a 15 cm dish, and 15 μg of IPO5-Flag plasmid was transfected. The sample was collected 24 h after transfection, and 2 mL of RIPA weak lysis buffer was used to lyse on ice for 30 min, with vortexing every 5 min. After lysis, centrifuge at 15000 g for 30 min at 4°C. Transfer the supernatant to a new EP tube. Prepare 100 μL of Anti-Flag agarose beads, and cut the front end of the tip before aspirating the agarose beads to avoid damaging the agarose beads (Thermo Scientific, A36797). Wash the agarose beads twice with IP wash buffer (centrifuge at 2000 g for 1 min, discard the supernatant), and add the agarose beads to the lysis solution, and incubate at 4°C for 2 h. After incubation, wash the agarose beads with RIPA weak lysis buffer for 3 times.

[0233] (2) Displacement: dissolve Flag Peptide to 100 μg / mL in PBS. Add 200-500 μL of Flag Peptide (Sigma, F3290) solution to the magnetic beads, and incubate at 4°C for 2 h with gentle rotation. After incubation, centrifuge at 2000 g for 1 min, wash with PBS for 3 times, and collect the supernatant (i.e. the eluted Flag fusion protein). Use BCA to detect the protein concentration.

[0234] (3) RNA-streptavidin coated plate binding: dissolve RNA-biotin to 20 ng / μL in PBS (with RNAase inhibitor). Pre-wash the streptavidin coated plate (Thermo Scientific, 15501) with 200 μL of wash buffer (PBST with RNAase inhibitor) for 3 times, pat dry the residual wash buffer, and add 50 μL of RNA dilution to each well, and react at 4°C for 2 h.

[0235] (4) Protein-RNA binding: dilute the displaced protein with PBS to the desired concentration, wash the coated plate with 200 μL of wash buffer for 3 times, pat dry the residual wash buffer, and add the IPO5 protein and Flag Peptide gradient dilution to the well plate, and react at 4°C for 2 h.

[0236] (5) HRP conjugation: Discard the protein solution, wash 3 times with 200 μL of wash solution, pat dry the residual wash solution, add 100 μL of Flag-HRP antibody (1:100) to each well, and combine at room temperature for 1 h.

[0237] (6) Color development and reading: Discard the HRP solution, wash 3 times with 200 μL of wash solution, pat dry the residual wash solution, add 100 μL of TMB color developing solution to each well, and react for 15 min, add 100 μL of stop solution, and immediately read at 450 nm.

[0238] Example Two, miR-29b directly binds to IPO5

[0239] IPO5-Flag was overexpressed in HEK293T cells, and the cell lysate was enriched using Flag magnetic beads. RIP-qPCR experiments showed that IPO5-Flag was significantly enriched in miR-29b (A). In addition, IgG and IPO5 antibodies were directly combined in HeLa cell lysate using Protein A / G magnetic beads for enrichment, and it was found that IPO5 antibodies were also significantly enriched in miR-29b (B). At the same time, miR-29a was detected, and it was found that miR-29a was not significantly enriched (B). In HeLa cell lysate, biotinylated miR-29b or NC was used, and RNA pull-down experiments were performed, and it was observed that miR-29b could bind to IPO5 protein (C). Figure 1 Figure 1 Figure 1 Figure 1

[0240] Next, the IPO5 protein was purified in eukaryotic cells. First, IPO5-Flag was overexpressed in HEK293T cells, and IPO5-Flag was enriched using Flag magnetic beads. Thereafter, the IPO5-Flag protein bound to the magnetic beads was replaced using Flag peptide. IPO5-Flag and control protein were respectively gradient-bound to miR-29b-biotin streptavidin plates for binding detection. The results showed that IPO5-Flag could significantly bind to miR-29b in vitro (D). Figure 1

[0241] Example Three, miR-29b specifically inhibits nuclear replication virus HSV-1 replication

[0242] The present application transfected 10 nM miR-29b (SEQ ID NO: 1) in HeLa cells for 12 hours, and then infected HSV-1 and PR8, respectively. RT-qPCR results showed that, compared with the NC group, transfection of miR-29b significantly inhibited HSV-1 (​​​​​Figure 2 A), PR8 viral RNA ( Figure 2 B). Meanwhile, the viral titer in the cell culture medium showed (…). Figure 2 C), transfection with miR-29b significantly reduced HSV-1 viral particles in cell culture medium, while transfection with the same or higher concentrations (20 nM) of miR-29a did not inhibit HSV-1 infection. Figure 2 (D) This phenomenon indicates that miR-29b can specifically inhibit intranuclear viral replication. Next, two miRNAs, let-7a (SEQ ID NO:2) and miR-34a (SEQ ID NO:10), which have not been previously reported to participate in inhibiting HSV-1 viral replication, were randomly selected. Experiments verified that let-7a and miR-34a did not affect HSV-1 viral replication, while let-7a-6nt (SEQ ID NO:11) and miR-34a-6nt (SEQ ID NO:12) showed anti-HSV-1 viral replication effects. Figure 2 E).

[0243] Example 4: miR-29b inhibitors promote viral replication

[0244] HeLa cells were transfected with miR-29b Inhibitor (SEQ ID NO:5) for 12 h. The treated HeLa cells were then infected with HSV-1 and PR8, respectively. RT-qPCR results showed a significant difference compared to the NC group. Figure 3 A- Figure 3 B) Transfection with miR-29b inhibitors significantly increased the levels of HSV-1 and PR8 viral RNA, indicating that miR-29b inhibitors promote viral replication.

[0245] Example 5: IPO5 inhibits HSV-1 virus replication

[0246] In HeLa cells, overexpression of IPO5 promotes HSV-1 and PR8 infection. Figure 4 A- Figure 4 B), using siRNA to knock down IPO5 to inhibit the replication of HSV-1 and PR8 viruses ( Figure 4 C- Figure 4 (D) This phenomenon indicates that IPO5 promotes viral replication and suggests that the inhibitory effect of miR-29b on the virus may be exerted through IPO5 to inhibit the replication of HSV-1 virus.

[0247] Example 6: miR-29b inhibits the binding of IPO5 to the nuclear replication viral entry protein.

[0248] Example 1 demonstrated the direct binding of miR-29b to IPO5 using RIP-qPCR and RNA pull-down. This example also investigated the nuclear importer UL47 from HSV-1 and the nuclear importer PB1 from influenza virus, finding that miR-29b could inhibit the binding of IPO5 to UL47 and IPO5 to PB1. Figure 5 A- Figure 5 B). However, miR-29a does not prevent the binding of IPO5 and UL47 ( Figure 5 C).

[0249] Example 7: miR-29b requires IPO5 to suppress viral replication.

[0250] After overexpression of IPO5 for 24 h in HeLa cells, followed by treatment with a 5 nM miR-29b inhibitor, HSV-1 replication was further enhanced. Figure 6 A). After knocking down IPO5 with siRNA in HeLa cells, transfecting them with miR-29b and infecting them with HSV-1 showed that HSV-1 replication was inhibited. The LentiCRISPRv2-sgIPO5 plasmid was constructed, and LentiCRISPRv2 and LentiCRISPRv2-sgIPO5 plasmids were packaged into lentiviruses and used to infect HeLa cells, thus obtaining sgControl-HeLa and sgIPO5-HeLa cells with stable IPO5 knockout. In the IPO5 knockout HeLa cell line sgIPO5, after transfecting miR-29b (10 nM) for 12 h, HSV-1 (MOI=1) was infected for 6 h and 12 h. RT-qPCR was used to detect HSV-1 viral RNA (…). Figure 6 C). This result also indicates that miR-29b needs to suppress viral replication through IPO5.

[0251] Example 8: The miR-29b-6nt mutant loses its antiviral activity in vivo.

[0252] This invention constructed a miR-29b-6nt mutant mouse and verified the anti-nuclear replication virus ability of miR-29b-6nt at the in vitro mouse level. A mutant mouse with a 6nt nucleotide element mutation was constructed, producing miR-29b1. AGCGCU and miR-29b2 AGCGUU mir-29b1 2mut _b2 1mut Mice and the production of miR-29b1 / b2 AGCGUU mir-29b1 1mut _b2 1mutMouse. Subsequently, miR-29b-WT (SEQ ID NO:1) and miR-29b were validated in vitro. AGCGCU (SEQ ID NO:3) and miR-29b AGCGUU The antiviral activity of (SEQ ID NO:4) was demonstrated in HeLa cells transfected with miR-29b-WT and miR-29b. AGCGUU and miR-29b AGCGCU Post-infection with HSV-1, RT-qPCR results showed that the miR-29b mutant lost its inhibitory effect on HSV-1 replication. Figure 7 A). Next, differentiation from miR-29b-WT mice and mir-29b1 mice... 2mut _b2 1mut Rats and mir-29b1 1mut _b2 1mut Mouse iBMM cells were infected with HSV-1 or PR8, and RT-qPCR results showed mutant mouse iBMM (iBMM) cells. 29b12mut_b21mut and iBMM 29b11mut_b21mut HSV-1 replication was significantly enhanced in the group with mutant hexanucleotide element miR-29b compared to iBMM in WT cells. Figure 7 B) and PR8 Figure 7 The infection was exacerbated by D). Simultaneously, the HSV-1 viral titer in the culture medium of mutant mouse iBMM cells was significantly increased ( Figure 7 C).

[0253] Therefore, the hexanucleotide element contained in miR-29b plays an important role in inhibiting HSV-1 virus. Mutating the hexanucleotide element of miR-29b will cause miR-29b to lose its in vitro inhibitory effect on HSV-1 virus.

[0254] Example 9: miR-29b-6nt mutant mice lose their antiviral activity

[0255] In 8-week-old C57BL / 6J wild-type mice and mir-29b1 2mut _b2 1mut Rats and mir-29b1 1mut _b2 1mut Mice were injected intracranially with 1000 pfu of HSV-1 per mouse. ELISA was used to detect inflammatory factors in the blood at 12 h and 72 h. The results showed that in mice infected with HSV-1, mir-29b1... 2mut _b2 1mut Rats and mir-29b1 1mut _b2 1mut It significantly increased the level of IFN-β in the blood of mice. mir-29b12mut _b2 1mut Mouse and mir-29b1 1mut _b2 1mut Inflammatory factors IFN-β, CXCL10 levels and HSV-1 viral RNA levels in brain tissues of mice are also significantly increased compared with wild type ( Figure 8 A- Figure 8 E), and the HSV-1 viral RNA level is also significantly up-regulated compared with wild type ( Figure 8 F). In the HE staining of brain tissues infected with HSV-1, it is observed that the nuclear pyknosis in the hippocampal region of the two miR-29b-6nt mutant mice is significantly enhanced ( Figure 8 G) miR-29b1 1mut _b2 1mut , miR-29b1 2mut _b2 1mut Similar anti-viral effects in vivo on HSV-1, so miR-29b1 1mut _b2 1mut , miR-29b1 2mut _b2 1mut After mixing, randomly selected mice as miR-29b-mut group, the survival ability of miR-29b-mut group is significantly weakened ( Figure 8 H).

[0256] It is shown by in vivo experiments in mice that the introduction of a specific 6-nucleotide mutation in the miR-29b gene significantly destroys the anti-viral defense function mediated by miR-29b. The mutant mice show exacerbated inflammatory response, uncontrolled viral replication, aggravated neuropathological damage and severely impaired survival ability after intracranial infection of HSV-1.

[0257] The sequence used in the application:

[0258] SEQ ID NO: 1 (miR-29b-WT):

[0259] 5'-UAGCACCAUUUGAAAUCAGUGUU-3';

[0260] SEQ ID NO: 2 (let-7a):

[0261] 5'-CUAUACAAUCUACUGUCUUUC-3';

[0262] SEQ ID NO: 3 (miR-29b-2mut):

[0263] 5'-UAGCACCAUUUGAAAUCAG C G C U-3';

[0264] SEQ ID NO: 4 (miR-29b-1mut):

[0265] 5'-UAGCACCAUUUGAAAUCAG C GUU-3';

[0266] SEQ ID NO: 5 (miR-29b inhibitor):

[0267] 5'-AACACUGAUUUCAAAUGGUGCUA-3';

[0268] SEQ ID NO: 6 (sgIPO5-1):

[0269] 5'-CCTGCTCAGCCCCGACAATG-3';

[0270] SEQ ID NO: 7 (sgIPO5-2):

[0271] 5'-AAATACAACAGCTGCTGAAG-3';

[0272] SEQ ID NO: 8 (sgl-mir29bl&b2):

[0273] 5'-GAACACTGATTTCAAATGG-3';

[0274] SEQ ID NO: 9 (sg2-mir29bl&b2):

[0275] 5'-CACTGATTTCAAATGGTGCT-3';

[0276] SEQ ID NO: 10 (miR-34a):

[0277] 5'-CAAUCAGCAAGUAUACUGCCCU-3';

[0278] SEQ ID NO: 11 (let-7a-6nt):

[0279] 5'-CUAUACAAUCUACUGAGUGUU-3';

[0280] SEQ ID NO: 12 (miR-34a-6nt):

[0281] 5'-CAAUCAGCAAGUAUACAGUGUU-3'.

Claims

1. Use of a polynucleotide derived from miR-29b or a promoter thereof in the manufacture of a product for anti-nucleic replication virus, wherein, the polynucleotide comprises a nuclear localization element sequence AGUGUU consisting of six nucleotides, and the sequence is located at the 3' end of miR-29b; the anti-nucleic replication virus comprises reducing viral gene transcription level and / or reducing viral titer.

2. Use according to claim 1, wherein, the polynucleotide is selected from any one of the group consisting of (i)-(iii): (i) a polynucleotide comprising a sequence as set forth in SEQ ID NO: 1; (ii) a mutant of the polynucleotide comprising a sequence as set forth in SEQ ID NO: 1, the mutant comprising substitution, deletion, duplication or addition of 1-5 nucleotides at one or two positions of the sequence as set forth in SEQ ID NO: 1, and the mutant having anti-nucleic replication virus activity; (iii) a polynucleotide having at least 90%, alternatively at least 93%, preferably at least 95%, most preferably at least 99% sequence identity to the nucleotide sequence as set forth in (i) or (ii), and having anti-nucleic replication virus activity.

3. Use according to claim 1 or 2, wherein, the promoter is selected from a substance that increases the level of the polynucleotide, stabilizes the polynucleotide or promotes the function of the polynucleotide; alternatively, the promoter is selected from at least one of the following: an overexpression vector of the polynucleotide, an exogenously isolated and purified polynucleotide, an in vitro transcribed RNA of the polynucleotide and a cell overexpressing the polynucleotide.

4. The use according to any one of claims 1 to 3, wherein, the nucleic replication virus comprises herpes virus, adenovirus and influenza virus.

5. Use according to claim 4, wherein, the herpes virus comprises herpes simplex virus; alternatively, the herpes simplex virus comprises herpes simplex virus type I (HSV-1); the influenza virus comprises PR8.

6. The use according to any one of claims 1 to 5, wherein, the product comprises a drug and a pharmaceutical composition; alternatively, the pharmaceutical composition further comprises one or more drugs clinically anti-nucleic replication virus and / or one or more pharmaceutically acceptable carriers; alternatively, the pharmaceutically acceptable carrier comprises one or more than two combinations of the following: solvent, solubilizer, cosolvent, emulsifier, flavoring agent, odorant, colorant, binder, disintegrant, filler, lubricant, wetting agent, osmotic pressure regulator, pH regulator, stabilizer, surfactant and preservative.

7. Use according to claims 1-6, wherein, the anti-nucleic replication virus comprises: (a1) protecting the host from viral infection; (a2) enhancing the host's resistance to viral infection; (a3) reducing the damage to the host's tissues and organs caused by viral infection; alternatively, the anti-nucleic replication virus comprises reducing the level of viral RNA and / or the number of viral particles in the host; alternatively, the anti-nucleic replication virus comprises reducing cell damage caused by viral infection; alternatively, the cell damage comprises karyopyknosis.

8. Use according to claim 6 or 7, wherein, the host is an animal that can be infected by nucleic replication virus; alternatively, the host comprises mammal; alternatively, the mammal comprises mouse, rat, guinea pig, cow, sheep, cat, dog, horse, rabbit, pig, monkey and human.

9. Use of a polynucleotide derived from miR-29b in the manufacture of an inhibitor of IPO5, wherein, The polynucleotide comprises a nucleotide localization element sequence AGUGUU consisting of six nucleotides, and the sequence is located at the 3' end of the miR-29b.

10. Use according to claim 9, wherein, The polynucleotide is selected from any one of the group consisting of (i)-(iii): (i) a polynucleotide comprising the sequence as set forth in SEQ ID NO: 1; (ii) a mutant of the polynucleotide comprising the sequence as set forth in SEQ ID NO: 1, the mutant comprising a substitution, a deletion, a duplication, or an addition of 1-5 nucleotides at one or two positions of the sequence as set forth in SEQ ID NO: 1, and the mutant having an anti-intracellular replication virus activity; (iii) a polynucleotide having at least 90%, alternatively at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to the nucleotide sequence as set forth in (i) or (ii), and having an anti-intracellular replication virus activity.

Images