Method for rescuing novel measles recombinant coronavirus

Abstract

The invention provides a method for rescuing a novel measles recombinant coronavirus. The pGEM3Zf (+)-T7RNAP plasmid constructed by the invention can be subjected to in-vitro reverse transcription processing to obtain T7RNA polymerase mRNA (messenger Ribonucleic Acid). The method comprises the following steps: by taking an MRC-5 cell as a cell matrix, co-transfecting the MRC-5 cell by using a pT7-MVEZ-COV2S.B.1.617.2 plasmid constructed by the invention and a helper plasmid in a physical electric shock manner, and simultaneously transfecting T7RNA polymerase mRNA (messenger ribonucleic acid). T7RNA polymerase mRNA translates and expresses T7RNA polymerase in an MRC-5 cell, the T7RNA polymerase further drives a T7 promoter, transcription of a full-length plasmid containing all genetic information of the virus and expression of N, P and L genes are started, virus packaging and proliferation are completed in a host cell, and the paramyxovirus with infection activity is obtained.

Description

Technical Field

[0001] This invention belongs to the field of viral vector vaccines, specifically relating to a method for rescuing recombinant SARS-CoV-2 from measles. Background Technology

[0002] Pneumonia caused by SARS-CoV-2 infection has resulted in severe morbidity and mortality worldwide. Safe and effective vaccines are crucial for successfully combating COVID-19 infection, and several Covid-19 vaccines have been developed globally. However, the rapid emergence and spread of SARS-CoV-2 mutant strains may jeopardize vaccine effectiveness. Therefore, more effective vaccines are needed to meet global demand, making a universal vaccine development system capable of rapidly and scalably producing vaccines against various novel coronavirus mutant strains particularly important.

[0003] Assembling the structural proteins of a target virus into other viral vectors to obtain recombinant viruses and thus viral vector vaccines represents a new direction in viral vaccine development. Recombinant viral vaccines using measles virus as a vector have many advantages, such as: stimulating the body to produce neutralizing antibodies and cellular immune responses; ensuring sufficient immunogens within the body to continuously stimulate the production of antibodies and T cells, thereby prolonging the vaccine's protective effect; and effectively activating the body's innate immunity, inducing a balanced Th1 and Th2 immune response without adjuvants. Therefore, the measles virus vector itself is a safe and reliable attenuated vaccine strain, and its safety has been fully demonstrated.

[0004] Measles virus is a negative-sense RNA virus. Compared to positive-sense RNA viruses, the naked genome or RNA transcribed from cDNA of negative-sense RNA viruses is non-infectious. It needs to form a ribonucleoprotein complex with nucleocapsid proteins and RNA-dependent RNA polymerase to begin normal replication and assembly, thus rescuing the paramyxovirus. In establishing a paramyxovirus reverse genetics system, the full-length cDNA of the viral strain and the genes encoding proteins N, P, and L are typically cloned onto a plasmid controlled by the T7 promoter. The full-length plasmid and helper plasmids are co-transfected into host cells. The plasmid needs to be transcribed by T7 RNA polymerase to complete virus rescue. T7 RNA polymerase is usually provided by transfecting recombinant poxviruses that express T7 RNA polymerase or engineered cells that stably express T7 RNA polymerase.

[0005] However, in the process of transfecting cells with a vaccinia virus / T7 RNA polymerase system (VV / T7) and a recombinant plasmid containing a T7 promoter, VV / T7 first expresses T7 RNA polymerase within the cells, which then initiates transcription of the full-length cDNA of the viral strain and the helper plasmid, further leading to protein expression. If an infectious recombinant vaccinia virus expressing T7 RNA polymerase is introduced during the rescue of the target virus, subsequent isolation and purification techniques cannot completely remove the recombinant vaccinia virus, failing to meet GMP requirements for the clinical application of viral candidate vaccines. Therefore, the virus rescued using this method cannot be used for vaccine development and production. Furthermore, compared to rescued viruses, recombinant vaccinia viruses exhibit a relatively rapid cytopathic effect, causing infected cells to quickly develop CPE, shortening the rescue and amplification time of the target virus and affecting rescue efficiency. Engineered cells that sustainably express T7 RNA polymerase can rescue recombinant viruses without introducing recombinant vaccinia viruses, but their use is also subject to certain limitations. On the one hand, constructing and maintaining engineered cells that stably express T7 RNA polymerase presents certain challenges. On the other hand, the genomic sequences of the engineered cells obtained involve insertions into the original cell lines. To ensure the safety of vaccine clinical applications, the application of engineered cells in vaccine development and production requires validation, which is challenging. Therefore, for candidate vaccines requiring evaluation in human clinical trials, using viruses or engineered cells that express T7 RNA polymerase in the production of their viral strains complicates the entire process from development to clinical application, increasing the difficulty of approval.

[0006] Patent CN 116785422 A discloses a method for preparing a recombinant measles attenuated vaccine containing a novel coronavirus combined antigen. The method uses full-length cDNA of the viral strain, plasmids containing the N, P, and L genes of the measles virus, and a T7 polymerase expression plasmid to rescue the virus via liposome co-transfection. However, due to varying degrees of cell damage after multi-plasmid co-transfection and the cytotoxicity of liposome transfection, the process of plasmid entry into cells is slow, which affects the rate and efficiency of transient expression of T7 RNA polymerase, ultimately affecting the transfection efficiency. Therefore, it is necessary to provide a method with high transfection efficiency, thereby improving the effectiveness of rescuing recombinant measles SARS-CoV-2. Summary of the Invention

[0007] To address the above problems, this invention provides a reagent kit for virus rescue, comprising the following components:

[0008] 1) T7 RNA polymerase mRNA;

[0009] 2) Helper plasmid 1, which contains the T7 promoter and the measles N protein gene;

[0010] 2) Helper plasmid 2, which contains the T7 promoter and the measles P protein gene;

[0011] 3) Helper plasmid 3 contains the T7 promoter and the measles L protein gene;

[0012] The T7 RNA polymerase mRNA is an mRNA transcribed and capped from the T7RNAP gene;

[0013] The nucleotide sequence of the T7RNAP gene is shown in NCBI Reference Sequence:NC_001604.1.

[0014] Furthermore, the T7 RNA polymerase mRNA is an mRNA that is transcribed and capped using an RNA transcription synthesis kit after the expression vector containing the T7RNAP gene is linearized.

[0015] The expression vector is pGEM3Zf(+) plasmid; the RNA transcription synthesis kit includes the Cap1 CappingSystem kit; the linearization is performed using the SapI enzyme.

[0016] And / or: the helper plasmid 1 is a pT7-IRES-MVN plasmid; the pT7-IRES-MVN plasmid is a pT7-IRES His-C DNA plasmid linked with the measles N protein gene;

[0017] And / or: the helper plasmid 2 is a pT7-IRES-MVP plasmid; the pT7-IRES-MVP plasmid is a pT7-IRES His-C DNA plasmid linked with the measles P protein gene;

[0018] And / or: the helper plasmid 3 is a pT7-IRES-MVL plasmid; the pT7-IRES-MVL plasmid is a pT7-IRES His-C DNA plasmid linked with the measles L protein gene.

[0019] Furthermore, it also contains viral vectors; said viral vectors include measles virus vectors and recombinant measles virus vectors.

[0020] Furthermore, the nucleotide sequence of the recombinant measles virus vector is shown in SEQ ID NO.2-3.

[0021] The present invention also provides the use of the aforementioned kit in rescuing viruses and / or recombinant viruses.

[0022] Furthermore, the recombinant virus includes measles recombinant SARS-CoV-2; the measles recombinant SARS-CoV-2 contains a gene fragment with a nucleotide sequence as shown in SEQ ID NO.1; the gene fragment encodes the SARS-CoV-2 S protein.

[0023] This invention also provides a method for rescuing recombinant measles SARS-CoV-2, which uses the aforementioned kit for rescue, and the steps are as follows:

[0024] 1) Obtain MRC-5 cells and use Opti-MEM. TM Suspend the sample, then add the components from the aforementioned kit and mix. Place the mixture in a Bio-Rad electroporation cuvette for electroporation.

[0025] 2) Take the cells after electrotransfection in step 1), add MEM medium containing bovine serum for culture, take the supernatant of the culture medium and mix it with Vero cells. When the Vero cells are 80-90% cytopathic, freeze and thaw, take the culture medium, centrifuge, and collect the supernatant to obtain the cell.

[0026] Further, in step 1), the MRC-5 cells are 2–7 × 10⁻⁶ per cell. 5～7 Each MRC-5 cell line contains 10–15 μg of recombinant measles virus vector, 6–10 μg of pT7-IRES-MVN plasmid, 2–6 μg of pT7-IRES-MVP plasmid, 0.5–1.5 μg of pT7-IRES-MVL plasmid, and 8–12 μg of T7 RNA polymerase mRNA. Preferably, the mRNA is added to every 5 × 10⁶ MRC-5 cells. 6 Each sample contains 12 μg of recombinant measles virus vector, 8 μg of pT7-IRES-MVN plasmid, 4 μg of pT7-IRES-MVP plasmid, 1 μg of pT7-IRES-MVL plasmid, and 10 μg of T7 RNA polymerase mRNA.

[0027] And / or: The conditions for electrotransferring in step 1) are exponential wave, voltage 180V, capacitance 950μF, and number of times 1;

[0028] And / or: The volume ratio of the MEM medium containing bovine serum to MRC-5 cells in step 2) is 10 mL: 2–7 × 10⁻⁶ cells. 5～7 Preferred 10mL: 5×10 6 ;

[0029] The concentration of bovine serum in the MEM medium containing bovine serum is 10%.

[0030] The culture conditions are: temperature 35-38℃, CO2 concentration 3-7%, time 5-10 days, preferably: temperature 37℃, CO2 concentration 5%, time 7 days;

[0031] The Vero cells are Vero cells with a cell confluence of 80-90%, preferably Vero cells with a cell confluence of 90%.

[0032] The present invention also provides a recombinant measles SARS-CoV-2 virus, which is an infectious paramyxovirus rescued according to the aforementioned method.

[0033] Finally, this invention provides the use of the aforementioned recombinant measles SARS-CoV-2 virus in the preparation of medicaments for the prevention and / or treatment of COVID-19, the medicaments including vaccines; the vaccines are prepared using recombinant measles SARS-CoV-2 virus as an antigen, plus pharmaceutically acceptable adjuvants.

[0034] The “capping” described in this invention refers to adding a special cap structure to the 5' end of mRNA. The specific process includes the following three steps: 1) Removal of 5' phosphate: RNA triphosphatase removes a phosphate group from the 5' end of the precursor mRNA, producing a 5'-diphosphate nucleotide;

[0035] 2) Addition of guanylic acid: Guanylate transferase catalyzes the addition of a guanylic acid (GMP) molecule to the 5' end of RNA in the form of a 5'-5' phosphodiester bond, forming a temporary "cap" structure;

[0036] 3) Methylation modification: Methyltransferases further methylate this temporary cap structure by adding methyl groups at the N7 position of the guanosine nucleotide and the 2'-O position of the ribose attached thereto, forming the final cap structure.

[0037] The pGEM3Zf(+)-T7RNAP plasmid constructed in this invention can be processed in vitro via reverse transcription to obtain T7 RNA polymerase mRNA. Using MRC-5 cells as the cell matrix, the pT7-MVEZ-COV2S.B.1.617.2 plasmid constructed in this invention, along with a helper plasmid, was co-transfected into MRC-5 cells via physical electroporation, simultaneously transfecting T7 RNA polymerase mRNA. The T7 RNA polymerase mRNA is translated and expressed in MRC-5 cells, which further drives the T7 promoter, initiating the transcription of the full-length plasmid containing all viral genetic information and the expression of the N, P, and L genes. This completes viral packaging and proliferation in the host cell, yielding an infectious paramyxovirus. The collected paramyxovirus can be used as a candidate strain for a COVID-19 vaccine.

[0038] This invention utilizes the pGEM3Zf(+)-T7RNAP plasmid to transduce T7 RNA polymerase mRNA in vitro, enabling the reverse genetics system for rescuing recombinant measles SARS-CoV-2 to express sufficient amounts of T7 RNA polymerase. This solves the problem that current methods for rescuing recombinant measles SARS-CoV-2 require transfection with recombinant poxviruses that express T7 RNA polymerase or engineered cells that stably express T7 RNA polymerase to provide the T7 RNA polymerase, making vaccine preparation using recombinant measles SARS-CoV-2 as a raw material difficult. It also solves the problem of low transfection efficiency in rescuing recombinant measles SARS-CoV-2 by transfecting T7 polymerase expression plasmids, resulting in low efficacy in rescuing recombinant measles SARS-CoV-2. This invention has practical application value.

[0039] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0040] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0041] Figure 1 Simplified diagram of pGEM3Zf(+)-T7RNAP plasmid construction

[0042] Figure 2 .pGEM3Zf(+)-T7RNAP restriction enzyme digestion verification (1, 2, 3: pGEM3Zf(+)-T7RNAP digested with NcoI and SacI; 4: pGEM3Zf(+)-T7RNAP plasmid)

[0043] Figure 3 pGEM3Zf(+)-T7RNAP was linearized by single digestion with SapI enzyme (1: pGEM3Zf(+)-T7RNAP plasmid; 2: pGEM3Zf(+)-T7RNAP plasmid digested with single digestion with SapI enzyme).

[0044] Figure 4 In vitro transcription synthesis of T7 RNA polymerase mRNA and capped mRNA gel electrophoresis (1: T7 RNA polymerase capped mRNA; 2: T7 RNA polymerase mRNA)

[0045] Figure 5 Electroporation of 5 μg pT7-RFP + 10 μg T7 RNA polymerase into mRNA in MRC-5 cells cultured for 24 h was observed for fluorescence (20X).

[0046] Figure 6 Fluorescence expression of cells cultured for 24 hours after electroporation in different experimental groups;

[0047] Figure 7 White light and fluorescence images of MVS191-GFP obtained by electroporation of MRC-5 cells;

[0048] Figure 8 White light and fluorescence images (20X) of Vero cells infected with MVS191-GFP obtained from MRC-5 cell rescue.

[0049] Figure 9 Simplified diagram of pT7-MVEZ-COV2S.B.1.617.2 plasmid construction;

[0050] Figure 10 plasmid digestion verification of pT7-MVEZ-COV2S.B.1.617.2 (1: MluI digestion band; 2: NcoI digestion band; 3: NdeI digestion band)

[0051] Figure 11 MVez-CoV2S.B.1.617.2 infects Vero cells to form syncytia;

[0052] Figure 12 MVez-CoV2S.B.1.617.2 monoclonal B genetically stable passaged virus P1-P10 infectivity titers;

[0053] Figure 13 MVez-CoV2S.B.1.617.2 monoclonal B genetic stability study: key passage antigen expression (WB) (1-5 are WB bands of virus concentrates from passages P1, P3, P5, P7, and P10, respectively) Detailed Implementation

[0054] The equipment and reagents used in the specific embodiments of this invention were all purchased commercially. The specific biological reagents used are as follows:

[0055] (I) Cells and Plasmids

[0056] MRC-5 cells and Vero cells (ATCC): preserved by Chengdu Institute of Biological Products Co., Ltd.

[0057] Plasmid pT7-IRES-T7RNAP: obtained by inserting the T7 RNA polymerase (T7RNAP) gene into the multiple cloning site using Takara pT7-IRES His-C DNA as a vector, and carrying the T7 promoter and T7 RNA polymerase sequence;

[0058] pT7-IRES His-C DNA plasmid (Takara): Contains a T7 promoter, IRES sequence, and His-C tag;

[0059] pGEM3Zf(+) plasmid (Nanjing GenScript): contains 5UTR\3UTR\polyA sequences.

[0060] pUC-GW-Amp plasmid (Ampicillin): Provided by Nanjing Genscript Biotech Co., Ltd.

[0061] pT7-IRES-MVN plasmid: obtained by inserting the measles N protein (MVN) gene into the multiple cloning site using Takara pT7-IRES His-C DNA as a vector, carrying the T7 promoter and the measles N protein coding sequence is the CDS sequence of gene="N" in GenBank:FJ211590.1;

[0062] pT7-IRES-MVP plasmid: obtained by inserting the measles P protein (MVP) gene into the multiple cloning site using Takara pT7-IRES His-C DNA as a vector, carrying the T7 promoter and the CDS sequence of gene="P" in GenBank:FJ211590.1;

[0063] pT7-IRES-MVL plasmid: obtained by inserting the measles L protein (MVL) gene into the multiple cloning site using Takara pT7-IRES His-C DNA as a vector, carrying the T7 promoter and the measles L protein coding sequence is the CDS sequence of gene="L" in GenBank:FJ211590.1;

[0064] (II) Main Reagents

[0065] The high-purity viral RNA extraction kit was purchased from Roche. High-fidelity DNA polymerase T4 DNA ligase and restriction endonucleases were purchased from NEB; random primers and Superscript III reverse transcriptase were purchased from Invitrogen; pGEM-T vector ligation kit and gel extraction kit were purchased from Promega; plasmid extraction kit was purchased from Omega; agarose and DNA marker were purchased from Takara; MEM and FBS culture medium were purchased from Gibco; and other reagents were domestically produced.

[0066] Example 1: Establishment of a paramyxovirus-recombinant measles virus MV-GFP rescue system

[0067] 1. T7 RNA polymerase mRNA obtained by in vitro transcription of pGEM3Zf(+)-T7RNAP plasmid and its functional verification

[0068] 1.1 Construction of pGEM3Zf(+)-T7RNAP plasmid

[0069] Constructing pGEM3Zf(+)-T7RNAP for reverse transcription to obtain mRNA: Using plasmid pT7-IRES-T7RNAP as a template, T7RNAP sequences were amplified using primers T7RNAP-NCOI-F:ATATGGCCACAACCATGGCTAACACGA and T7RNAP-SACI-R:GAGCTCATTACGCGAACG. The T7RNAP amplification products were recovered. The T7RNAP amplification products were inserted into the pGEM3Zf(+) plasmid through NcoI and SacI restriction sites. Restriction digestion with NcoI-HF and SacI was performed for identification; the identification results were consistent with the theoretical restriction band size. The plasmid was sequenced, and the sequence was consistent with the theoretical sequence. Figures 1-2 )

[0070] The T7 RNAP gene sequence information can be found in NCBI Reference Sequence:NC_001604.1

[0071] 1.2. In vitro transcription to synthesize T7 RNA polymerase mRNA and mRNA capping

[0072] The pGEM-3Zf(+)-T7RNAP plasmid has a SapI restriction enzyme site at its posterior end, which is adjacent to poly(A). After single enzyme digestion, a DNA template ending with poly(A) will be formed, which is beneficial for subsequent mRNA synthesis and translation expression.

[0073] 10 μg pGEM3Zf(+)-T7RNAP plasmid was linearized with SapI enzyme and detected by electrophoresis: digestion was performed at 37℃, with a digestion ratio of 1 μg plasmid to 3 U restriction enzyme, and the digestion time was 3 hours. Single enzyme digestion results were detected by 1% agarose gel electrophoresis. Figure 3 .

[0074] Linear plasmid recovery: Add 1 / 10 of 3M sodium acetate and 2 volumes of ethanol to precipitate the DNA. Wash twice with 70% ethanol and evaporate the ethanol for 15-30 minutes. Dissolve in nuclease-free water and determine the concentration.

[0075] In vitro transcription and recovery of mRNA from linear DNA template: mRNA was synthesized in vitro according to the instructions of the T7 high-yield RNA transcription kit (nearshore protein).

[0076] 20 μl reaction system: 1 μg DNA synthesizes approximately 100 μg mRNA

[0077] RNA was precipitated with 7.5M lithium chloride, with a final lithium chloride concentration of 2.5M. Note the effect of the order of sample addition on precipitation formation; 7.5M lithium chloride should be added first, followed by nuclease-free water to bring the final lithium chloride concentration to 2.5M. The precipitate was washed twice with pre-cooled 70% ethanol, evaporated for 10 minutes, and then reconstituted with nuclease-free water.

[0078] mRNA capping: Add reagents to a 2×100 μl system according to the Cap1 Capping System kit (nearshore proteins) instructions, and incubate at 37°C for 30 min. See attached image for capped mRNA gel electrophoresis results. Figure 4 .

[0079] 1.3 Functional verification of T7 RNA polymerase mRNA obtained from in vitro transcription

[0080] MRC-5 cells required for electroporation were passaged into T225 flasks at a ratio of 1:2 and cultured at 37°C with 5% CO2 for 24-48 hours until the cells reached over 70% confluence or a thin monolayer. After passage, the MRC-5 cells were trypsinized, and 6-8 ml of culture medium was used to elute the cells. 20 μl of the eluent was pipetted for cell counting. After cell counting, the required cell volume was calculated based on 1 × 10⁶ cells, and the calculated volume was added to a 1.5 ml autoclaved EP tube. The cells in the EP tube were centrifuged at 2000 g for 5 min at room temperature to remove the culture medium.

[0081] The cells were thoroughly and gently suspended in 110 μl of opti-MEM. Then, 5 μg of the required plasmid pT7-RFP and 10 μg of T7 RNA polymerase mRNA were added sequentially and gently mixed.

[0082] Cells, plasmids, and mRNA were mixed and transferred into 4 mm diameter Bio-rad electroporation cuvettes. The Bio-rad multifunctional electroporator was set to 4 mm diameter cuvettes, 140 V, and 950 μF. After one electroporation, the electroporated cells were transferred to T25 cell culture flasks, and 10 ml of MEM medium containing 10% NBS was added. The cells were cultured at 37°C and 5% CO2 for 24 h. The expression of RFP (red fluorescent protein) was observed under a fluorescence microscope. Results are shown below. Figure 5 .

[0083] Figure 5 Experimental results showed that after co-transfecting MRC-5 cells with the in vitro transcribed T7 RNA polymerase mRNA and pT7-RFP, normal T7 RNA polymerase could be expressed. The T7 RNA polymerase could further initiate the expression of red fluorescent protein RFP located under the T7 promoter in the pT7-RFP plasmid.

[0084] 2. Exploration of electroporation conditions during the establishment of the paramyxovirus electroporation rescue system

[0085] Cells: Vero and MRC-5

[0086] Electro-rotor cups: Bio-rad (4mm) and BTX (2mm)

[0087] Buffer: This system directly suspends cells in Opti-MEM for electroporation, without the need for a special electroporation buffer.

[0088] Plasmid: pT7-RFP with T7 promoter (can be recognized by T7 RNA polymerase in eukaryotic cells and express red fluorescent protein, which facilitates the evaluation of electroporation efficiency by observing the expression level of fluorescent protein in the later stage);

[0089] T7 RNA polymerase: Provided by translation after T7 RNA polymerase mRNA is electroporated into MRC-5 cells.

[0090] Cells, plasmids, and T7 RNA polymerase mRNA obtained from in vitro transcription were mixed and transferred into a 4 mm diameter electroporation cuvette. Electroporation conditions were set on the multifunctional electroporator (as shown in Tables 1 and 2) before electroporation. After electroporation, white foam appeared at the top of the cuvette, mostly cell debris or dead cells.

[0091] After electroporation, cells were transferred to culture flasks and incubated at 37°C in a 5% CO2 incubator for approximately 4 hours. Cell viability was then observed under a microscope. Live cells were characterized by good adhesion, clear outlines, normal extension, and good translucency, while dead cells were characterized by rounded shape, poor translucency, and floating in the culture medium. After 24 hours of electroporation, the medium was changed to 5 ml of MEM or DMEM low-glucose medium (containing 10% NBS) and cultured further. Once a thin monolayer was formed, the expression of red fluorescent protein was observed. Cell viability and fluorescence expression under various conditions were roughly statistically analyzed using cells in a single field of view. The results are shown in Table 1. Figure 6 As shown.

[0092]

[0093] The results above show that cell survival rate after electroporation is closely related to the electroporation voltage; the lower the voltage, the higher the cell survival rate. For electroporation using MRC-5 cells, the optimal electroporation conditions in a 4mm electroporation cup are 180V and 950μF. For electroporation using Vero cells, the optimal conditions in a 4mm electroporation cup are 220V and 950μF. However, the overall survival rate and electroporation efficiency of Vero cells are worse than those of MRC-5 cells. In the later stage, MRC-5 cells were used for recombinant virus rescue.

[0094] 3. Electroporation of whole plasmids in MRC-5 cells to rescue recombinant measles virus MV-GFP

[0095] The plasmids used are pT7-MVS191N, pT7-MVS191P, and pT7-MVS191L. The construction of pT7-MVS191-GFP can be found in Example 1 of patent CN201710001203 - A system and method for rescuing measles virus and recombinant measles virus.

[0096] mRNA used: T7 RNA polymerase mRNA obtained through in vitro transcription

[0097] Experiments were conducted according to the optimal electroporation conditions determined through trial and error. The specific amounts of plasmids used for electroporation are shown in Table 2. Table 2 lists the amounts of multiple plasmids and T7 RNAP (mRNA) 10 μg and 5 × 10⁻⁶ mRNA, respectively. 6 After suspending and mixing MRC-5 cells in 200 μl of Opti-MEM medium, they were transferred to a 4 mm Bio-rad. The optimal electroporation conditions were set as follows: 180 V, 950 uF, one click per cell. After co-transfection of MRC-5 cells, if the experiment is successful, the resulting recombinant measles virus MV-GFP can express green fluorescent protein, which is convenient for later observation under a microscope.

[0098] After electroporation, the cells were transferred to a T25 flask and cultured in a 37°C, 5% CO2 incubator. After 24 hours of culture, the medium was changed to 10 ml MEM (containing 10% NBS). On the 5th day, it was observed whether MV-GFP expressing green fluorescent protein was rescued.

[0099] Table 2 Recombinant Measles Virus MV S191 The amount of GFP plasmid used is as follows:

[0100] plasmid Dosage (μg) Concentration (μg / ul) Volume (μl) <![CDATA[pT7-N S191 ]]> 8 3 2.7 <![CDATA[pT7-P S191 ]]> 4 1.7 2.5 <![CDATA[pT7-L S191 ]]> 1 1.05 1 <![CDATA[pT7-MV S191 -GFP]]> 12 4 3

[0101] Table 2 shows that after co-transfection of MRC-5 cells with multiple plasmids and 10 μg of T7 RNAP (mRNA), T7 RNAP (mRNA) can initiate the expression of T7 RNA polymerase in MRC-5 cells. The expressed T7 RNA polymerase can then initiate the T7 promoters of other plasmids, subsequently expressing N, P, L, and other proteins. When plasmids containing full-length viral cDNA are co-transfected, the RNA transcribed under the T7 promoter forms a ribonucleoprotein complex with these proteins, initiating normal replication and assembly, thus successfully rescuing recombinant measles virus MVS191-GFP. Figure 7 ).

[0102] MVS191-GFP culture medium obtained from electroporation of MRC-5 cells was transferred to Vero cells for expanded culture. Infection of Vero cells with MVS191-GFP induced cytopathic effects. Figure 8 ).

[0103] Therefore, successful expression of T7 RNA polymerase is a key factor in the successful rescue. 10 μg of T7RNAP (mRNA) can express sufficient T7 RNA polymerase, which further initiates the transcription and expression of genes carried by the T7 promoter.

[0104] Example 2: Reverse genetics of the recombinant novel coronavirus variant vaccine MVEZ-COV2S.B.1.617.2 using measles virus Edmonston-Zagreb strain as a vector.

[0105] 1. Construction of recombinant measles-SARS-CoV-2 vector

[0106] 1.1 Optimization and Acquisition of Exogenous Gene COV2S.B.1.617.2

[0107] Based on literature reports, the amino acid sequence with mutation sites T19R, G142D, 157-158 deletion, L452R, T478K, D614G, P681R, and D950N was selected as the basic amino acid sequence of SARS-CoV-2 S.B.617.2. The sequence encoding the basic amino acids of SARS-CoV-2 S.B.617.2 was optimized (for Homo sapiens (Human)) and sent to Genewiz for routine synthesis of the gene S.617.2 (contract number: 80-690562719). 5'UTR (BsiWI; BspEI) and 3'UTR (MluI; BssHII) were added, and the gene was cloned into the vector pUC-GW-Amp (Ampicillin) to construct the plasmid pUC-GW-Amp-S.617.2 for subsequent enzyme digestion to provide the COV2S.B.1.617.2 gene fragment.

[0108] The sequence of the synthetic gene S.617.2 is shown in SEQ ID NO.1:

[0109]

[0110]

[0111]

[0112] 1.2 Modification of pT7-IRES His-C DNA vector

[0113] Using the pT7-IRES His-C DNA vector as a template, and pT7-IRES-NotI and pT7-IRES-NheI as upstream and downstream primers, PCR amplification was performed to remove the EMCV-IRES sequence and SacII restriction site from the pT7-IRES His-C DNA vector. The multiple cloning site (MCS) sequence of the NheI-AscI-SacII-XmaI-PacI-EcoRI-KpnI-BsrGI-NotI restriction endonuclease was synthesized. The MCS sequence was ligated to the vector PCR amplification product via the NheI and NotI restriction sites. After transformation, colonies were picked for amplification culture, plasmids were extracted, and appropriate restriction endonucleases were selected for plasmid identification. The modified vector was named pT7-MCS, and the BSSHII restriction site in the multiple cloning site region was removed again by point mutation to construct the PT7-MCS vector.

[0114] 1.3 Construction of measles virus vector pT7-MVEZ

[0115] Using the PT7-MCS vector, the 5' end of the measles Edmonston-Zagreb reverse genome was introduced into the T7 promoter and hammerhead nuclease sequence (HamRz), the 3' end into the T7 terminator and hepatitis D virus ribozyme sequence (HdvRz), and an additional transcription unit (ATU) was introduced between the P and M genes. These sequences were divided into seven fragments (F1-F7), which were then synthesized and assembled by Nanjing GenScript Biotech Co., Ltd., to construct the plasmid pT7-MVEZ, which was returned as a dry powder.

[0116] A simplified diagram of the construction of plasmid pT7-MVEZ is shown below. Figure 9 As shown.

[0117] 1.4 Insertion of foreign genes

[0118] The exogenous gene COV2S.B.1.617.2 was excised from pUC-GW-Amp-S.617.2 using BsiWI and BssHII restriction endonucleases, and ligated between the ATU sequences of the pT7-MVEZ plasmid. JM109 competent cells were transformed, and single clones were selected for plasmid size analysis using 1% agarose gel electrophoresis. The recombinant measles virus vector pT7-MVEZ-COV2S.B.1.617.2, containing the COV2S.B.1.617.2-related antigenic epitope genes, was constructed. The plasmid map is shown below. Figure 10 As shown, the nucleotide sequence is as follows:

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131] Note: The serial number of the area marked by the underline "____" is SEQ ID NO.2, and the serial number of the unmarked area is SEQ ID NO.3.

[0132] The plasmid pT7-MVEZ-CoV2S.B.1.617.2 was identified by digestion with the restriction endonucleases MluI, NcoI, and NdeI. Theoretically, MluI digestion yielded two bands of 18930 bp and 3831 bp; NcoI digestion yielded three bands of 16210 bp, 6059 bp, and 462 bp; and NdeI digestion yielded four bands of 17246 bp, 2681 bp, 1898 bp, and 936 bp. The identification results are as follows: Figure 10 As shown, the enzyme digestion pattern is consistent with the theoretical fragment of the target sequence.

[0133] 2. Virus rescue

[0134] 5×10 6 Personal diploid MRC-5 cells were thoroughly resuspended in Opti-MEM. 12 μg of recombinant measles virus vector pT7-MVEZ-CoV2S.B.1.617.2, 8 μg of pT7-IRES-MVN plasmid, 4 μg of pT7-IRES-MVP, and 1 μg of pT7-IRES-MVL helper plasmids were added, along with 10 μg of in vitro transcribed T7 RNA polymerase mRNA. The virus was then rescued according to the following steps:

[0135] 1) The mixture is transferred into a Bio-Rad electric rotary cup with a diameter of 4 mm and subjected to an exponential wave, 180 V, 950 μ F electric shock once.

[0136] 2) After electroporation, transfer the cells to a T25 flask, add 10 mL of 10% NBS / MEM, and incubate at 37°C for 24 h under 5% CO2 conditions. Then change the medium and continue culturing.

[0137] 3) After electroporating MRC-5 cells and culturing them for another 7 days, the supernatant was transferred to Vero cells that had reached approximately 90% confluence, and the cytopathic effect was observed. Cytopathic effects were observed when the cell confluence reached approximately 80-90%.

[0138] 4) Repeat the freeze-thaw cycle 3 times with the Vero cells and supernatant mixture to harvest the supernatant of recombinant virus MVEZ-CoV2S.B.1.617.2 after freeze-thaw.

[0139] 3. RT-PCR and gene sequencing of viral exogenous genes

[0140] Take the viral culture medium and centrifuge at 1500g for 2 min at 4℃. Collect the supernatant and extract the genomic RNA of the recombinant virus according to the instructions of the Roche high-purity viral RNA extraction kit. Reverse transcribe the genomic RNA into cDNA using random primers. Using this cDNA as a template, amplify the exogenous gene fragment using Phusion high-fidelity DNA polymerase and the 5 primer pairs in Table 3. PCR results detected by 1% agarose gel electrophoresis showed that the amplified target band was present and the fragment size was correct. The PCR product was sent to Genewiz for sequencing, and the gene sequencing results were consistent with the target sequence of CoV2S.B.1.617.2.

[0141] Table 3.MV EZ -CoV2S.B.1.617.2 exogenous gene fragment sequencing primers

[0142]

[0143] Example 3: Monoclonal screening and stability study of recombinant virus MVEZ-CoV2S.B.1.617.2

[0144] 1. MV EZ -CoV2S.B.1.617.2 Monoclonal Screening

[0145] Cell matrix: Vero, cells were packed at 3 × 10⁻⁶ 5 1 cell / well is seeded into a 6-well plate.

[0146] Virus: The original strain MVez-CoV2S.B.1.617.2 harvested in Example 2.

[0147] The virus fluid was subjected to 10 -1 —10 -5Serial dilutions were performed, with each dilution seeded at 100 μl / well into a six-well plate of Vero cells. After incubation overnight at 33°C with 5% CO2, the supernatant was aspirated. A 1:1 volume mixture of low-melting-point agarose gel and 2× medium was added to the six-well plate at 2 ml / well, and the plates were incubated until syncytial formation was observed. Figure 11 ).

[0148] Circle the syncytium at the bottom of the culture dish, scrape the marked area with the tip of a 200 μl pipette and aspirate 60 μl of the gel mixture in parallel to obtain a monoclonal strain.

[0149] The 60 μl gel mixture was transferred to the prepared MRC-5 cells and cultured. Six monoclonal strains of AF were picked and cultured, which were defined as P0 generation virus.

[0150] RNA was extracted from six monoclonal strains of AF P0 generation virus, cDNA was synthesized, and PCR was performed for sequencing. Among them, the CoV2S.B.1.617.2 sequence of monoclonal B was consistent with the theoretical sequence. The MVez-CoV2S.B.1.617.2 monoclonal B strain was used as the strain for genetic stability studies.

[0151] 2. Continuous passage culture of the virus

[0152] The total viral load of MVez-CoV2S.B.1.617.2 monoclonal B in the P0 generation was relatively low. When passing it down to the P1 generation, it was inoculated at 300 μl / T25 flask of cells, and 2 × T25 flasks were inoculated.

[0153] Cells inoculated with the virus were cultured at 33°C and 5% CO2 for 7 days.

[0154] After cultivation, the virus was collected and subjected to three freeze-thaw cycles at -80°C to obtain the P1 generation virus.

[0155] The P1 generation virus was seeded into 2 × 2 T75 flasks at a rate of 2 ml / T75 flask (MRC-5). The above culture conditions and virus harvesting process were repeated to obtain the P2 generation virus.

[0156] Afterwards, the virus inoculation volume was fixed at 2 ml / T75 flask of cells, and the virus MVez-CoV2S.B.1.617.2 monoclonal B was passaged to P3-P10 generations according to the above method.

[0157] Each generation of virus is stored at -70°C.

[0158] 3. Virus titer determination

[0159] Cell matrix: Vero, with cell concentration adjusted to 1×10⁶ cells using 2% NBS / MEM medium. 5100 μl per well was seeded into a 96-well plate at a rate of cells / ml.

[0160] Sample: P1-P10 generation virus of MVez-CoV2S.B.1.617.2 monoclonal B

[0161] Sample dilution: The P1-P10 generation of MVez-CoV2S.B.1.617.2 monoclonal B virus amplified on MRC-5 cells was serially diluted 10-fold to 10^-6 using 2% NBS / MEM medium. Dilutes from -1 to -6 were inoculated, with 8 replicates per well. 100 μl was inoculated per well.

[0162] Culture conditions: After incubating the 96-well plate in a 37℃, 5% CO2 incubator for 7 days, the results were evaluated as follows: Figure 12 .

[0163] 4. Western blot detection of S protein expression

[0164] Western blot analysis was performed on P1, P3, P5, P7, and P10 generations of MVez-CoV2S.B.1.617.2 monoclonal B virus to observe the expression of the S protein.

[0165] Sample preparation: Centrifuge 1 ml of virus harvested fluid through an ultrafiltration tube at 12000 g. Concentrate to approximately 60-80 μL. If less than 80 μL, add to a final volume of 80 μL. Add 40 μL of concentrated virus sample to reducing and non-reducing 5*SDS loading buffer, respectively, and incubate at 95°C for 5 min. Immediately centrifuge on ice for 1 min.

[0166] SDS-PAGE electrophoresis: Pour electrophoresis buffer into the inner electrophoresis tank, submerging all wells, and remove the sample comb. Load 20 μL / well of sample into each well according to the order of loading, and 10 μL / well of protein rainbow marker. Pour electrophoresis buffer into the outer electrophoresis tank, according to the label on the outer tank. Replace the electrophoresis tank cover. Electrophoresis at 200V for 45 minutes. Observe that all indicator bands have emerged from the electrophoresis gel. Stop electrophoresis. Remove the electrophoresis gel and proceed to the next step of membrane transfer.

[0167] Transfer: Immerse the PVDF membrane in methanol for 5-10 seconds. Immediately remove and place in semi-dry transfer buffer. Immerse two pieces of filter paper and the electrophoresis gel together in the semi-dry transfer buffer for 10-30 minutes. Place the membrane in the following order: filter paper, PVDF membrane, electrophoresis gel, filter paper, removing air bubbles. Squeeze out excess buffer. Replace the semi-dry transfer cover: run at 17V for 50 minutes. After transfer, remove the PVDF membrane and place it in PBS buffer. Clean the filter paper and the semi-dry transfer apparatus.

[0168] Hybridization: PVDF membranes were placed in PBST buffer containing 5% skim milk and incubated at room temperature for 1 hour with a shaker. Primary antibody (T62 antibody vs. anti-S2 rabbit antibody, 1:4000) was added by volume and the mixture was incubated at room temperature for 1 hour. The membrane was washed three times with PBST buffer, 5 minutes each time. Secondary antibody (HRP-labeled goat anti-rabbit IgG antibody, 1:4000) was added by volume and the mixture was incubated at room temperature for 1 hour. The membrane was washed three times with PBST buffer, 5 minutes each time.

[0169] TMB color development. The reaction is terminated by water once a band appears.

[0170] See results Figure 13 The MVez-CoV2S.B.1.617.2 virus can stably express the antigen S protein during genetic stability passage.

[0171] Conclusion: The recombinant measles SARS-CoV-2S.B.1.617.2 strain rescued by electroporation in MRC-5 cells, after single-clone screening, yielded the correct strain, clone B. After 10 passages in MRC-5 cells, the infectivity titer remained above 4 LogCCID50 / ml. Western blot analysis of key passages during passage revealed the detection of the SARS-CoV-2 S protein. Sequencing analysis of the exogenous gene fragment in the intermediate P3 passage showed no base mutations or deletions in the target gene fragment during passage. A second round of single-clone screening in the P10 passage also yielded clones with the completely correct exogenous gene fragment, indicating that the virus, after 10 passages in MRC-5 cells, still possesses the completely correct exogenous gene fragment and stably expresses the target antigen fragment.

[0172] In summary, the pGEM3Zf(+)-T7RNAP plasmid constructed in this invention, along with the T7 RNA polymerase mRNA obtained through in vitro reverse transcription, the pT7-MVEZ-COV2S.B.1.617.2 plasmid constructed in this invention, and the helper plasmid, can be co-transfected into host cells via physical electroporation to obtain infectious recombinant measles SARS-CoV-2. This solves the problem that current methods for rescuing recombinant measles SARS-CoV-2 require transfection with recombinant poxviruses expressing T7 RNA polymerase or engineered cells that stably express T7 RNA polymerase to provide T7 RNA polymerase, making vaccine preparation using recombinant measles SARS-CoV-2 as a raw material difficult. It also solves the problem of low transfection efficiency and low effectiveness in rescuing recombinant measles SARS-CoV-2 by transfecting T7 polymerase expression plasmids. Therefore, this invention has practical application value.

Claims

1. A kit for virus rescue, characterized by: It comprises the following components: 1) T7 RNA polymerase mRNA; 2) helper plasmid 1 containing T7 promoter and measles N protein gene; 2) helper plasmid 2 containing T7 promoter and measles P protein gene; 3) helper plasmid 3 containing T7 promoter and measles L protein gene; The T7 RNA polymerase mRNA is mRNA capped by transcription of the T7RNAP gene; The nucleotide sequence of the T7RNAP gene is shown in NCBI Reference Sequence: NC_001604.

1.

2. The kit of claim 1, wherein: The T7 RNA polymerase mRNA is mRNA capped by transcription of the T7RNAP gene after linearization of the expression vector connected with the T7RNAP gene by using an RNA transcription synthesis kit; The expression vector is pGEM3Zf(+) plasmid; the RNA transcription synthesis kit includes Cap1 Capping System kit; the linearization is linearization by using SapI enzyme; And / or: the helper plasmid 1 is pT7-IRES-MVN plasmid; the pT7-IRES-MVN plasmid is pT7-IRES His-C DNA plasmid connected with the measles N protein gene; And / or: the helper plasmid 2 is pT7-IRES-MVP plasmid; the pT7-IRES-MVP plasmid is pT7-IRES His-C DNA plasmid connected with the measles P protein gene; And / or: the helper plasmid 3 is pT7-IRES-MVL plasmid; the pT7-IRES-MVL plasmid is pT7-IRES His-C DNA plasmid connected with the measles L protein gene.

3. The kit according to claim 1 or 2, characterized in that: It further comprises a viral vector; the viral vector includes a measles virus vector and a recombinant measles virus vector.

4. The kit of claim 3, wherein: The nucleotide sequence of the recombinant measles virus vector is shown in SEQ ID NO. 2-3.

5. Use of the kit of any one of claims 1-4 in rescuing viruses and / or recombinant viruses.

6. Use according to claim 5, characterized in that: The recombinant virus includes a measles recombinant novel coronavirus; the measles recombinant novel coronavirus comprises a gene fragment with a nucleotide sequence shown in SEQ ID NO. 1; the gene fragment encodes a novel coronavirus S protein.

7. A method of rescuing a recombinant coronavirus of measles, characterized by: It is rescued by using the kit of claim 4, and the steps are as follows: 1) Take MRC-5 cells, suspend in Opti-MEM TM medium, add the components of the kit of claim 4, mix, and place in a Bio-Rad cuvette for electroporation. 2) After the cells in step 1) are electroporated, they are cultured in MEM medium containing bovine serum, the supernatant of the culture solution is mixed with Vero cells, the Vero cells are frozen-thawed when the cytopathic effect is 80-90%, the culture solution is centrifuged, and the supernatant is collected, thereby obtaining the product.

8. The method of claim 7, wherein: Step 1) 2-7 x 10 5～7 MRC-5 cells plus 10-15 μg recombinant measles virus vector, 6-10 μg pT7-IRES-MVN plasmid, 2-6 μg pT7-IRES-MVP plasmid, 0.5-1.5 μg pT7-IRES-MVL plasmid, 8-12 μg T7 RNA polymerase mRNA, preferably: MRC-5 cells plus 5 x 10 6 MRC-5 cells plus 12 μg recombinant measles virus vector, 8 μg pT7-IRES-MVN plasmid, 4 μg pT7-IRES-MVP plasmid, 1 μg pT7-IRES-MVL plasmid, 10 μg T7 RNA polymerase mRNA; And / or: the conditions for the electroporation in step 1) are exponential wave, voltage 180V, capacitance 950μF, and frequency 1 time; and / or: the volume number ratio of the MEM medium containing bovine serum to MRC-5 cells in step 2) is 10 mL: 2-7 x 10 5～7 , preferably 10 mL: 5 x 10 6 ​ The concentration of bovine serum in the MEM medium containing bovine serum is 10%; The culture conditions are temperature 35-38℃, CO2 concentration 3-7%, and time 5-10 days, preferably: temperature 37℃, CO2 concentration 5%, and time 7 days; The Vero cells are Vero cells with a cell confluence of 80-90%, preferably Vero cells with a cell confluence of 90%.

9. A recombinant coronavirus of measles, characterized in that: It is a paramyxovirus with infectivity activity rescued according to the method of claim 7 or 8.

10. Use of the recombinant measles coronavirus of claim 9 for the preparation of a medicament for the prevention and / or treatment of COVID-19, characterized in that: The medicine includes a vaccine; the vaccine is made of a measles recombinant new coronavirus as an antigen, plus a pharmaceutically acceptable adjuvant.

Images