Editing system for specifically repairing pathogenic mutant gene by combining Sup-tRNA with gsnoRNA

Abstract

The invention discloses an editing system for specifically repairing a pathogenic mutant gene by combining Sup-tRNA with gsnoRNA. According to the method, the Sup-tRNA and the gsnoRNA are combined to repair the pathogenic nonsense mutation for the first time, so that the mutation read-through efficiency is improved, and off-target read-through is avoided. In addition, the invention also provides a recombinant vector and a cell comprising the editing system, and provides a pharmaceutical composition. The invention provides a new strategy for treating pathogenic nonsense mutation related diseases, and has a wide application prospect clinically.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology. Specifically, this invention relates to an editing system for the specific repair of pathogenic mutated genes by Sup-tRNA binding to gsnoRNA. Background Technology

[0002] Many types of gene mutations exist in the human genome, and nonsense mutations are one type. Gene mutations are heritable variations in genomic DNA molecules, including frameshift mutations and base substitutions. Frameshift mutations include base insertions and deletions, while base substitutions are mainly missense and nonsense mutations. Nonsense mutations occur when a base in a gene is mutated, producing stop codons UAG, UAA, and UGA. Stop codons do not encode any amino acids under normal physiological conditions. Stop codons cannot pair with the anticodons of transfer RNA (tRNA), but they can be recognized by termination factors or releasing factors, terminating peptide bond synthesis and causing protein synthesis to stop, resulting in the loss of normal protein function. The occurrence of nonsense mutations produces premature termination codons (PTCs) within the gene frame, leading to two possible outcomes: either the production of truncated proteins or a decrease in the stability and abundance of mRNA containing PTCs, thus triggering corresponding diseases.

[0003] Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease caused by the loss of motor neurons from the brain and spinal cord. The disease leads to progressive weakness and atrophy of the muscles in the limbs, trunk, chest, and abdomen, affecting motor, communication, swallowing, and respiratory functions, ultimately resulting in death. Recent findings suggest that the pathogenesis of ALS may be caused by nonsense mutations in genes, such as those in FUS and TBK1. Therefore, repairing nonsense mutations in disease-causing genes is key to treating ALS. Summary of the Invention

[0004] To overcome the shortcomings of existing technologies, the purpose of this invention is to provide an editing system for the specific repair of pathogenic mutated genes by Sup-tRNA binding to gsnoRNA.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] The first aspect of this invention provides a Sup-tRNA.

[0007] Furthermore, the Sup-tRNA is selected from any of the sequences shown in SEQ ID NO. 1-2; or sequences that have at least 80% identity with any of the sequences shown in SEQ ID NO. 1-2.

[0008] In this invention, the applicant uses parental Sup-tRNA Arg The anticodon UCG is mutated to UCA, enabling it to pair with the stop codon TGA, thereby reading through the nonsense mutation, restoring full-length protein expression, and rescuing the nonsense mutation phenotype.

[0009] In some embodiments, the Sup-tRNA is selected from sequences having at least 80%, 81%, 83%, 85%, 87%, 88%, 89%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 99.9% sequence identity with any of the sequences shown in SEQ ID NO. 1-2.

[0010] In this invention, the term "identity" refers to the overall correlation between polymer molecules, such as between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. For example, for optimal comparison, the percentage of identity between two polynucleotide sequences can be calculated by comparing them for optimal alignment (e.g., for optimal alignment, gaps can be introduced in one or both of the first and second nucleic acid sequences, and dissimilar sequences can be ignored for comparison purposes). In some embodiments, the sequence lengths compared for comparison purposes are at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of a reference sequence. Nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the two molecules are identical at that position. The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. The comparison of sequences and the determination of the percentage of identity between two sequences can be accomplished using mathematical algorithms. For example, the percentage of identity between two nucleic acid sequences can be determined using methods described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percentage of identity between two nucleic acid sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which uses a PAM120 weighted residual table, a gap length penalty of 12, and a gap penalty of 4 incorporated into the ALIGN program (version 2.0).Alternatively, the NWSgapdna.CMP matrix can be used with the GAP program in the GCG software package to determine the percentage of identity between two nucleic acid sequences. Methods commonly used to determine the percentage of identity between sequences include, but are not limited to, those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are incorporated into publicly available computer programs. Exemplary computer software for determining homology between two sequences includes, but is not limited to, the GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, SF et al., J. Molec. Biol., 215, 403 (1990)).

[0011] A second aspect of the present invention provides a gsnoRNA.

[0012] Furthermore, the gsnoRNA comprises a backbone sequence and a guide sequence for hybridization with a sequence containing target uridine residues in the target RNA.

[0013] Furthermore, the backbone sequence is derived from the following H / ACA-snoRNAs: ACA19, ACA36, ACA2b, ACA19-TTCT, and ACA19-TGTT.

[0014] Furthermore, the guiding sequence is located within the hairpin structure of the skeleton sequence.

[0015] Furthermore, the gsnoRNA is selected from any of the sequences shown in SEQ ID NO. 6-10; or sequences that have at least 80% identity with any of the sequences shown in SEQ ID NO. 6-10.

[0016] In some embodiments, the gsnoRNA is a full-length gsnoRNA comprising a 3' hairpin, a 5' hairpin, an H box, and an ACA box, wherein the guide sequence is located within the hairpin structure of the gsnoRNA backbone sequence.

[0017] In some implementations, the gsnoRNA contains multiple guide sequences.

[0018] In this invention, the guide sequence is shown as (Xn) and underlined, where Xn is a sequence of X nucleotides of length n, where X is any one of A, U, G, or C, and n is 4, 5, 6, 7, 8, 9, 10, 11, or 12. As those skilled in the art will appreciate, this guide sequence (Xn) can be modified to target gsnoRNA to a desired target site. In some embodiments, n is an integer of an appropriate length for the guide region. In some embodiments, n is 4, 5, 6, 7, 8, or 9. In specific embodiments of this invention, the guide sequence is designed with FUS as the target, and designing guide sequences for different targets is well known to those skilled in the art.

[0019] A third aspect of the present invention provides an editing system that specifically targets nonsense mutations.

[0020] Furthermore, the editing system includes the modified Sup-tRNA and the gsnoRNA described in the second aspect of the present invention.

[0021] Furthermore, the modified Sup-tRNA is selected from any of the sequences shown in SEQ ID NO. 3-5, or sequences that have at least 80% identity with any of the sequences shown in SEQ ID NO. 3-5.

[0022] Furthermore, the editing system includes a combination of any one of SEQ ID NO.3 and SEQ ID NO.6-10.

[0023] Furthermore, the editing system is selected from a combination of SEQ ID NO.3 and SEQ ID NO.10.

[0024] In this invention, to specifically target nonsense mutations, the applicant, taking the FUS gene as an example, combines Sup-tRNA and gsnoRNA to treat this nonsense mutation. To this end, the applicant first modified Sup-tRNA Arg1, specifically targeting positions 33 and 37, to create Sup-tRNA-X1 (37G>A), Sup-tRNA-X2 (33U>C), and Sup-tRNA-X3 (37G>C); subsequently, six gsnoRNAs were screened; and when Sup-tRNA and gsnoRNA were randomly combined, it was found that the combination of X1 and g6 could specifically target the FUS-R495X nonsense mutation, restoring its full length.

[0025] In this invention, the terms “modified,” “non-naturally occurring,” or “engineered” are used interchangeably and indicate artificial involvement. When referring to a nucleic acid molecule or polypeptide, it means that, compared to a naturally occurring nucleic acid molecule or peptide, it contains at least one modification (e.g., at least one mutation, such as substitution, insertion, or deletion, or at least one non-naturally occurring chemical modification), or at least substantially contains no other components that are naturally associated with and exist in nature.

[0026] A fourth aspect of the present invention provides a recombinant vector.

[0027] Furthermore, the recombinant vector includes the Sup-tRNA described in the first aspect of the present invention, the gsnoRNA described in the second aspect of the present invention, or the editing system described in the third aspect of the present invention.

[0028] Furthermore, the recombinant vector is selected from adeno-associated virus vectors.

[0029] Furthermore, the adeno-associated virus vector is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, and AAVrh74.

[0030] In this invention, a vector refers to an artificial construct capable of delivering and preferably expressing one or more target genes or sequences in a host cell. The vector of this invention is not limited and can be an expression vector, viral vector, etc. In some embodiments, the vector comprises the Sup-tRNA described in the first aspect of this invention or the gsnoRNA described in the second aspect of this invention, a promoter, a terminator, or optionally further comprises a marker gene. The vector can be a known vector or a self-constructed vector. Known vectors include plasmid vectors, lentiviral vectors, adenovirus vectors, AAV viral vectors, etc. In a specific embodiment of this invention, the vector is selected from AAV viral vectors.

[0031] The fifth aspect of the present invention provides a host cell.

[0032] Furthermore, the host cell includes the Sup-tRNA described in the first aspect of the present invention, the gsnoRNA described in the second aspect of the present invention, the editing system described in the third aspect of the present invention, or the recombinant vector described in the fourth aspect of the present invention.

[0033] Furthermore, the host cells include prokaryotic cells and eukaryotic cells.

[0034] In this invention, the host cell includes any suitable prokaryotic or eukaryotic cell. Cells that can be used include those that can grow easily and reliably, have a reasonably rapid growth rate, possess a well-characterized expression system, and can be easily and efficiently transformed or transfected. Eukaryotic cells are known in the art and include, but are not limited to, yeast cells, insect cells, and mammalian cells. In one embodiment, the vector is expressed in a mammalian cell. Many suitable mammalian host cells are known in the art. Examples of suitable mammalian cells include (but are not limited to) Chinese hamster ovary cells, CHO DHFR cells, human embryonic kidney (HEK) 293, HEK293E, HEK293-6E, HEK293F, or 293T cells (ATCC No. CRL1573) and 3T3 cells (ATCC No. CCL92). Other suitable mammalian cell lines include monkey COS-1 (ATCC CRL1650) and COS-7 (ATCC CRL1651), per.C6 cells, CV-1 (ATCC CCL70), myeloma cells, hybridoma cells, and NSO cells. Human cells are ideally chosen as the mammalian cell type. In a specific embodiment of this invention, the host cell is HEK293F cell. The nucleic acid sequences described herein can be introduced into cells via transfection, transformation, or transduction.

[0035] The sixth aspect of the present invention provides a pharmaceutical composition.

[0036] Furthermore, the pharmaceutical composition includes the Sup-tRNA described in the first aspect of the present invention, the gsnoRNA described in the second aspect of the present invention, the editing system described in the third aspect of the present invention, the recombinant vector described in the fourth aspect of the present invention, or the host cell described in the fifth aspect of the present invention.

[0037] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier and / or excipients.

[0038] In this invention, pharmaceutically acceptable carriers may include, for example, pharmaceutically acceptable liquid, gel or solid carriers, aqueous mediators, non-aqueous mediators, antimicrobial agents, isotonic agents, buffers, antioxidants, anesthetics, suspending / dispersing agents, clamping or chelating agents, diluents, adjuvants, excipients or non-toxic auxiliary substances, other components known in the art, or various combinations thereof.

[0039] The pharmaceutical composition may be a liquid solution, suspension, emulsion, pill, capsule, tablet, sustained-release formulation, or powder. Oral formulations may include standard carriers such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, polyvinylpyrrolidone, sodium saccharin, cellulose, magnesium carbonate, etc.

[0040] Furthermore, the pharmaceutical composition may also include other drugs for treating diseases caused by nonsense mutations.

[0041] The seventh aspect of the present invention provides a method for editing target RNA in cells.

[0042] Furthermore, the method includes introducing the Sup-tRNA described in the first aspect of the present invention, the gsnoRNA described in the second aspect of the present invention, the editing system described in the third aspect of the present invention, or the recombinant vector described in the fourth aspect of the present invention into cells containing target RNA.

[0043] The eighth aspect of the present invention provides the use of the Sup-tRNA described in the first aspect of the present invention, the gsnoRNA described in the second aspect of the present invention, the editing system described in the third aspect of the present invention, the recombinant vector described in the fourth aspect of the present invention, the host cell described in the fifth aspect of the present invention, or the pharmaceutical composition described in the sixth aspect of the present invention in the preparation of a medicament for treating diseases caused by nonsense mutations.

[0044] Furthermore, the diseases mentioned include: amyotrophic lateral sclerosis (ALS), cystic fibrosis, Heller syndrome, alpha-1 antitrypsin deficiency, Parkinson's disease, Alzheimer's disease, albinism, asthma, thalassemia 8, Cadasil syndrome, Shaco-Malley-Duss disease, chronic obstructive pulmonary disease, distal spinal muscular atrophy, Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, Leiden factor 5-related diseases, familial adenomatous polyposis, galactosemia, Gaucher's disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Huntington's disease, and inflammatory bowel disease. IBD, hereditary polyagglutination syndrome, Leber congenital amaurosis, Leber-Ney's syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy of types I and II, neurofibromatosis, Niemann-Pick II disease of types A, B and C, NY-esol-related cancers, Boytz-Yage syndrome, phenylketonuria, Pompe disease, primary ciliary body disease, pulmonary hypertension, Sandhoff disease, severe complex immunodeficiency syndrome, sickle cell anemia, spinal muscular atrophy, Sturgeon's disease, Ty-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturgeon-Weber syndrome, and cancer.

[0045] Furthermore, the disease is selected from amyotrophic lateral sclerosis (ALS).

[0046] Advantages and beneficial effects of the present invention:

[0047] This invention is the first to combine Sup-tRNA with gsnoRNA to repair pathogenic nonsense mutations. Furthermore, the applicant discovered through engineered modification of Sup-tRNA that the binding of Sup-tRNA-X1 and gsnoRNA6 can dual-target pathogenic nonsense mutation sequences. This approach not only improves mutation readthrough efficiency but also avoids off-target readthrough, providing a new strategy for treating nonsense mutation-related diseases. Attached Figure Description

[0048] Figure 1 The sup-tRNA was shown to be able to read nonsense mutations in mCherry-R41X; among which, Figure 1 A is a schematic diagram of the construction of sup-tRNAArg1 (S1) and sup-tRNAArg2 (S2); Figure 1 B is a schematic diagram of sup-tRNA screening constructed using a plasmid (cb6-mCherry-R41X) encoding red fluorescent protein (mCherry) and carrying a PTC mutation; Figure 1 Figure C shows the repair results of the mCherry-R41X reporter gene treated with S1 and S2 at 24 hours and 48 hours; Figure 1 D is a quantitative diagram showing the recovery of mCherry protein expression by S1 and S2;

[0049] Figure 2 The study demonstrated the inhibitory effect of PTC in HEK 293FT cells and the restoration of TBK1-R357X protein function; among which, Figure 2 A is a schematic diagram of TBK1-WT-GFP and TBK1-R357X-GFP; Figure 2 B and C represent the green fluorescent protein images (bar=200μm) of TBK1-R357X-GFP after recovery via S1 or S2, respectively, and the quantitative analysis diagrams. Figure 2 DE are representative protein blots and quantitative analysis diagrams of TBK1 protein expression restored by S1 or S2, respectively. Figure 2 F represents the amino acid residue incorporation rate at the TBK1-R357X site as analyzed by mass spectrometry;

[0050] Figure 3 The sup-tRNA showed that it inhibited the FUS-R495X mutation in HEK293 cells; among which... Figure 3 A is a schematic diagram of FUS-WT-GFP and FUS-R495X-GFP; Figure 3 B and C represent representative images (bar=100μm) and quantitative plots of S1 recovery of FUS-R495X GFP expression, respectively. Figure 3D shows representative immunofluorescence images (bar=50μm) of wild-type FUS and mutant FUS (red) in HEK 293 FT cells. The magnified field shows aggregates of mutant FUS in the cytoplasm. Figure 3 E is a quantitative analysis chart of the aggregation area of ​​FUS-WT, FUS-R495X and FUS-R495X+S1; Figure 3 F is a graph showing the cell inventory rate results; Figure 3 G represents the full-length protein content results of FUS;

[0051] Figure 4 The mFus R487X He-hFUS R495X Hem (double H) mice showed reduced motor activity and motor neuron count, as well as microglial activation; among which, Figure 4 A shows the extension status of an 8-month-old double-H mouse; Figure 4 B represents the result of the rotator test; Figure 4 CD is a NeuN and Fus staining image of wild-type mice and double-H mice; Figure 4 EF shows Iba1 and NeuN staining patterns (bar=20μm) in wild-type mice and double-H mice.

[0052] Figure 5 AAV9 Sup-tRNA was observed after ICV injection. Arg Distribution of -GFP (AAV9-S1-GFP); among which Figure 5 A represents IVIS spectral imaging of AAV9-S1-GFP-treated WT mice, hFUS-R495X mice, and hFUS-R495X+S1 mice. Figure 5 B represents the distribution of GFP in the cortex, cervical spinal cord, and lumbar spinal cord; Figure 5 C represents the proportion of GFP-positive cells in Neu N-positive cells; Figure 5 D represents NeuN and GFP double-positive cells throughout the cortex and spinal cord;

[0053] Figure 6 The study demonstrated intrathecal treatment of mFus R487X He-hFUS R495X Hem (double H) mice with AAV9-S1; among them, Figure 6 A is a schematic diagram of AAV9-S1-mCherry; Figure 6 B represents the phenotype of DoubleH mice after AAV9-S1 intervention; Figure 6 C represents IVIS spectral imaging of AAV9-S1-mCherry-treated WT mice, double-H mice, and double-H+S1 mice. Figure 6 D significantly increased the latency of the wheel test in model mice with AAV9-S1; Figure 6E and F represent readout efficiency and staining results of motor neurons; Figure 6 GJ represents the distribution of FUS in the cytoplasm and the number of IBA-1 positive cells;

[0054] Figure 7 The results of Sup-tRNA engineering are shown; among them... Figure 7 A is a schematic diagram of the engineering modification of Sup-tRNA; Figure 7 B and D represent the readthrough efficiency of the modified Sup-tRNA against nonsense mutations mCherry-R41X, FUS-R495X, and TBK1-R357X, respectively.

[0055] Figure 8 The results showed that Sup-tRNA combined with gsnoRNA could achieve specific readthrough of hFUS-R495X; among which, Figure 8 A is a diagram showing the backbone structure of ACA19-TGTT gsnoRNA and its interaction pattern with target mRNA; Figure 8 B represents the sequences and mutation sites of the 5' target guide and 3' target guide of gsnoRNA targeting human FUS-R495X. Figure 8 C forms gsnoRNA6 (hFUS-R495X-gsnoRNA6) that targets the FUS-R495X mutation. The 5' and 3' guide sequences of gsnoRNA6 target the FUS-R495X mRNA, forming a complex composed of gsnoRNA, mRNA, and DKC1, etc. Finally, the U in the stop codon is modified to ψ.

[0056] Figure 9 The screening results for the gsnoRNA6 combination of Sup-tRNA-X1 and hFUS-R495X; Figure 9 AD represents the readthrough efficiency of Sup-X1+gsnoRNA6 against FUS-R495X, mCherry-R41X, TBK1-R357X 24h, and TBK1-R357X 48h, respectively. Figure 9 EG represents the readout quantification results of Sup-X1+gsnoRNA6 against FUS-R495X, mCherry-R41X, and TBK1-R357X.

[0057] Figure 10 The screening results for gsnoRNA4-5 combinations of Sup-tRNA-X1 and hFUS-R495X; Figure 10 AC represent the readthrough efficiency of Sup-X1+gsnoRNA4 or 5 against FUS-R495X, mCherry-R41X, and TBK1-R357X, respectively. Figure 10 DF represents the readout quantification results of Sup-X1+gsnoRNA4 or 5 pairs of FUS-R495X, mCherry-R41X and TBK1-R357X, respectively.

[0058] Figure 11 The screening results for gsnoRNA1-3 combinations of Sup-tRNA-X1 and hFUS-R495X; Figure 11 A and B represent the readthrough efficiency of Sup-X1+gsnoRNA1-3 on FUS-R495X at 24h and 48h, respectively. Figure 11 CD represents the readout quantification results of Sup-X1+gsnoRNA1-3 against FUS-R495X at 24h and 48h, respectively.

[0059] Figure 12 The screening results for gsnoRNA1-3 combinations of Sup-tRNA-X2 and hFUS-R495X; Figure 12 A and B represent the readthrough efficiency of Sup-X2+gsnoRNA1-3 on FUS-R495X at 24h and 48h, respectively. Figure 12 CD represents the readout quantification results of Sup-X2+gsnoRNA1-3 against FUS-R495X at 24h and 48h, respectively.

[0060] Figure 13 The screening results for gsnoRNA4-6 combinations of Sup-tRNA-X2 and hFUS-R495X; Figure 13 A and B represent the readthrough efficiency of Sup-X2+gsnoRNA4-6 against FUS-R495X at 24h and 48h, respectively. Figure 13 CD represents the readout quantification results of Sup-X2+gsnoRNA4-6 against FUS-R495X at 24h and 48h, respectively.

[0061] Figure 14 The screening results for gsnoRNA1-3 combinations of Sup-tRNA-X3 and hFUS-R495X; Figure 14 A and B represent the readthrough efficiency of Sup-X3+gsnoRNA1-3 on FUS-R495X at 24h and 48h, respectively. Figure 14 CD represents the readout quantification results of Sup-X2+gsnoRNA1-3 against FUS-R495X at 24h and 48h, respectively.

[0062] Figure 15 The screening results for gsnoRNA4-6 combinations of Sup-tRNA-X3 and hFUS-R495X; Figure 15A and B represent the readthrough efficiency of Sup-X3+gsnoRNA4-6 against FUS-R495X at 24h and 48h, respectively. Figure 15 CD represents the readout quantification results of Sup-X3+gsnoRNA4-6 against FUS-R495X at 24h and 48h. Detailed Implementation

[0063] The present invention will be further described below with reference to specific embodiments. However, the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention. Unless otherwise specified in the following embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments used, unless otherwise specified by the manufacturer, are all commercially available conventional products.

[0064] The materials and methods used in the following embodiments are as follows:

[0065] 1. Cell lines and cell culture: The human embryonic kidney cells 293FT (HEK 293FT, 1101HUM-PUMC000364) used in this experiment were purchased from the Cell Resource Center of Peking Union Medical College. HEK 293FT cells were cultured in DMEM (Pricela, Wuhan, China) supplemented with 10% (v / v) fetal bovine serum (Invitrogen, Carlsbad, USA). The NSC-34 cell line (donated by Professor Yuesheng) (Zhang, Roswell Parkwas) was maintained in DMEM supplemented with 20% (v / v) fetal bovine serum and cultured in a humidified incubator at 37°C and 5% CO2.

[0066] 2. Plasmids and Transfection: Target genes hTBK1 and hFUS were identified using the Ensemble database. The coding DNA sequences (CDS) of the target genes were added to enzyme restriction sites. Plasmids were constructed and synthesized by Shanghai Sangon Biotech Co., Ltd. Co-transfection was performed in 293-FT and NSC34 cells using Lipofectamine 3000 (Invitrogen, Carlsbad, USA). Green fluorescence expression was detected under a microscope, indicating successful transfection.

[0067] 3. Fluorescence Analysis: Mouse spinal cord was perfused with 4% paraformaldehyde and fixed in the same fixative for 24 hours. The sections were then cut into 25-micron free-floating sections using a vibratory microtome (Leica Biosystems, Shanghai, China). 200 μL of 0.01 M PBS buffer was added to the slides, and the sections were washed three times for 5 minutes each time. The sections were then perforated with 0.3% Triton X-100 for 30 minutes. The sections were blocked with 100 μL of 10% horse serum for approximately 1 hour at room temperature. The corresponding primary antibody was diluted to 50 μL with 1% horse serum and incubated overnight at 4°C. The next day, the sections were washed three times with 0.01 M PBS solution for 5 minutes each time. The corresponding fluorescent secondary antibody was diluted to 50 μL with 1% horse serum and incubated with shaking at room temperature for 1 hour. The sections were washed three times with 0.01 M PBS, with Hoechst nuclear staining agent (1:50) added for 5 minutes each time, and incubated for 30 minutes at room temperature in the dark using a shaker. Rinse three times with 0.01M PBS for 5 minutes each time, mount with anti-fluorescence quencher, store at 4°C in the dark, and observe and photograph using an Olympus FV1000 confocal laser microscope.

[0068] 4. Western blot: Protein expression in cells was quantified by Western blotting. Total protein was extracted using a total protein extraction kit (Applygen, Beijing, China). 50 μg of protein from each sample was separated onto a 10% or 12% SDS-PAGE gel and transferred to a PVDF membrane. The membrane was incubated overnight at 4°C with the primary antibody. After incubation for 1 hour at room temperature with a secondary antibody conjugated to a fluorescent dye, the bands of interest were detected using an Odesai infrared imaging system (LI-COR, Lincoln, NE).

[0069] 5. Animal Models: The mice used in the experiments were designed and manufactured by Shanghai Southern Model Biotechnology Co., Ltd. The mFus point mutation mouse model (mFus mouse) was obtained using CRISPR / Cas9 technology to create mice with the R487* point mutation in the Fus gene. Specifically, a CAC-LSL-FLAG-HFUS-R495*-2A EGFP-WPRE pA mouse model was established at the Rosa26 locus in HFUS mice using CRISPR / Cas9 technology. Because the mouse FUS protein is relatively short, the mouse position corresponding to R487 in humans is R495. During mouse breeding, Cas9 mRNA and guide RNA were obtained through in vitro transcription, and oligonucleotide donor DNA was synthesized. Cas9 mRNA, gRNA, and donor DNA were microinjected into the fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. F0 generation mice with positive PCR product sequencing were mated with C57BL / 6J mice, and mFus He hFUS Hem mice were obtained through crossbreeding mFus He and hFUS Hem mice.

[0070] All animal experiments were conducted in accordance with the guidelines of the National Institutes of Health (NIH) *Laboratory Animal Care and Use Guidelines* (NIH Publication No. 8023, 1978 Revision). This study was approved by the local ethics committee (Research Ethics Committee of the Second Hospital of Hebei Medical University, Approval License No.: 2024-AE200). Mice were randomly fed sterile pelleted food and water in an environment of 22–26°C, 40–70% humidity, and a 12-hour light / 12-hour dark cycle. Cages were checked daily to ensure animal welfare. Weight was assessed regularly to ensure no weight loss. When animals were used for research, we followed the 3R (Reduction, Replacement, and Optimization) principle.

[0071] 6. ICV and Intrathecal Injection: On day 0 (P0) after birth, newborn mice were hypothermia-anesthetized for 2-4 minutes until they stopped moving. Each mouse received 5 μL of AAV9 virus, for a total dose of 2.5 × 10⁻⁶. 11 Each hFUS Hom pup was randomly assigned to a different treatment group. Injection sites were located 0.8–1 mm lateral to the midpoint of the anterior and posterior fontanelles, at a depth of 3 mm. Injections were administered perpendicularly to the skull surface using a 25 μL Hamilton syringe (Hamilton Company, Reno, NV, USA) with a 45° bevel. Mice were weaned at 4 weeks of age and sacrificed at 4 months of age for immunofluorescence and immunohistochemical analysis.

[0072] 7. Behavioral testing:

[0073] Rotary bar test: Place the animal on an accelerator shaft (4-40 rpm) for 5 minutes each time, three times a day for 4 consecutive days. Allow a 20-minute rest period between each test. The system automatically calculates the time it takes for the mouse to fall off the rotundus within 5 seconds.

[0074] Footprint analysis experiment: Mice were placed in a footprint analysis box, with their hind feet colored red and their forefeet colored black. Researchers analyzed the footprints left by the mice as they walked to assess their gait, stride length, and other parameters. At the end of the experiment, all stride lengths on the recording paper were measured, and the maximum values ​​were recorded.

[0075] Hind limb extension test: This test assesses hind limb strength. The mouse is placed vertically on a soft mat 50 cm above the midpoint of its tail for a maximum of 30 seconds. The mouse is scored as follows: 0 = both hind limbs are fully retracted; 1 = both hind limbs are partially retracted; 2 = one hind limb is retracted and the other hind limb is extended outward from the abdomen.

[0076] Wire suspension test: To assess limb strength (as a measure of motor function), mice were placed on a wire suspended 50 cm above a soft mat, and their fall time was recorded. Each mouse was tested three times a day for three consecutive days, with each test lasting a maximum of 5 minutes.

[0077] 8. LC-MS / MS: After cell lysis, the gel strips were stained with Coomassie Brilliant Blue following Western blotting, and the repaired protein target bands were cleaved according to the molecular weight of TBK1. Subsequently, protein mass spectrometry analysis was performed by Sangon Biotech Co., Ltd. to identify protein mutation sites. Mass spectrometry data were retrieved using MaxQuant (V2.0.1) software with the Andromeda database retrieval algorithm.

[0078] IVIS spectral imaging: AAV-S1 was injected into mice via intracerebroventricular injection. At four months of age, hFUS He mice were sacrificed, and their brains and spinal cords were collected for biodistribution assessment. Brain and spinal cord imaging was performed using the IVIS Lumina III imaging system (PerkinElmer, Waltham, Massachusetts, UK). Signal intensity was quantified using LivingImage software (PerkinElmer, Waltham, Massachusetts, UK).

[0079] Example 1: sup-tRNA can effectively read pathogenic nonsense mutations.

[0080] The sequences of parental tRNA-Arg-TCG-1-1 (GGCCGCGTGGCCTAATGGATAAGGCGTCTGACTTCAG ATCAGAAGATTGCAGGTTCGAGTCCTGCCGCGGTCG) and tRNA-Arg-TCG-3-1 (GACCGCGTGGCCTAATGGATAAGGCGTCTGACTTCAGATCAGAAGATTGAGGGTTCGAGTCCCTTCGTGGTCG) were downloaded from the GtRNAdb website (https: / / gtrnadb.ucsc.edu / citation.html). To pair with the stop codon TGA, the anticodon of tRNA-Arg-UCG was mutated to UCA, creating sup-tRNA Arg1 (S1) and sup-tRNA Arg2 (S2) plasmids. Figure 1 A). The sequence of the mutated sup-tRNA Arg1 is (GGCCGCGTGGCCTAATGGATAAGGCGTCTGACTTCAGATCAGAAGAT TGCAGGTTCGAGTCCTGCCGCGGTCA, SEQ ID NO.1); the sequence of the mutated sup-tRNA Arg2 is (GACCGCGTGGCCTAATGGATAAGGCGTCTGACTTCAGATCAGAAGATTGAGGGTTCGAGTCCCTTCGTGGTCA, SEQ ID NO.2).

[0081] Next, a red fluorescent protein reporter group cb6-mCherry-R41X (abbreviated as mCherry-R41X, where R41X represents a nonsense mutation in the 41st arginine codon of the mCherry gene, which has been mutated into TGA) was prepared to test the reading efficiency of S1 and S2. Figure 1 CD results showed that co-transfection of S1 and S2 with the mCherry-R41X reporter gene in 293FT cells significantly restored mCherry expression at both 24 and 48 hours, especially at 48 hours. These results increase the likelihood that sup-tRNA can effectively read pathogenic nonsense mutations.

[0082] To interpret the termination mutations in ALS-related genes, we constructed the CB6-TBK1-R357X-GFP plasmid (abbreviated as TBK1-R357X, where TBK1-R357X is a pathogenic nonsense mutation site in ALS) and co-transfected it with S1 and S2 in 293FT cells. Figure 2A). Observation under an inverted fluorescence microscope at 24h and 48h post-transfection showed that the fluorescence intensity of TBK1-R357X+S1 and TBK1-R357X+S2 in the treatment group was significantly higher than that in the control group, which was statistically significant (P<0.001). Figure 2 BC). Figure 2 The results of DE also showed that S1 and S2 significantly restored the expression of full-length TBK1, while the expression of the truncated protein was almost completely reduced. Protein mass spectrometry analysis of the repaired proteins showed that the amino acid residue infiltration rates of sup-tRNA through-read PTC were: Arg 73%, Ger 26%, and Gly 1%. Figure 2 F).

[0083] Besides the TBK1 protein, FUS mutations also lead to adolescent ALS, accompanied by rapid progression of motor neuron degeneration. Therefore, we developed the CB6-Flag-FUS-R495X-GFP plasmid (FUS-R495X) and the CB6-Flag-FUS-WT-GFP plasmid (FUS-WT). Figure 3 A). The constructed FUS-R495X plasmid was co-transfected with S1, and the results showed that S1 significantly increased the expression of full-length FUS at both 24 and 48 hours. Figure 3 BC). Subsequently, the number of aggregates of mutant FUS was quantified, and S1 reduced aggregates to 50% compared to the untreated group (BC). Figure 3 DE). Compared with the FUS-R495X group, the S1+FUS-R495X group showed a 2.9-fold increase in full-length FUS protein content and a significantly improved cell viability. Figure 3 FG).

[0084] Furthermore, in order to test Sup-tRNA Arg To assess the therapeutic value in vivo, we established hFUS-R495X (N-terminally labeled with a Flag peptide, C-terminally linked with a 2A peptide and GFP) and mFus-R487X animal models. First, we tested the motor function of the hFUS R495X transgenic animal models. We found that hFUS R495X mice exhibited abnormal stretching and bending at 4 months of age. Although there were no significant changes in body weight and leg length compared to WT mice, the time spent on the rotarod was reduced by 24.2% on day 2. From day 1 to day 3, suspension time decreased by 57.23%, 58.1%, and 60.24%, respectively. Furthermore, we evaluated the motor function of mFus R487X He-hFUS R495X-Hem (double H) mice, finding that from 48 to 96 hours, their latency on the rotarod decreased by 36.34%, 50.53%, and 40.46%, respectively. Figure 4 AB). The body weight, leg length, and suspension time of the double-H mice were similar to those of wild-type mice. Subsequently, motor neurons in the spinal cord were evaluated, and the results showed that the number of neurons in the lumbar and cervical spinal cords was reduced by 32.49% and 42.46%, respectively. Figure 4 CD). The intensity of cytoplasmic Fus protein in motor neurons of double-H mice was 2.4 times higher than that of WT mice ( Figure 4 CD). We labeled microglia with IBA-1 antibody and found that the FUS termination mutation led to microglia activation, increased number, and enlarged shape. Figure 4 Finally, the double-H mice reproduced the essential motor phenotypes and pathological features associated with FUS mutations in ALS patients.

[0085] Next, we evaluated the effect of AAV9 via ICV (intraventricular injection) in P0-hFUS-R495X-Hem mice (1.5 × 10⁻⁶). 13 Distribution of Arg-Sup-tRNA1 delivered at 3 μL (vg / ml) was analyzed. Samples were collected 3 months post-injection, and Arg-Sup-tRNA1 distribution was assessed based on the amount of GFP fluorescence in the cortex and spinal cord. Figure 5 In A, IVIS spectral imaging revealed that GFP fluorescence was widely distributed throughout the central nervous system, suggesting that AAV9-Arg-Sup-tRNA1 achieved readthrough of the termination mutation. Furthermore, tissue sections showed that GFP was mainly located in cortical layers 4-5, the anterior horn of the cervical and lumbar spinal cords. Figure 5 BD).

[0086] Double H mice were injected intrathecally with AAV9 Sup-tRNA Arg After treatment, the distribution of mCherry fluorescence in the lumbar spinal cord significantly increased. Figure 6 C). In addition, Figure 6 AB and D showed that, compared with the control group, the latency on the rotarod was significantly increased in the Double-H+AVA9-S1 group on the third training day after four months of treatment. Consistently, 34.5% and 27.5% of motor neurons were preserved in the cervical and lumbar spinal cords, respectively, and the reading efficiency in the spinal cord reached 58.8% by calculating mCherry-positive cells. Simultaneously, intrathecal injection of AAV9 Sup-tRNA... Arg Subsequently, the cytoplasmic FUS level decreased to 80.65%, while the nuclear FUS intensity increased by 39.31%. Figure 6 DF, Figure 6 H).

[0087] Example 2 Modified Sup-tRNA Arg gsnoRNA can specifically read hFUS-R495X

[0088] To evaluate Sup-tRNA Arg To improve readability, we modified the nucleic acids at positions 33 and 37 of sup-tRNA Arg1 and named it Sup-tRNA. Arg -X1 (mutating "G" to "A" at position 37, abbreviated as X1), Sup-tRNA Arg -X2 (mutating "T" to "C" at position 33, abbreviated as X2) and Sup-tRNA Arg -X3 (mutates "G" to "C" at position 37, abbreviated as X3) Figure 7 A), whose mutated sequences are GGCCGCGTGGCCTAATGGATAAGGCGTCTGACTTCAAATCAGAAGATTGCAGGTTCGAGTCCTGCCGCGGTCA (SEQ ID NO.3), GGCCG CGTGGCCTAATGGATAAGGCGTCTGACCTCAGATCAGAAGATTGCAGGTTCGAGTCCTGCCGCGGTCA (SEQ ID NO.4), and GGCCGCGTGGCCTAATGGAT AAGGCGTCTGACTTCACATCAGAAGATTGCAGGTTCGAGTCCTGCCGCGGTCA (SEQ ID NO.5). Then, we tested the modified Sup-tRN in 293FT cells co-transfected with mCherry-R41X, FUS-R495X, and TBK1-R357X. Arg The reading efficiency was significantly reduced after modification of Sup-tRNA-X. Figure 7 BD).

[0089] To achieve specific readthrough of hFUS-R495X, we constructed a series of gsnoRNAs capable of converting UGA to ΨGA. The backbone structures of the gsnoRNAs were selected from H / ACA box snoRNAs: ACA19, ACA36, ACA2b, ACA19-TTCT, and ACA19-TGTT, with backbone structures of GTGCACAT, respectively. (Xn) ACCTGCTTTCTTTTATGTGAGTAGTGTT (Xn) ATGTGCTATACAAATAATTGAAGG (Xn) GCAGTATAACTATAAATAGTAATGCTGC (Xn) CCTTCAGACAAAA(SEQID NO.6);TTCCAA (Xn)TCAGTCCAGGGCAGCTTCCCTG TTCTGA (Xn) TTGGGACATTAAAATGGGCTAAGGG (Xn) GGGTAGAAAGTATTATTCTATTC (Xn) CCCAGCCTACAAAA(SEQ ID NO.7);TTGGCTCTT (Xn) GGCCAGCAGTTTGCTGAAGCTGTTGGcc (Xn) AGGAGCCTAAAGAATTGTCTTTCTA (Xn) TTGGCCATTTCATAACTTTGGAAATGTAATGGTCAA (Xn) AGAAAGAAACATGA(SEQ ID NO.8);GTGCACA (Xn) GACCTGCTTTCTTCTATGTGAG TAGTGTT (Xn) TGTGCTATACAAATAATTGAAG (Xn) GCAGTATAACTATAAATAGTAATGCTGC (Xn) TCTTCAGACAAAA(SEQ ID NO.9);GTGCACA (Xn) GACCTGCTTTCTGTTATGTGAGTAGTGTT (Xn) TGTGCTATACAAATAATTGAAG (Xn) GCAGTATAACTATAAATAGTAATGCTGC (Xn) CTTCAGACAAAA(SEQ ID NO.10).

[0090] The 5' left and right target guide sequences of hFUS-R495X-gsnoRNA are derived from the base strand of the FUS stop mutation and do not include the CA nucleotides that pair with GU. Similarly, the 3' left and right target guide sequences are also derived from the base strand, with some cytosine (C) in the 3' left target guide sequence replaced by uracil (U) for better target recognition. A total of 6 gsnoRNAs were screened, with the following sequences: gsnoRNA1: GTGCACAT CCCCCTG ACCTGCTTTCTTTTATGTGAGTAGT GTT GAAGCCT ATGTGCTATACAAATAATTGAAGG GCCCCCT GCAGTATAACTATAAATAGTAATGCTGC AAGTCTCCTTCAGACAAAA(SEQ ID NO.11);gsnoRNA2:GTGCACAT CCCCCTG ACCTGCTTTCTTTTATGTGAGTAGTGTT GAAGCCT ATGTGCTATACAAAATAATTGAAGG GCCCCCT GCAGTATAACTATAAATAGTAATGCTGC CAAGTCT CCTTCAGACAAAA(SEQ ID NO.12);gsnoRNA3: TTCCAA CCGTTCCCCT TCAGTCCAGGGCAGCTTCCCTGTTCTGA GAAGCCTCC TTGGGACATTAAAATGGGCTAAGGG GGGCCCCT GGGTAGAAAGTTATTCTATTC GAAGCCT CCCAGCCTACAAAA(SEQ ID NO.13);gsnoRNA4: TTGGCTCTT GTTCCT GGCCAGCAGTTTGCTGAAGCTGTTGGcc CAAGTC AGGAGCCTAAAGAATTGTCTTTCTA GTATCTT TTGGCCATTTCATAACTTTGGAAATGTAATGGTCAA CAAGCT AGAAAGAAACATGA(SEQ ID NO.14);gsnoRNA5: GTGCACA GCCTCCT GACCTGCTTTCTTCTATGTGAGTAGTGTT GCCGTTTC TGTGCTATACAAATAATTGAAG GTCCCCCT GCAGTATAACTATAAATAGTAATGCTGC GAAGTT TCTTCAGACAAAA(SEQ ID NO.15);gsnoRNA6: GTGCACA GCCCCCT GACCTGCTTTCTGTTATGTGAGTAGTGTT GAAGCCTCC TGTGCTATACAAATAATTGAAG GTCCCCCT GCAGTATAACTATAAATAGTAATGCTGC GAAGCTT CTTCAGACAAAA(SEQ ID NO.16)。Supplementary Information, Product Delivery:

[0091] H1-ACA19-Hfus-R495X gsnoRNA1(NheI-XhoI):

[0092] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgGTGCACAT CCCCCTG ACCTGCTTTCTTTTATGTGAGTAGTGTT GAAGCCT ATGTGCTATACAAATAATTGAAGG GCCCCCT GCAGTATAACTATAAATAGTAATGCTGC AAGTCT CCTTCAGACAAAAttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG

[0093] H1-ACA19-Hfus-R495X gsnoRNA2(NheI-XhoI):

[0094] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgGTGCACAT CCCCCTG ACCTGCTTTCTTTTATGTGAGTAGTGTT GAAGCCT ATGTGCTATACAAATAATTGAAGG GCCCCCT GCAGTATAACTATAAATAGTAATGCTGC CAAGTCTCCTTCAGACAAAAttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG

[0095] H1-ACA36 -Hfus-R495X gsnoRNA3(NheI-XhoI):

[0096] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgTTCCAA CCGTTCCCCT TCAGTCCAGGGCAGCTTCCCTGTTCTGA GAAGCCT CC TTGGGACATTAAAATGGGCTAAGGG GGGCCCCT GGGTAGAAAGTATTATTCTATTC GAAGCCT CCCAGCCTACAAAAttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG

[0097] H1-gACA2b-Hfus-R495X gsnoRNA4(NheI-XhoI):

[0098] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgTTGGCTCTT GTTCCT GGCCAGCAGTTTGCTGAAGCTGTTGGcc CAAGTC AGGAGCCTAAAGAATTGTCTTTCTA GTATCTT TTGGCCATTTCATAACTTTGGAAATGTAATGGTCAA CAAGCT AGAAAGAAACATGAttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG

[0099] H1-gACA19-TTCT-hFUS-R495X gsnoRNA5(NheI-XhoI):

[0100] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgGTGCACA GCCTCCT GACCTGCTTTCTTCTATGTGAGTAGTGTT GCCGTTTC TGTGCTATACAAATAATTGAAG GTCCCCCT GCAGTATAACTATAAATAGTAATGCTGC GAAGTT TCTTCAGACAAAAttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG

[0101] H1-gACA19-TGTT-hFUS-R495X gsnoRNA6(NheI-XhoI):

[0102] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacagggg agtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgGTGCACA GCCCCCT GACCTGCTTTCTGTTATGTGAGTAGTGTT GAAGCCTC C TGTGCTATACAAATAATTGAAG GTCCCCCT GCAGTATAACTATAAATAGTAATGCTGC GAAGCTT CTTCAGACAAAAttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG

[0103] Subsequently, we screened 18 combinations, such as X1+gsnoRNA1-6, X2+gsnoRNA-1-6, and X3+gsnoRNA1-6. Ultimately, we determined that Sup-tRNA-X1+gsnoRNA6 (X1+g6) significantly improved the specific readthrough of the pathogenic hFUS-R495X mutation, while not improving readthrough of mCherry-R41X (…). Figure 8 These results indicate that X1+g6 can selectively read hFUS-R495X without adversely affecting the natural stop codon.

[0104] In summary, through engineered modification of Sup-tRNA, we found that Sup-tRNA-X1+gsnoRNA6 can bind to the dual-target pathogenic nonsense mutation sequence of gsnoRNA, which improves mutation readthrough efficiency and avoids off-target readthrough.

[0105] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. A sup-tRNA, characterized in that, The Sup-tRNA is selected from any of the sequences shown in SEQ ID NO. 1-2; or sequences that have at least 80% identity with any of the sequences shown in SEQ ID NO. 1-2.

2. A gsnoRNA, characterized in that, The gsnoRNA comprises a backbone sequence and a guide sequence for hybridization with a sequence containing a target uridine residue in the target RNA. Preferably, the backbone sequence is derived from the following H / ACA-snoRNAs: ACA19, ACA36, ACA2b, ACA19-TTCT, and ACA19-TGTT; Preferably, the guiding sequence is located within the hairpin structure of the skeleton sequence; Preferably, the gsnoRNA is selected from any one of the sequences shown in SEQ ID NO. 6-10; or a sequence that has at least 80% identity with any one of the sequences shown in SEQ ID NO. 6-10.

3. An editing system that specifically targets nonsense mutations, characterized in that, The editing system includes the modified Sup-tRNA and the gsnoRNA of claim 2; The modified Sup-tRNA is selected from any of the sequences shown in SEQ ID NO. 3-5, or sequences that have at least 80% identity with any of the sequences shown in SEQ ID NO. 3-5.

4. The editing system according to claim 3, characterized in that, The editing system includes a combination of any one of SEQ ID NO.3 and SEQ ID NO.6-10; Preferably, the editing system is selected from a combination of SEQ ID NO.3 and SEQ ID NO.

10.

5. A recombinant vector, characterized in that, The recombinant vector comprises the Sup-tRNA of claim 1, the gsnoRNA of claim 2, or the editing system of any one of claims 3-4; Preferably, the recombinant vector is selected from adeno-associated virus vectors; Preferably, the adeno-associated virus vector is selected from any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, and AAVrh74.

6. A host cell, characterized in that, The host cell includes the Sup-tRNA of claim 1, the gsnoRNA of claim 2, the editing system of any one of claims 3-4, or the recombinant vector of claim 5; Preferably, the host cell includes prokaryotic cells and eukaryotic cells.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the Sup-tRNA of claim 1, the gsnoRNA of claim 2, the editing system of any one of claims 3-4, the recombinant vector of claim 5, or the host cell of claim 6; Preferably, the pharmaceutical composition further includes a pharmaceutically acceptable carrier and / or excipients.

8. A method for editing target RNA in cells, characterized in that, The method includes introducing the Sup-tRNA of claim 1, the gsnoRNA of claim 2, the editing system of any one of claims 3-4, or the recombinant vector of claim 5 into cells containing target RNA.

9. The use of the Sup-tRNA of claim 1, the gsnoRNA of claim 2, the editing system of any one of claims 3-4, the recombinant vector of claim 5, the host cell of claim 6, or the pharmaceutical composition of claim 7 in the preparation of a medicament for treating diseases caused by nonsense mutations.

10. The application according to claim 9, characterized in that, The diseases mentioned include: amyotrophic lateral sclerosis (ALS), cystic fibrosis, Heller syndrome, alpha-1 antitrypsin deficiency, Parkinson's disease, Alzheimer's disease, albinism, asthma, thalassemia 8, Cadasil syndrome, Shaco-Malley-Duss disease, chronic obstructive pulmonary disease, distal spinal muscular atrophy, Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, Leiden factor 5 related diseases, familial adenomatous polyposis, galactosemia, Gaucher's disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Huntington's disease, and inflammatory bowel disease. Diseases including IBD, hereditary polyagglutination syndrome, Leber congenital amaurosis, Leber-Ney's syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy of types I and II, neurofibromatosis, Niemann-Pick II disease of types A, B and C, NY-esol-related cancers, Boytz-Yage syndrome, phenylketonuria, Pompe disease, primary ciliary body disease, pulmonary hypertension, Sandhoff disease, severe complex immunodeficiency syndrome, sickle cell anemia, spinal muscular atrophy, Sturgeon's disease, Ty-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturgeon-Weber syndrome, and cancer; Preferably, the disease is selected from amyotrophic lateral sclerosis (ALS).

Images