Application of serum MSTN (myostatin) as marker in preparation of metabolism-related steatohepatitis diagnosis product
By using serum myostatin (MSTN) as a non-invasive diagnostic marker, combined with ALT or AST, the problem of low MASH diagnostic rate has been solved, achieving higher diagnostic accuracy and lower missed diagnosis rate, especially with significant advantages in patients with normal ALT or AST.
Patent Information
- Application Number
- CN202511503349.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-21
- Publication Date
- 2026-02-03
AI Technical Summary
In existing technologies, the diagnostic rate of metabolic-associated steatohepatitis (MASH) is low, and the accuracy of invasive liver biopsy or non-invasive diagnostic models is limited, making it difficult to meet the needs of dynamic monitoring of disease progression.
Serum myostatin (MSTN) was used as a novel non-invasive diagnostic biomarker. MSTN expression levels were detected by ELISA kits or chemiluminescence platforms, and combined with ALT or AST for joint diagnosis.
It significantly improved the diagnostic efficacy of MASH, reduced the rate of missed diagnoses and misdiagnoses, and showed higher diagnostic accuracy, especially in patients with normal ALT or AST. It also improved the positive predictive value (PPV) and specificity, and reduced unnecessary invasive examinations.
Smart Images

Figure CN121454064A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biomedical detection, and particularly relates to application of serum MSTN as a marker in preparation of a metabolic dysfunction-associated steatohepatitis diagnosis product. BACKGROUND
[0002] Due to changes in living habits and dietary structure, metabolic dysfunction-associated fatty liver disease (MAFLD) has become one of the most common chronic liver diseases in China, and the prevalence rate is showing a rising trend year by year. Metabolic dysfunction-associated steatohepatitis (MASH) is a progressive subtype of MAFLD, characterized by lobular inflammation, hepatocyte ballooning and varying degrees of fibrosis. Without effective management, 25% of MAFLD patients will gradually progress from simple hepatic steatosis to MASH, and MASH is the most important factor affecting the liver-related adverse prognosis (liver cirrhosis / liver cancer malignancy) of patients. However, the current MASH diagnosis rate is low and the severity of the disease is often underestimated, resulting in an increasing public health burden.
[0003] At present, liver biopsy is still the gold standard for diagnosing MASH and assessing its severity, and the key histological features include the degree of steatosis, lobular inflammation, hepatocyte ballooning and fibrosis. However, liver biopsy has inherent limitations such as sampling error, intra / inter-observer differences and invasiveness, which not only limit its application in clinical routine, but also make it difficult to meet the needs of dynamic monitoring of disease progression.
[0004] Noninvasive diagnostic biomarkers for MASH core pathological features (especially hepatocyte ballooning) are still in short supply. The sensitivity and specificity of commonly used serological indicators (such as transaminase) are insufficient (Li J, et al. Diagnosis and assessment of disease severity in patients with nonalcoholic fatty liver disease. United European Gastroenterol J, 2024, 12(2): 219-225). Although CK-18 fragment detection in blood has some value in predicting histological MASH and severity, its diagnostic performance is still insufficient to support routine clinical application (Tada T, et al. Predictive value of cytokeratin-18 fragment levels for diagnosing steatohepatitis in patients with nonalcoholic fatty liver disease. Eur J Gastroenterol Hepatol, 2021, 33(11): 1451-1458).
[0005] Therefore, in order to improve the early diagnosis rate of MASH and reduce missed diagnosis and misdiagnosis, it is urgent to develop new, more sensitive and specific noninvasive diagnostic markers. This not only helps to take timely intervention measures and delay disease progression, but also significantly improves patient prognosis and quality of life. SUMMARY
[0006] The purpose of the present application is to provide a serum MSTN as a marker for preparing a metabolic-related steatohepatitis diagnostic product in view of the current situation that MASH diagnosis relies on invasive liver biopsy or noninvasive diagnostic model performance.
[0007] The present application takes serum myostatin (MSTN) as a new noninvasive diagnostic marker to solve the problems of high risk of trauma, limited accuracy and the like in the prior art.
[0008] Technical scheme: The purpose of the present application is achieved by the following technical scheme: The present application provides a biomarker for noninvasive diagnosis of metabolic-related steatohepatitis, which is serum myostatin MSTN.
[0009] MSTN nucleotide sequence (SEQ ID NO. 1): 1 agattcactg gtgtggcaag ttgtctctca gactgtacat gcattaaaat tttgcttggc 61 attactcaaa agcaaaagaa aagtaaaagg aagaaacaag aacaagaaaa aagattatat 121 tgattttaaa atcatgcaaa aactgcaact ctgtgtttat atttacctgt ttatgctgat 181 tgttgctggt ccagtggatc taaatgagaa cagtgagcaa aaagaaaatg tggaaaaaga 241 ggggctgtgt aatgcatgta cttggagaca aaacactaaa tcttcaagaa tagaagccat 301 taagatacaa atcctcagta aacttcgtct ggaaacagct cctaacatca gcaaagatgt 361 tataagacaa cttttaccca aagctcctcc actccgggaa ctgattgatc agtatgatgt 421 ccagagggat gacagcagcg atggctcttt ggaagatgac gattatcacg ctacaacgga 481 aacaatcatt accatgccta cagagtctga ttttctaatg caagtggatg gaaaacccaa 541 atgttgcttc tttaaattta gctctaaaat acaatacaat aaagtagtaa aggcccaact 601 atggatatat ttgagacccg tcgagactcc tacaacagtg tttgtgcaaa tcctgagact 661 catcaaacct atgaaagacg gtacaaggta tactggaatc cgatctctga aacttgacat 721 gaacccaggc actggtattt ggcagagcat tgatgtgaag acagtgttgc aaaattggct 781 caaacaacct gaatccaact taggcattga aataaaagct ttagatgaga atggtcatga 841 tcttgctgta accttcccag gaccaggaga agatgggctg aatccgtttt tagaggtcaa 901 ggtaacagac acaccaaaaa gatccagaag ggattttggt cttgactgtg atgagcactc 961 aacagaatca cgatgctgtc gttaccctct aactgtggat tttgaagctt ttggatggga 1021 ttggattatc gctcctaaaa gatataaggc caattactgc tctggagagtgtgaatttgt 1081 atttttacaa aaatatcctc atactcatct ggtacaccaa gcaaaccccagaggttcagc 1141 aggcccttgc tgtactccca caaagatgtc tccaattaat atgctatattttaatggcaa 1201 agaacaaata atatatggga aaattccagc gatggtagta gaccgctgtgggtgctcatg 1261 agatttatat taagcgttca taacttccta aaacatggaa ggttttcccctcaacaattt 1321 tgaagctgtg aaattaagta ccacaggcta taggcctaga gtatgctacagtcacttaag 1381 cataagctac agtatgtaaa ctaaaagggg gaatatatgc aatggttggcatttaaccat 1441 ccaaacaaat catacaagaa agttttatga tttccagagt ttttgagctagaaggagatc 1501 aaattacatt tatgttccta tatattacaa catcggcgag gaaatgaaagcgattctcct 1561 tgagttctga tgaattaaag gagtatgctt taaagtctat ttctttaaagttttgtttaa 1621 tatttacaga aaaatccaca tacagtattg gtaaaatgca ggattgttatataccatcat 1681 tcgaatcatc cttaaacact tgaatttata ttgtatggta gtatacttggtaagataaaa 1741 ttccacaaaa atagggatgg tgcagcatat gcaatttcca ttcctattataattgacaca 1801 gtacattaac aatccatgcc aacggtgcta atacgatagg ctgaatgtctgaggctacca 1861 ggtttatcac ataaaaaaca ttcagtaaaa tagtaagttt ctcttttcttcaggtgcatt 1921 ttcctacacc tccaaatgag gaatggattt tctttaatgt aagaagaatcatttttctag 1981 aggttggctt tcaattctgt agcatactlg gagaaactgc attatcttaaaaggcagtca 2041 aatggtgttt gtttttatca aaatgtcaaa ataacatact tggagaagtatgtaattttg 2101 tctttggaaa attacaacac tgcctttgca acactgcagt ttttatggtaaaataataga 2161 aatgatcgac tctatcaata ttgtataaaa agactgaaac aatgcatttatataatatgt 2221 atacaatatt gttttgtaaa taagtgtctc cttttttatt tactttggtatatttttaca 2281 ctaaggacat ttcaaattaa gtactaaggc acaaagacat gtcatgcatcacagaaaagc 2341 aactacttat atttcagagc aaattagcag attaaatagt ggtcttaaaactccatatgt 2401 taatgattag atggttatat tacaatcatt ttatattttt ttacatgattaacattcact 2461 tatggattca tgatggctgt ataaagtgaa tttgaaattt caatggtttactgtcattgt 2521 gtttaaatct caacgttcca ttattttaat acttgcaaaa acattactaagtataccaaa 2581 ataattgact ctattatctg aaatgaagaa taaactgatg ctatctcaacaataactgtt 2641 acttttattt tataatttga taatgaatat atttctgcat ttatttacttctgttttgta 2701 aattgggatt ttgttaatca aatttattgt actatgacta aatgaaattatttcttacat 2761 ctaatttgta gaaacagtat aagttatatt aaagtgtttt cacatttttt tgaaagaca MSTN amino acid sequence (SEQ ID NO. 2): 1 mqklqlcvyi ylfmlivagp vdlnenseqk envekeglcn actwrqntks srieaikiqi 61 lsklrletap niskdvirql lpkapplrel idqydvqrdd ssdgsleddd yhattetiit 121 mptesdflmq vdgkpkccff kfsskiqynk vvkaqlwiyl rpvetpttvf vqilrlikpm 181 kdgtrytgir slkldmnpgt giwqsidvkt vlqnwlkqpe snlgieikal denghdlavt 241 fpgpgedgln pflevkvtdt pkrsrrdfgl dcdehstesr ccrypltvdf eafgwdwiia 301 pkrykanycs gecefvflqk yphthlvhqa nprgsagpcc tptkmspinm lyfngkeqii 361 ygkipamvvd rcgcs。
[0010] The application also provides application of the biomarker MSTN as a detection target in preparation of a non-invasive diagnosis product for metabolic-related steatohepatitis.
[0011] The MSTN is used as an independent biomarker.
[0012] The application researches and finds that, compared with glutamic-pyruvic transaminase ALT and glutamic-oxaloacetic transaminase AST, the MSTN ensures that the positive predictive value PPV is greater than 80% while the misdiagnosis rate is reduced to the maximum, and helps to more comprehensively identify MASH patients.
[0013] The application also provides application of a reagent for detecting expression level of serum myostatin MSTN in preparation of a non-invasive diagnosis product for metabolic-related steatohepatitis.
[0014] The product takes a blood sample of a patient to be detected as a detection sample.
[0015] The product comprises a reagent or a kit.
[0016] The product can be an ELISA kit or an in-vitro diagnosis kit based on a chemiluminescence platform.
[0017] The present invention also provides a kit for the non-invasive diagnosis of metabolic-associated steatohepatitis, which includes a reagent for detecting serum myostatin (MSTN) protein levels.
[0018] The present invention also provides a reagent for non-invasive diagnosis of metabolic-related steatohepatitis, which includes reagents for enzyme-linked immunosorbent assay (ELISA), reagents for immunoblotting, reagents for immunoprecipitation analysis, reagents for quality analysis, or reagents for protein microarrays.
[0019] This invention also provides the application of MSTN in combination with ALT or AST as biomarkers in the preparation of non-invasive diagnostic products for metabolic-related steatohepatitis.
[0020] This invention has found that combining MSTN with ALT or AST can improve the specificity and positive predictive value (PPV) of ALT or AST alone, and reduce their misdiagnosis rate.
[0021] Beneficial effects: (1) This invention validates the use of MSTN as a biomarker in the non-invasive diagnosis of metabolic-associated steatohepatitis (MAH), and demonstrates higher diagnostic efficacy in patients with normal AST levels: its AUC reached 0.808 (sensitivity 88.9%, specificity 72.7%), significantly higher than the AUC of 0.673 (sensitivity 77.3%, specificity 57.1%) in patients with abnormal AST levels. Fatty liver patients with normal transaminase levels are generally considered to have a lower risk of disease progression or be in an earlier stage. However, a considerable proportion of these patients still have MASH, and traditional liver enzyme (ALT / AST) testing has a significant diagnostic blind spot for these patients. This invention confirms that MSTN has excellent diagnostic capabilities in this specific population, effectively identifying MASH patients missed by routine liver enzyme testing, and significantly reducing the risk of missed diagnosis.
[0022] (2) The present invention combines MSTN with ALT or AST, which can improve the specificity and positive predictive value (PPV) of ALT or AST alone and reduce its misdiagnosis rate, helping to more accurately exclude non-MASH patients and reduce unnecessary, invasive or expensive follow-up examinations. Attached Figure Description
[0023] Figure 1 MSTN expression is increased in MASH patients and is positively correlated with disease severity; among them, Figure 1 A represents the increase in MSTN levels as disease severity increases; Figure 1 B represents the expression level of MSTN in different lobular inflammation grades; Figure 1 C represents the expression level of MSTN in different grades of fatty degeneration; Figure 1 D represents the expression level of MSTN in different balloon-like variability classifications;Figure 1 E represents the correlation between MSTN and age, BMI, ALT, AST, FBG, TC, TG, NAS, fatty degeneration, ballooning degeneration, and lobular inflammation; Figure 2 ROC curve for MSTN diagnosis of MASH; Figure 3 The ROC curve for MASH was diagnosed using stratified analysis based on ALT and AST levels for the continuous variable MSTN; among which, Figure 3 A represents the ROC curve of MSTN in diagnosing MASH in patients with normal ALT (<40 U / L) and abnormal ALT (≥40 U / L); Figure 3 B is the ROC curve of MSTN in diagnosing MASH in patients with normal AST (<40 U / L) and abnormal AST (≥40 U / L); Figure 4 ROC curve for diagnosing MASH after converting MSTN, ALT, and AST into categorical variables; Figure 5 The ROC curve for MASH was diagnosed using stratified analysis based on ALT and AST levels for the categorical variable MSTN; among which, Figure 5 A represents the ROC curve for the categorical variable MSTN in diagnosing MASH in patients with normal ALT (<40 U / L) and abnormal ALT (≥40 U / L); Figure 5 B represents the ROC curve of MSTN, a categorical variable, in diagnosing MASH in patients with normal AST (<40 U / L) and abnormal AST (≥40 U / L). Detailed Implementation
[0024] The technical solution of the present invention will be described in detail below through specific embodiments, but the scope of protection of the present invention is not limited to the embodiments described.
[0025] Unless otherwise specified, the instruments, reagents, and materials involved in the following embodiments are all conventional instruments, reagents, and materials that are already available in the prior art and can be obtained through legitimate commercial channels.
[0026] Unless otherwise specified, the experimental methods and detection methods involved in the following embodiments are all conventional experimental methods and detection methods that already exist in the prior art.
[0027] Example 1: Collection of Samples and Clinical Information This study included 62 patients with MAFLD who underwent liver biopsy and had serum samples collected at Nanjing Drum Tower Hospital between January 2021 and October 2024. Among them, 41 (66.1%) were male, with a mean age of 41.0 ± 14.0 years. Simultaneously, 22 healthy individuals with matched baseline characteristics were recruited as a control group. Baseline data are detailed in Table 1.
[0028] Table 1. Baseline characteristics of healthy controls and patients with fatty liver
[0029] Example 2: Detection of serum MSTN expression levels in patients using an ELISA kit. This invention uses an ELISA kit to detect the expression level of serum MSTN in each group (healthy control group and MAFLD group) in Example 1. The experimental methods were strictly performed according to the kit instructions.
[0030] The ELISA kit was purchased from R&D Systems, Minneapolis, Minnesota, USA, catalog number DGDF80.
[0031] 10N Sodium Hydroxide (NaOH): Dissolve 4g of sodium hydroxide granules in 9ml of water. After the sodium hydroxide is completely dissolved, dilute with water to 10ml.
[0032] 1 N HCl (10 ml): Slowly add 0.833 ml of 12 N HCl to 9.167 ml of dd water and mix well.
[0033] 1.2 N NaOH / 0.5 M HEPES (10 ml): Slowly add 1.2 ml of 10 N NaOH to 7.5 ml of dd water, mix well, add 1.19 g of HEPES, mix well, and finally set the total volume to 10 ml. Use dd water to maintain the pH of the acidification and neutralization reagent at 7.2-7.6.
[0034] Detection method: 1. Activate the sample: (1) Add 25 μL of 1 N HCl to 50 μL of sample, mix well, and incubate at room temperature for 10 min; (2) Add 25 μL of 1.2 N NaOH / 0.5 M HEPES and mix well; (3) Add 100ul of Calibrator Diluent RD5-26 (diluted 1:4), mix well, and test within 2 hours (the final dilution factor is 1:4). The concentration read on the standard curve must be multiplied by the appropriate dilution factor.
[0035] 2. Reagent preparation (1) All reagents were brought to room temperature; (2) Add 20 ml of Wash Buffer to 480 ml of dd water to obtain 500 ml of Wash Buffer; (3) Substrate solution: Mix reagent A and reagent B in equal volumes within 15 minutes before use, protect from light, and add 200 μL to each well; (4) Add 20ml of Calibrator Diluent RD5-26 to 60ml of dd water to obtain 80ml of Calibrator Diluent RD5-26 (diluted 1:4); (5) Standards: GDF-8 standard was prepared with dd water to obtain a stock solution of 20,000 pg / mL. The stock solution was then serially diluted with CalibratorDiluent RD5-26 (diluted 1:4) solution to obtain standard solutions of 2000, 1000, 500, 250, 125, 62.5 and 31.3 pg / mL, respectively.
[0036] 3. Experimental steps: (1) Place all reagents and samples at room temperature before use.
[0037] (2) Prepare reagents, standards and samples according to the above steps.
[0038] (3) Seal the excess perforated plate and place it at 4°C.
[0039] (4) Add 50ul Assay Diluent RD1-17 to each well.
[0040] (5) Add 50 μL of standard, control or sample to each well. Cover with the provided adhesive tape. Incubate at room temperature on a horizontal track microplate shaker (0.12" orbit) at 500 ± 50 rpm for 2 hours.
[0041] (6) Aspirate from each well and wash, repeating this process three times for a total of four washes. Fill each well with washing buffer (200 μL). After the last wash, remove any remaining washing buffer by aspiration or by inverting the plate. Invert the plate and blot dry with a clean paper towel.
[0042] (7) Add 200 μL of GDF-8 Conjugate to each well. Cover with a new strip of adhesive tape. Incubate on a shaker at room temperature for 2 hours.
[0043] (8) Repeat step (6).
[0044] (9) Add 200 μL of Substrate Solution to each well. Incubate at room temperature on a workbench for 30 minutes. Protect from light.
[0045] (10) Add 50 μL of Stop Solution to each well. The color in the well should change from blue to yellow. If the color in the well is green or the color change is uneven, tap the plate lightly to ensure thorough mixing.
[0046] (11) Measure the optical density of each well within 30 minutes using a wavelength of 450 nm.
[0047] Table 2 shows the serum MSTN levels in healthy controls and MAFLD patients with different disease severities as measured by ELISA. Based on liver biopsy results, MAFLD patients were grouped using the Nonalcoholic Fatty Liver Disease Activity Score (NAS): NAS < 4 was diagnosed as simple hepatic steatosis, and NAS ≥ 4 was diagnosed as MASH. A total of 39 patients were diagnosed with MASH, accounting for 62.9% of all patients. The serum MSTN levels in healthy controls, simple hepatic steatosis, and the MASH group were 2.09 ± 0.65, 2.37 ± 1.08, and 2.70 ± 0.98 ng / ml, respectively, showing a gradually increasing trend. Figure 1 A). Further grouping analysis based on the pathological features of MAFLD (including fatty degeneration, lobular inflammation, and ballooning degeneration) revealed that serum MSTN levels increased accordingly with increasing severity of lobular inflammation. Figure 1 B- Figure 1 D). Correlation analysis showed that serum MSTN levels were positively correlated with both ALT and the degree of liver lobular inflammation. Figure 1 E).
[0048] Table 2. MSTN expression levels in healthy controls and MAFLD patients with different disease severities (NAS < 4 or NAS ≥ 4)
[0049] Example 3: Evaluation of the diagnostic efficacy of serum MSTN, ALT, AST, and their combinations ROC curves for the diagnosis of MASH using MSTN, ALT, AST and their combinations were plotted using Medcalc software. The area under the curve (AUC) was calculated, along with the optimal cutoff value, sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), misdiagnosis rate (1-specificity), and missed diagnosis rate (1-sensitivity) for MSTN in diagnosing MASH.
[0050] The specific implementation steps are as follows: (1) Import data through File; (2) Select Statistics—ROCcurves—ROC curve analysis in the tab bar; (3) Select the research variable and the outcome variable in the dialog box.
[0051] As continuous variables, in MAFLD patients, the AUCs for MSTN, ALT, AST, and their combinations in diagnosing MASH were 0.742, 0.724, 0.739, 0.761, and 0.792, respectively. The AUC for MSTN alone in diagnosing MASH was higher than that for ALT and AST, and the AUC for MSTN combined with ALT or AST in diagnosing MASH was higher than that of either indicator used alone. Figure 2 According to baseline ALT ( Figure 3 A) and AST Figure 3 B) Whether the levels are normal or not: Patients were divided into two groups: ALT < 40 U / L, ALT ≥ 40 U / L and AST < 40 U / L, AST ≥ 40 U / L. In patients with normal transaminase levels (ALT < 40 U / L or AST < 40 U / L), the diagnostic performance of MSTN was significantly better than that of patients with abnormal transaminase levels (ALT ≥ 40 U / L or AST ≥ 40 U / L).
[0052] According to the Youden index, the optimal cutoff value for MSTN in diagnosing MASH is 1.87 ng / ml. The Youden index is a comprehensive evaluation index for diagnostic tests, combining the characteristics of both sensitivity and specificity. The calculation formula is: Sensitivity + Specificity - 1, with a value ranging from 0 to 1, and the higher the value, the better.
[0053] The Youden index is often used to confirm the optimal threshold for diagnostic indicators using ROC curves. Based on this cutoff value, as well as clinically common cutoff values for ALT and AST (ALT > 40 U / L, AST > 40 U / L), each indicator is converted into a categorical variable (positive results indicate high risk of MASH). In assessing the diagnostic efficacy of MASH, the MSTN showed the best sensitivity (84.2%), negative predictive value (NPV, 66.7%), and AUC (0.733). It also had the lowest false negative rate (see [link to relevant documentation]). Figure 4 (Table 3).
[0054] This invention combines MSTN with ALT or AST, which can improve the specificity and positive predictive value (PPV) of ALT or AST alone and reduce their misdiagnosis rate. Experimental data are shown in Table 3. The combined diagnostic strategy helps to more accurately exclude non-MASH patients and reduce unnecessary, invasive, or expensive follow-up examinations.
[0055] Based on the patient's baseline ALT ( Figure 5 A) and ASTFigure 5 B) Subgroup analysis was performed to determine whether the AST levels were normal. The results are shown in Table 4. The results showed that in the subgroup of patients with normal AST, MSTN demonstrated higher diagnostic efficacy: its sensitivity (88.9 vs 77.3), specificity (72.7 vs 57.1), and AUC (0.808 vs 0.673) were all significantly better than those of patients with abnormal AST.
[0056] Table 3. Comparison of the diagnostic accuracy of MSTN, ALT, and AST alone and in combination for MASH.
[0057] Table 4. Subgroup analysis based on ALT / AST levels comparing the efficacy of MSTN in diagnosing MASH.
[0058] Fatty liver patients with normal transaminase levels are generally considered to have a lower risk of disease progression or are in an earlier stage. However, a significant proportion of these patients still have MASH (malignant atherosclerotic liver disease), and traditional liver enzyme (ALT / AST) testing has a significant diagnostic blind spot for these patients. This study demonstrates that MSTN (monotropic liver enzyme) has excellent diagnostic capabilities in this specific population, effectively identifying MASH patients missed by routine liver enzyme testing and significantly reducing the risk of missed diagnosis.
[0059] As described above, although the invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the invention itself. Various changes in form and detail may be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. A biomarker for non-invasive diagnosis of metabolic-related steatohepatitis, characterized in that, The biomarker is serum myostatin (MSTN).
2. The application of the biomarker MSTN as described in claim 1 as a detection target in the preparation of non-invasive diagnostic products for metabolic-related steatohepatitis.
3. The application according to claim 2, characterized in that, MSTN is used as an independent biomarker.
4. Application of reagents for detecting serum myostatin (MSTN) expression levels in the preparation of non-invasive diagnostic products for metabolism-related steatohepatitis.
5. The application according to claim 2 or 4, characterized in that, The product uses blood samples from the patients to be tested as the test samples.
6. The application according to claim 2 or 4, characterized in that, The products include reagents or kits.
7. A kit for non-invasive diagnosis of metabolic-associated steatohepatitis, characterized in that, It includes reagents for detecting serum myostatin (MSTN) protein levels.
8. A reagent for the non-invasive diagnosis of metabolic-related steatohepatitis, characterized in that, These include reagents for enzyme-linked immunosorbent assay (ELISA), reagents for immunoblotting, reagents for immunoprecipitation analysis, reagents for quality analysis, or reagents for protein microarrays.
9. Application of MSTN in combination with ALT or AST as biomarkers in the preparation of non-invasive diagnostic products for metabolic-related steatohepatitis.