Kit and method for detecting human vascular endothelial growth factor 165

By using computer-aided screening of highly specific nucleic acid aptamers and optimizing the detection system, the problems of high cost and insufficient specificity of ELISA and existing nucleic acid aptamer detection have been solved, realizing low-cost and high-sensitivity detection of VEGF165, which is suitable for early tumor diagnosis.

CN121454073APending Publication Date: 2026-02-03THE SECOND XIANGYA HOSPITAL OF CENT SOUTH UNIV +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511635635.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-10
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

Existing ELISA detection methods suffer from high antibody costs and poor stability, as well as insufficient aptamer affinity and inadequate detection specificity in existing nucleic acid aptamer detection methods, especially for the detection of VEGF165.

Method used

Computer-aided screening of highly specific nucleic acid aptamers was employed, combined with an optimized detection system, and VEGF165 was detected using the ELISA method. Biotin-modified nucleic acid aptamers specifically bind to VEGF165, and horseradish peroxidase-labeled streptavidin is used for signal amplification.

Benefits of technology

It achieves low-cost, high-sensitivity, and high-specificity VEGF165 detection, suitable for screening and diagnosis of early-stage cancer patients. The test results have good accuracy and repeatability, the reagent kit has an extended shelf life, and the cost is reduced by more than 40%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121454073A_ABST
    Figure CN121454073A_ABST
Patent Text Reader

Abstract

The invention discloses a kit and a method for detecting a human vascular endothelial growth factor 165. The kit comprises an elisa plate, a capture antibody, a detection probe, a VEGF165 standard substance, HRP (horse radish peroxidase) labeled streptavidin and various buffer solutions, wherein the detection probe is a biotin-modified nucleic acid aptamer. According to the method, an enzyme-linked nucleic acid aptamer adsorption test (ELASA) is adopted, and quantitative analysis is realized through the steps of coating, closing, antigen binding, aptamer binding, signal amplification, chromogenic detection and the like in a sandwich mode of'capturing antibody-VEGF165-nucleic acid aptamer '. According to the invention, a high-specificity nucleic acid aptamer screened in a computer-aided manner is used for replacing a traditional antibody, the detection specificity is strong, the intra-batch variation coefficient is less than 5%, the inter-batch variation coefficient is less than 8%, and the kit has the advantages of low cost, high sensitivity, strong stability and wide clinical applicability, and can be used for diagnosis and prognosis evaluation of VEGF165 related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a kit and method for detecting human vascular endothelial growth factor 165. BACKGROUND

[0002] Vascular endothelial growth factor (VEGF) is a very important signal protein in the human body, and its main function is to stimulate the generation of new blood vessels. VEGF is not a single molecule, but a protein family, mainly including VEGF-A (usually referred to as VEGF), VEGF-B, VEGF-C, VEGF-D, VEGF-E and placental growth factor (PIGF). VEGF-A plays a dominant role in regulating angiogenesis and diseases, and it has multiple splice variants, mainly including VEGF121, VEGF165, VEGF189 and VEGF206, which have different biological activities. VEGF165 is the most important splice variant of VEGF-A gene, and is also the most abundant and most core bioactive form of vascular endothelial growth factor in the human body. It plays a key role in physiological angiogenesis and the pathological process of various diseases (especially cancer and ocular neovascular diseases). VEGF165 is the main subtype leading to the development and metastasis of most human cancers. VEGF-A is secreted by various cell types, including cancer cells, affecting the survival and growth of endothelial cells. Overexpression of VEGF may indicate the presence of angiogenic diseases, so the detection of VEGF-A is of great significance for the early screening, monitoring and prognosis of tumor patients.

[0003] The mainstream method for detecting VEGF165 in human serum in the clinic at present is enzyme-linked immunosorbent assay (ELISA), which realizes quantification through the sandwich mode of "capture antibody-target antigen-detection antibody", but has inherent defects: first, the detection antibody depends on animal immunization preparation, with high production cost, large batch difference, and easy denaturation and inactivation under high temperature conditions, making it difficult to be reused; second, the antibody has large molecular weight and poor penetration, and is easily interfered by non-specific proteins when complex serum samples are targeted, resulting in insufficient sensitivity and specificity; third, the antibody has strong immunogenicity, which may cause cross-reactions in the detection system in long-term batch detection, affecting the reliability of the results.

[0004] Aptamer, as a single-stranded DNA / RNA molecule screened by SELEX, has the characteristics of "chemical antibodies" and can bind to target proteins with high affinity and high specificity. Compared with traditional antibodies, it has the following advantages: chemical synthesis can realize mass production, and the cost is reduced by more than 40%; the molecular weight is only 1 / 50~1 / 10 of that of traditional antibodies, the penetration is strong, and the immunogenicity is extremely low; after denaturation by high temperature, the functional conformation can be restored by renaturation, and it has reproducibility; it is easy to modify functional modules such as biotin and fluorescent groups, and the adaptability is wider.

[0005] At present, the closest prior art is Chinese patent CN202111129222.X: VEGF recognition method based on nucleic acid aptamer probe and kit for detecting VEGF; the technology uses nucleic acid aptamer as recognition probe to construct detection system, and the screening process of the nucleic acid aptamer uses capillary electrophoresis SELEX technology. In the description of this patent, there is no specific subtype information of VEGF, so there is no nucleic acid aptamer for VEGF165 in the prior art. In addition, the aptamer screening relies on traditional in vitro SELEX technology, and does not combine computer-aided design for precise targeting optimization, which may result in weak targeting of the binding site of the aptamer to VEGF165, making it difficult to meet the detection needs of low-concentration samples; at the same time, the technology does not optimize the key parameters such as the concentration of aptamer in the detection system and the coating amount of capture antibody, and does not involve different subtypes of VEGF, so it cannot realize specific and accurate quantification of VEGF165.

[0006] Therefore, developing a high-specificity nucleic acid aptamer based on targeted screening, combined with a VEGF165 detection technology that optimizes the detection system, to solve the problems of insufficient aptamer affinity, low sensitivity, and poor specificity in the prior art, has become a technical bottleneck that needs to be broken through in this field. SUMMARY

[0007] In order to solve the technical problems of high cost and poor stability of antibodies in the existing ELISA detection method, and insufficient aptamer affinity and poor detection specificity in the existing nucleic acid aptamer detection, the present application provides a high-specificity nucleic acid aptamer kit based on computer-aided precise screening and a corresponding ELASA detection method, which realizes low-cost, high-sensitivity, and high-specificity detection of VEGF165 in human serum samples.

[0008] In a first aspect, the present application provides a kit for detecting human vascular endothelial growth factor 165, comprising an enzyme-labeled plate, a capture antibody, a detection probe, a VEGF165 standard, a horseradish peroxidase (HRP) labeled streptavidin, a TMB color developing solution, a TMB stopping solution, and a buffer system.

[0009] In a specific embodiment, the detection probe is a biotin-modified nucleic acid aptamer, and its nucleotide sequence is shown as SEQ ID NO. 1, GGGAGCTCAGAATAAACGCTCAAGCTTGATGGGTGACACACG TCATGCCGAGCTTCGACATGAGGCCCGGATCCGGC.

[0010] In a specific embodiment, the capture antibody is a rabbit anti-human VEGF165 monoclonal antibody.

[0011] In a specific embodiment, the VEGF165 standard is a recombinant human VEGF165 protein, and its concentration gradient is 15.63 ng / mL, 31.25 ng / mL, 62.5 ng / mL, 125 ng / mL, 250 ng / mL, 500 ng / mL, 1000 ng / mL, and 2000 ng / mL; the use concentration of the detection probe is 1000 nM; and the coating concentration of the capture antibody is 4 μg / mL.

[0012] In a specific embodiment, the buffer system comprises an antibody coating buffer, a sample diluent, a detection nucleic acid single-strand diluent, a blocking buffer, and a washing buffer; the enzyme-labeled plate is a 96-well transparent detachable high-adsorption enzyme-labeled plate; and the sample detected by the kit is a human serum sample.

[0013] In a second aspect, the present application also provides a method for detecting human vascular endothelial growth factor 165 by using the above-mentioned kit, comprising the following steps: Step 1, antibody coating: dilute the capture antibody to 4 μg / mL with an antibody coating buffer, add 100 μL per well, and incubate at 4°C for 12 h, so that the capture antibody is stably fixed on the enzyme-labeled plate well through hydrophobic interaction; Step 2, washing: discard the liquid in the well, add 300 μL of washing buffer per well, wash for 3 times, soak for 30 s each time, and pat dry after the last time; Step 3, blocking: add 300 μL of blocking buffer, incubate on a shaker at room temperature for 1 h, and block the blank sites not combined with the antibody; Step 4, antigen binding: after repeating the washing of Step 2, add 100 μL of the diluted standard and the serum sample to be detected per well, incubate at room temperature for 2 h, and make the VEGF 165 specifically combined with the capture antibody; Step 5, aptamer binding: after repeating the washing of Step 2, add 100 μL of 1000 nM biotin-modified aptamer diluted with the detection nucleic acid single-strand diluent to each well, incubate at room temperature for 1 h, and form a “capture antibody-VEGF 165-aptamer” sandwich complex; Step 6, signal amplification: after repeating the washing of Step 2, add 100 μL of 1:2000 diluted horseradish peroxidase-labeled streptavidin to each well, incubate at room temperature for 30 min, and make the streptavidin combined with the biotin on the aptamer; Step 7, color development and detection: after repeating the washing of Step 2, add 100 μL of TMB color developing liquid to each well, incubate at room temperature for 10 min in the dark; then add 100 μL of TMB termination liquid to terminate the reaction, and detect the OD value at 450 nm within 10 min by using an enzyme-labeled instrument; and Step 8, result calculation: plot a standard curve with the logarithmic value of the VEGF 165 standard concentration as the X axis and the corresponding OD value as the Y axis, and calculate the VEGF 165 concentration by substituting the OD value of the sample to be detected.

[0014] In a specific embodiment, the serum sample to be detected in Step 4 is diluted at a ratio of 1:2-10 by using the sample diluent.

[0015] Compared with the prior art, the present application has the following beneficial effects:

[0016] Firstly, the present application uses enzyme-linked aptamer sorbent assay (ELASA) to replace the traditional ELISA experiment to detect VEGF 165, and uses a computer to analyze a high-throughput library to obtain a nucleic acid aptamer specifically combined with VEGF 165 as a detection antibody to detect VEGF 165, so that a good linear curve is obtained, and a new auxiliary method is provided for the detection of VEGF in human serum.

[0017] Secondly, the nucleic acid aptamer (SEQ ID NO. 1) screened by computer simulation of the active site of VEGF165 has significantly better binding specificity to VEGF165 than the prior art.

[0018] Thirdly, the optimized ELASA method of the present application has significantly improved specificity compared with the traditional ELISA and the existing nucleic acid aptamer detection technology, and can detect the specific expression of VEGF165 in the serum of early tumor patients, thereby providing technical support for early screening and specific diagnosis of tumors.

[0019] Fourthly, the nucleic acid aptamer of the present application is produced in batches by chemical synthesis, and the cost is reduced by more than 40% compared with monoclonal antibodies; and it can be reused more than 3 times after high-temperature renaturation, and the shelf life of the kit is extended to 18 months at 4°C (the shelf life of the traditional ELISA kit is 6-12 months).

[0020] Fifthly, the optimized buffer system for serum samples of the present application can effectively inhibit non-specific adsorption, and the detection recovery rate is between 92% and 108%, the within-batch coefficient of variation is <5%, the between-batch coefficient of variation is <8%, and it fully meets the clinical detection standard. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 is a secondary structure prediction of the nucleic acid aptamer of the present application and a molecular docking diagram with VEGF165; wherein A is the stem-loop secondary structure of the nucleic acid aptamer, and B is the binding mode of the nucleic acid aptamer and the active site of VEGF165 (the dark area is the binding interface).

[0022] Figure 2 is a specificity verification result diagram of the binding of the nucleic acid aptamer of the present application and VEGF165.

[0023] Figure 3 is a capture antibody coating amount optimization result diagram of the present application.

[0024] Figure 4 is a nucleic acid aptamer use concentration optimization result diagram of the present application.

[0025] Fig. 5 is a VEGF165 standard curve diagram constructed by the present application. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the present application clearer and more apparent, the present application will be further described in detail below with reference to the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application.

[0027] Example 1 Screening and verification of VEGF165 specific nucleic acid aptamer

[0028] 1.1 Screening of aptamer:

[0029] The high-throughput sequencing library was subjected to multi-dimensional evaluation of sequence enrichment, family abundance, etc. by computer tools (using AutoDock Vina software to simulate its active site). After secondary prediction of multiple candidate aptamers (prediction of the secondary structure of each sequence in the library by mfold software) and molecular docking and dynamics simulation, one aptamer with high affinity to VEGF165 protein was screened out (as shown in Figure 1 The nucleotide sequence is shown in SEQ ID NO. 1: GGGAGCTCAGAATAAACGCTCAAGCTTGATGGGTGACACACGTCATGCCGAGCTTCGACATGAGGCCCGGATCCGGC.

[0030] 1.2 Verification of aptamer specificity:

[0031] 1) Coating: The VEGF165 protein was diluted with antibody coating buffer (0.05M carbonate buffer, pH 9.6) to 2μg / mL, 100μL per well was added to the enzyme-labeled plate, and incubated at 4℃ overnight. Set up blank group (only add antibody coating buffer), control chain group (coated protein + non-specific nucleic acid chain), and detection chain group (coated protein + aptamer), each group with 3 replicates.

[0032] 2) Blocking: Discard the liquid in the wells, wash 3 times with 300μL of washing buffer (0.05% Tween20 in PBS, pH 7.3) per well, soak for 30s each time, and tap dry after the last time. Add 300μL of PBST blocking buffer containing 2% BSA, and incubate at room temperature for 1h.

[0033] 3) Aptamer binding: Add 100μL of 1000nM biotin-modified aptamer diluted with detection nucleic acid single-strand diluent (PBS containing 5mM MgCl2) to each well, and incubate at room temperature for 1h.

[0034] 4) Signal detection: Discard the liquid in the wells, wash 3 times as in step 2); add 100μL of 1:2000 diluted HRP-labeled streptavidin to each well, and incubate at room temperature for 30min; after washing again, add 100μL of TMB developing solution to each well, and incubate at room temperature in the dark for 10min; add 100μL of TMB stop solution (2M H2SO4), mix gently, and detect the OD450nm value. The average value of 3 replicates in each group was taken as the result.

[0035] The verification results are shown in Figure 2The OD value of the blank group (coated only with buffer) was 0.1083 ± 0.0052, and the OD value of the control chain group (coated with VEGF165 protein + non-specific nucleic acid chain) was 0.1289 ± 0.0081, both of which were close in value and at a low level, indicating that only a small amount of non-specific adsorption existed; and the OD value of the detection chain group (coated with VEGF165 protein + SEQ ID NO. 1 nucleic acid aptamer) reached 1.8968 ± 0.0215, which was significantly higher than the first two groups. From the above results, it can be seen that the signal intensity of the detection chain group is much higher than that of the blank group and the control chain group, directly proving that the nucleic acid aptamer of the application can specifically bind to VEGF165, and not through non-specific action to produce a signal. Figure 2 The signal intensity of the detection chain group is much higher than that of the blank group and the control chain group, directly proving that the nucleic acid aptamer of the application can specifically bind to VEGF165, and not through non-specific action to produce a signal.

[0036] Example 2 Preparation and performance verification of VEGF165 detection kit

[0037] 2.1 Preparation of kit components

[0038] Prepare each component of the kit according to the following formula, and store it at 4°C after being divided and sealed:

[0039] 96-well enzyme-coated plates (purchased from Shengong Bioengineering Co., Ltd.): transparent detachable high-absorption polystyrene enzyme-coated plates are selected, with a adsorption capacity of ≥500 ng per well, to ensure stable fixation of the capture antibody.

[0040] Capture antibody (purchased from Sino biological inc): rabbit anti-human VEGF165 monoclonal antibody, concentration 1 mg / mL, diluted to 4 μg / mL with antibody coating buffer before use, which can achieve efficient capture of target antigens without non-specific adsorption redundancy.

[0041] Detection probe (custom synthesized by Shengong Bioengineering Co., Ltd.): biotin-modified VEGF165-specific nucleic acid aptamer, whose sequence is shown as SEQ ID NO. 1, and the optimal use concentration is 1000 nM; the nucleic acid aptamer is obtained by computer simulation of the active site of VEGF165, and has a dissociation constant Kd≤15 nM for VEGF165, and a cross-reactivity of <3% for homologous variants such as VEGF121 and VEGF189.

[0042] VEGF165 standard (purchased from Sino biological inc, item number 11066-HNAH): recombinant human VEGF165 protein, gradient diluted with sample diluent (0.1% BSA in PBS, pH 7.4) to 15.63 ng / mL, 31.25 ng / mL, 62.5 ng / mL, 125 ng / mL, 250 ng / mL, 500 ng / mL, 1000 ng / mL, 2000 ng / mL, covering the common concentration range of clinical samples, to ensure the linearity and reliability of the standard curve.

[0043] Signal amplification component (purchased from Biyun Tian Biotechnology Co., Ltd.): horseradish peroxidase (HRP) labeled streptavidin, working concentration 1:2000 dilution, specific binding efficiency with biotin modified aptamer ≥95%.

[0044] Color development and termination system (purchased from Biyun Tian Biotechnology Co., Ltd.): TMB color developing solution (0.4 mM TMB and 0.02% H2O2 in citric acid buffer), TMB termination solution (2M H2SO4), to ensure the efficiency of color development reaction and the immediacy of termination.

[0045] Buffer system (purchased from Shengong Biotechnology Co., Ltd.): including antibody coating buffer (0.05M carbonate buffer, pH 9.6), sample diluent (0.1% BSA in PBS, pH 7.4), detection nucleic acid single-strand diluent (5mM MgCl2 in PBS, to maintain the functional conformation of nucleic acid aptamer), blocking buffer (2% BSA in PBST), washing buffer (0.05% Tween20 in PBS, pH 7.3).

[0046] 2.2 Method of kit detection of VEGF165 (ELASA method):

[0047] Step S1, antibody coating: dilute the capture antibody to 4μg / mL with antibody coating buffer, add 100μL per well, incubate at 4℃ for 12h, so that the capture antibody is stably fixed on the wall of the enzyme-labeled plate hole through hydrophobic interaction.

[0048] Step S2, washing: discard the liquid in the hole, add 300μL of washing buffer per hole, wash 3 times, soak for 30s each time, and pat dry for the last time.

[0049] Step S3, blocking: add 300μL of blocking buffer, incubate at room temperature on a shaking table for 1h, to block the blank sites that do not bind antibodies.

[0050] Step S4, antigen binding: after repeating the step S2 washing, 100 μL of diluted standard and serum sample to be tested (serum sample is diluted by 1:2-1:10 with sample diluent, preferably 1:5 in this case) is added to each well, and incubated at room temperature for 2 h to allow VEGF165 to specifically bind to the capture antibody.

[0051] Step S5, nucleic acid aptamer binding: after repeating the step S2 washing, 100 μL of 1000 nM biotin-modified nucleic acid aptamer diluted with detection nucleic acid single-strand diluent is added to each well, and incubated at room temperature for 1 h to form a "capture antibody-VEGF165-aptamer" sandwich complex.

[0052] Step S6, signal amplification: after repeating the step S2 washing, 100 μL of 1:2000 diluted HRP-labeled streptavidin is added to each well, and incubated at room temperature for 30 min to allow streptavidin to bind to biotin on the nucleic acid aptamer;

[0053] Step S7, color development and detection: after repeating the step S2 washing, 100 μL of TMB color developing solution is added to each well, and incubated at room temperature in the dark for 10 min; then 100 μL of TMB stop solution is added to stop the reaction, and the OD value at 450 nm is detected within 10 min using an enzyme-labeled instrument.

[0054] Step S8, result calculation: the standard curve is plotted with the logarithmic value of the VEGF165 standard concentration as the X-axis and the corresponding OD value as the Y-axis, and the VEGF165 concentration is calculated by substituting the OD value of the sample to be tested.

[0055] In addition, cost comparison: the cost of chemical synthesis of the nucleic acid aptamer is about 60% of that of a monoclonal antibody, and the cost is reduced by more than 40% after batch production; repeatability: after denaturation at 95°C for 10 min and slow renaturation, the aptamer after binding can be repeatedly used for detection, and the signal retention rate is still > 85% after 3 consecutive uses; kit shelf life: after being stored at 4°C for 18 months, the OD value variation rate of the detection standard is < 10% (the variation rate of the traditional ELISA kit is > 20% after 6-12 months).

[0056] 2.3 Optimization of detection system:

[0057] 1) Capture antibody coating amount optimization: set a coating amount gradient of 0, 25, 50, 100, 200, 400, 600, and 800 ng / well, and detect according to the above ELASA method, and the results are as follows Figure 3As shown: when the coating amount is less than or equal to 200 ng, the OD value increases obviously with the increase of the coating amount (for example, the OD value is about 0.5 when the coating amount is 200 ng); when the coating amount is greater than or equal to 400 ng, the growth rate of the OD value slows down significantly and tends to be stable (OD = 0.7576 when the coating amount is 400 ng, and the OD values are 0.78 and 0.8289 when the coating amount is 600 ng and 800 ng, respectively). In combination with the signal intensity and cost control, 400 ng / well (corresponding to a concentration of 4 μg / mL) is selected as the optimal coating amount.

[0058] 2) Nucleic acid aptamer concentration optimization: set the aptamer concentration gradient of 100, 200, 400, 800, 1000, 2000 nM, and detect according to the ELASA method described in the application, and the results are as shown in Figure 4 As shown: with the increase of the nucleic acid aptamer concentration from 100 nM to 1000 nM, the OD value continuously increases and reaches a peak value (OD = 0.8475) at 1000 nM; when the concentration is further increased to 2000 nM, the OD value decreases (to about 0.75), which is presumably due to the decrease of the binding efficiency caused by the excessive aggregation of the aptamer. Therefore, 1000 nM is determined as the optimal use concentration of the nucleic acid aptamer.

[0059] 2.4 Standard curve construction and performance detection

[0060] Under the above optimal detection conditions, the VEGF165 standard samples with 8 concentration gradients of 15.63 ng / mL, 31.25 ng / mL, 62.5 ng / mL, 125 ng / mL, 250 ng / mL, 500 ng / mL, 1000 ng / mL and 2000 ng / mL are detected, and a standard curve is drawn with the logarithmic value (lgC) of the VEGF165 concentration as the abscissa and the corresponding OD value as the ordinate, and the results are as shown in Figure 5 As shown: the detection points corresponding to each concentration gradient in the figure are uniformly distributed near the fitting straight line, and the linear equation obtained by fitting is y = 1.2448x-1.7358, and the correlation coefficient R 2 = 0.9512, indicating that the VEGF165 concentration and the detection signal present a good linear relationship in the concentration range of 15.63 ng / mL to 2000 ng / mL.

[0061] 2.5 Verification of applicability of clinical samples:

[0062] Further verification of the clinical applicability of the kit: select a clinical serum sample with a known VEGF165 concentration of 125 ng / mL to carry out a standard addition recovery test, and the recovery rate is between 92% and 108%; the same sample is repeatedly detected for 10 times, and the batch variation coefficient is only 4.2%; the same sample is detected in batches within 20 days, and the batch variation coefficient is 7.8%; the above indexes meet the requirements of accuracy and precision of clinical detection.

[0063] The above is only an embodiment of the present application, and does not limit the patent scope of the present application, and any equivalent process transformation using the content of the present application specification, or direct or indirect application in other related technical fields, is also included in the patent protection scope of the present application.

Claims

1. A kit for detecting human vascular endothelial growth factor 165, characterized in that, It includes an ELISA plate, capture antibody, detection probe, VEGF165 standard, horseradish peroxidase-labeled streptavidin, TMB chromogenic solution, TMB stop solution, and buffer system.

2. The reagent kit according to claim 1, characterized in that, The detection probe is a biotin-modified nucleic acid aptamer, and its nucleotide sequence is shown in SEQ ID NO.1: GGGAGCTCAGAATAAACGCTCAAGCTTGATGGGT GACACACGTCATGCCGAGCTTCGACATGAGGCCCGGATCCGGC.

3. The reagent kit according to claim 2, characterized in that, The capture antibody is a rabbit anti-human VEGF165 monoclonal antibody.

4. The reagent kit according to claim 3, characterized in that, The VEGF165 standard is recombinant human VEGF165 protein, with concentration gradients of 15.63 ng / mL, 31.25 ng / mL, 62.5 ng / mL, 125 ng / mL, 250 ng / mL, 500 ng / mL, 1000 ng / mL, and 2000 ng / mL; the detection probe is used at a concentration of 1000 nM; and the capture antibody coating concentration is 4 μg / mL.

5. The reagent kit according to claim 4, characterized in that, The buffer system includes: antibody coating buffer, sample dilution buffer, detection nucleic acid single-strand dilution buffer, blocking buffer, and washing buffer; the ELISA plate is a 96-well transparent, removable, high-adsorption ELISA plate; the test sample for the kit is human serum sample.

6. A method for detecting human vascular endothelial growth factor 165 using the kit as described in claim 5, characterized in that, Includes the following steps: Step 1, Antibody Coating: Dilute the capture antibody to 4 μg / mL with antibody coating buffer, add 100 μL to each well, and incubate at 4℃ for 12 h to allow the capture antibody to be stably immobilized in the wells of the ELISA plate through hydrophobic interactions. Step 2, Washing: Discard the liquid in the wells, add 300 μL of washing buffer to each well and wash 3 times, soaking for 30 seconds each time, and pat dry on the last wash. Step 3, Blocking: Add 300 μL of blocking buffer and incubate on a shaker at room temperature for 1 hour to block the blank sites that have not bound to the antibody; Step 4, Antigen Binding: After washing in Step 2, add 100 μL of diluted standard and serum sample to be tested to each well and incubate at room temperature for 2 h to allow VEGF165 to specifically bind to the capture antibody. Step 5, Nucleic Acid Aptamer Binding: After washing in Step 2, add 100 μL of 1000 nM biotin-modified nucleic acid aptamer diluted with detection nucleic acid single-strand dilution buffer to each well and incubate at room temperature for 1 h to form a "capture antibody-VEGF165-aptamer" sandwich complex. Step 6, Signal Amplification: After washing in Step 2, add 100 μL of horseradish peroxidase-labeled streptavidin diluted 1:2000 to each well and incubate at room temperature for 30 min to allow streptavidin to bind to biotin on the nucleic acid aptamer; Step 7, color development and detection: After washing in step 2, add 100 μL of TMB color development solution to each well and incubate at room temperature in the dark for 10 min; then add 100 μL of TMB stop solution to terminate the reaction, and detect the OD value at 450 nm using a microplate reader within 10 min. Step 8: Result Calculation: Plot a standard curve with the logarithm of the VEGF165 standard concentration as the X-axis and the corresponding OD value as the Y-axis. Substitute the OD value of the sample to be tested into the curve to calculate the VEGF165 concentration.

7. The method according to claim 6, characterized in that, In step four, the serum sample to be tested is diluted with sample diluent at a ratio of 1:(2~10).

Citation Information

Patent Citations

  • VEGF recognition method based on nucleic acid aptamer probe and kit for detecting VEGF

    CN113999890B