Application of exosome blocker in treatment of sleep disorder

Abstract

The invention discloses an application of an exosome blocker in treatment of sleep disorders. It is found for the first time that after miR-24 secretory expression is inhibited, the hypoxia stress induced total sleep and daytime sleep duration reduction and sleep fragmentation phenomena are obviously improved. A new intervention strategy is provided for coping with sleep disorder caused by environmental stress, and the application prospect is wide.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the application of exosome blocking agents in the treatment of sleep disorders. Background Technology

[0002] Sleep disorders are a common health problem in humans living in high-altitude, low-oxygen environments, mainly manifested as difficulty falling asleep, reduced sleep efficiency, and decreased rapid eye movement (REM) sleep. These sleep disorders not only seriously affect an individual's physical and mental health and quality of life, but can also reduce work efficiency and even trigger other neurological or cardiovascular diseases.

[0003] Traditional methods for improving sleep disorders, such as drug therapy (sedatives and hypnotics) and oxygen therapy, have significant shortcomings, including drug dependence, significant side effects, short-lived efficacy, and inability to fundamentally address nerve damage. Therefore, there is an urgent need to develop a new treatment approach that is highly safe, has no toxic side effects, and offers significant therapeutic benefits. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, this invention provides the application of exosome blocking agents in the treatment of sleep disorders.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides the use of miR-24 blockers in the preparation of medicaments for treating sleep disorders.

[0007] Furthermore, the sleep disorder is a hypoxia-induced sleep disorder.

[0008] Furthermore, the miR-24 blocker includes one or more substances that inhibit miR-24 production, inhibit miR-24 secretion, inhibit miR-24 maturation, and prevent miR-24 from interacting with or binding to its target cells.

[0009] Furthermore, the miR-24 blocker is selected from substances that inhibit miR-24 secretion.

[0010] Furthermore, the substance that inhibits miR-24 secretion is selected from GW4869.

[0011] A second aspect of the invention provides a medicament for treating sleep disorders, the medicament comprising a miR-24 blocker.

[0012] Furthermore, the sleep disorder is a hypoxia-induced sleep disorder.

[0013] Furthermore, the miR-24 blocker includes one or more substances that inhibit miR-24 production, inhibit miR-24 secretion, inhibit miR-24 maturation, and prevent miR-24 from interacting with or binding to its target cells.

[0014] Furthermore, miR-24 blockers are selected from substances that inhibit miR-24 secretion.

[0015] Furthermore, the substance that inhibits miR-24 secretion is selected from GW4869.

[0016] Furthermore, the drug also includes pharmaceutically acceptable excipients.

[0017] A third aspect of the invention provides the use of miR-24 as a target in screening candidate drugs for the treatment of diseases caused by hypoxia stress.

[0018] Furthermore, a method for screening candidate drugs for treating diseases caused by hypoxia stress includes: treating a culture system expressing or containing the miR-24 gene or its encoded protein with a substance to be screened; and detecting the expression or activity of the miR-24 gene or its encoded protein in the system; wherein, when the substance to be screened inhibits the expression level or activity of the miR-24 gene or its encoded protein, the substance to be screened is a candidate drug for treating diseases caused by hypoxia stress.

[0019] Furthermore, the disease in question is a sleep disorder.

[0020] A fourth aspect of the present invention provides a method for screening candidate drugs for treating diseases caused by hypoxia stress, the method comprising: treating a culture system expressing or containing the miR-24 gene or its encoded protein with a substance to be screened; and detecting the expression or activity of the miR-24 gene or its encoded protein in the system; wherein, when the substance to be screened inhibits the expression level or activity of the miR-24 gene or its encoded protein, the substance to be screened is a candidate drug for treating diseases caused by hypoxia stress.

[0021] Furthermore, the disease in question is a sleep disorder.

[0022] A fifth aspect of the invention provides a method for preparing CHRNA3-reduced cells for non-therapeutic purposes, the method comprising administering a miR-24 blocker.

[0023] Furthermore, the miR-24 blocker includes one or more substances that inhibit miR-24 production, inhibit miR-24 secretion, inhibit miR-24 maturation, and prevent miR-24 from interacting with or binding to its target cells.

[0024] Furthermore, miR-24 blockers are selected from substances that inhibit miR-24 secretion.

[0025] Furthermore, the substance that inhibits miR-24 secretion is selected from GW4869.

[0026] A sixth aspect of the invention provides the use of miR-24 blockers in the preparation of CHRNA3-reduced cells for non-therapeutic purposes.

[0027] Furthermore, the miR-24 blocker includes one or more substances that inhibit miR-24 production, inhibit miR-24 secretion, inhibit miR-24 maturation, and prevent miR-24 from interacting with or binding to its target cells.

[0028] Furthermore, miR-24 blockers are selected from substances that inhibit miR-24 secretion.

[0029] Furthermore, the substance that inhibits miR-24 secretion is selected from GW4869.

[0030] The seventh aspect of the present invention provides the use of a reagent for detecting miR-24 in a sample for use in the preparation of products for diagnosing diseases caused by hypoxia stress.

[0031] Furthermore, the reagents are selected from probes that specifically recognize miR-24 and primers that specifically amplify miR-24.

[0032] Furthermore, the samples include adipose tissue, serum, hippocampus, hypothalamus, and basal forebrain.

[0033] Furthermore, the adipose tissue is selected from brown adipose tissue.

[0034] Furthermore, the disease in question is a sleep disorder.

[0035] Advantages and beneficial effects of the present invention:

[0036] This application is the first to discover that inhibiting miR-24 secretion significantly improves hypoxia-stress-induced reductions in total sleep and daytime sleep duration, as well as sleep fragmentation. This provides a novel intervention strategy for addressing sleep disorders caused by environmental stress and has broad application prospects. Attached Figure Description

[0037] Figure 1This is a graph showing the experimental results of hypoxia-induced upregulation of miR-47119-24 expression levels in brown adipose tissue exosomes and serum. 1A shows the experimental results of upregulation of miR-47119-24 expression levels in serum under hypoxia-stress conditions; 1B shows the experimental results of upregulation of miR-47119-24 expression levels in brown adipose tissue under hypoxia-stress conditions; 1C shows the experimental results of no change in miR-47119-24 expression levels in neuronal cells treated under hypoxia-stress conditions; and 1D is the ROC curve of miR-47119-24 in diagnosing hypoxia-stress.

[0038] Figure 2 This is a figure showing the experimental results of the dysrastic expression disorder of PC-5p-47119_24 induced by hypoxia stress;

[0039] Figure 3 The images show the changes in miR-47119-24 expression levels after hypoxia stress. 3A shows the changes in miR-47119-24 expression levels in various brain regions after hypoxia stress, and 3B shows the results of detecting exosome-labeled RFP signals in mouse hippocampal tissue.

[0040] Figure 4 This is an experimental result diagram showing that CHRNA3 is a potential target gene of miR-47119-24. Among them, 4A and 4B are the predicted results of the binding region of miR-47119_24 and CHRNA3. The first three brain regions in 4C are the results of the effect of hypothermia and hypoxia stress on the expression level of CHRNA3 mRNA, and the last brain region is the results of the effect of hypoxia stress on the expression level of CHRNA3 mRNA. 4D is the results of the effect of hypoxia stress on the expression level of CHRNA3 protein.

[0041] Figure 5 The diagram shows the experimental results of miR-47119-24 secreted by brown adipose tissue targeting and regulating CHRNA3 expression in neuronal cells. Among them, 5A shows the changes in CHRNA3 gene expression in the hippocampus before and after hypoxia stress, 5B shows the changes in CHRNA3 protein expression in various neuronal cells before and after hypoxia stress, and 5C shows the results of miRNA24 regulating CHRNA3-3'UTR-dependent luciferase activity.

[0042] Figure 6 The figure shows the experimental results of how GW4869 injection into brown adipose tissue can reduce the level of miR-47119-24 in serum. Among them, 6A is the GW4869 administration regimen, 6B is the result of the weakening of the hypoxic stress response in brown adipose tissue after GW4869 injection, and 6C is the result of the significant downregulation of miR-47119-24 in serum after GW4869 injection.

[0043] Figure 7 The diagram shows the results of GW4869 injection into brown fat to antagonize the hypoxia-induced upregulation of miR-47119-24 expression, downregulation of CHRNA3 expression, and decline in learning and memory abilities in the hippocampus. Among them, 7A is the result of miR-47119-24 expression changes, 7B is the result of CHRNA3 expression changes, and 7C is the result of learning and memory ability changes.

[0044] Figure 8 This is a diagram showing the experimental results of GW4869 injection into brown fat to antagonize hypoxia-induced sleep disorder. Detailed Implementation

[0045] The following provides definitions for some of the terms used in this specification. Unless otherwise stated, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0046] This invention provides the use of miR-24 blockers in the preparation of medicaments for treating sleep disorders.

[0047] In some embodiments, the sleep disorder includes hypoxia-induced sleep disorder, age-related sleep disorder, sleep disorder caused by chronic disease, sleep disorder caused by mood disorder, sleep disorder caused by light and sound, sleep disorder caused by irregular sleep patterns, and drug-induced sleep disorder.

[0048] In a specific implementation, the sleep disorder is a hypoxia-induced sleep disorder.

[0049] In some embodiments, the miR-24 blocker includes, but is not limited to, GW4869, calpain, bisindolymaleimide I, Y-27632, U0126, manumycin A, dimethylamilol (DMA), tepifenabil, ketoconazole, endothelin A receptor (ETA) antagonists, cannabidiol (CBD), ketotifen, proton pump inhibitors (PPIs), Dynasore, or methyl-β-cyclodextrin (MbCD).

[0050] In a specific implementation, the substance that inhibits miR-24 secretion is selected from GW4869.

[0051] The drug also includes pharmaceutically acceptable excipients.

[0052] In some embodiments, pharmaceutically acceptable excipients are substances suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., substances with a reasonable benefit / risk ratio. Pharmaceutically acceptable excipients include all solvents, diluents, buffers (e.g., neutral buffered saline, or optionally Tris-HCl, acetate, or phosphate buffers), solubilizers (e.g., polysorbate 80), colloids, dispersion media, solvents, fillers, chelating agents (e.g., EDTA or glutathione), amino acids (e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, sweeteners, colorants, flavoring agents, aromatizers, thickeners, substances that provide storage effects, coating agents, antifungal agents, preservatives (e.g., Thimerosal™, benzyl alcohol), antioxidants (e.g., ascorbic acid, sodium metabisulfite), tension control agents, absorption delay agents, adjuvants, extenders (e.g., lactose, mannitol), etc. The use of such media and reagents for the formulation of pharmaceuticals is well known in the art. Their use in pharmaceuticals may be considered unless any conventional media or reagent is incompatible with the active ingredient.

[0053] The dosage forms of the drug include gastrointestinal dosage forms and non-gastrointestinal dosage forms.

[0054] In some embodiments, the gastrointestinal dosage form includes tablets, granules, capsules, solutions, dry suspensions, powders, sustained-release formulations, effervescent tablets, emulsions, suspensions, syrups, drops, and chewable tablets.

[0055] In some embodiments, the non-gastrointestinal dosage form includes injectable dosage form, respiratory dosage form, cavity dosage form, mucosal dosage form, and skin dosage form.

[0056] In some embodiments, the administration of the drug is not limited to a specific pattern of administration, dosage, or frequency. The drug may be given to the subject in a single dose or in multiple doses. For example, the drug may be administered once a week, or once every 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, or more weeks. It is understood that for any given subject, the specific dosage regimen should be adjusted over time based on individual needs and the professional judgment of the person administering or supervising the administration of the drug. For example, if a lower dose does not provide sufficient activity in the treatment of the disease or condition described in this application, the dose of the drug may be increased. Conversely, if the disease is reduced or eliminated, the dose of the drug may be decreased.

[0057] In some embodiments, an effective amount refers to an amount sufficient to treat a disease, disorder, and / or condition when administered to a population suffering from or susceptible to such a disease, disorder, and / or condition according to a therapeutic dosage regimen. In some embodiments, a therapeutically effective amount is an amount that reduces the incidence and / or severity of a disease, disorder, and / or condition, and / or delays the onset of one or more symptoms of a disease, disorder, and / or condition. Those skilled in the art will recognize that an effective amount does not actually require successful treatment in a particular individual. Rather, an effective amount can be an amount that, when administered to a patient requiring such treatment, provides a particularly desired pharmacological response in a substantial number of subjects. Specifically, it is understood that a particular subject may be difficult to treat with respect to an effective amount. To cite just one example, a difficult-to-treat subject may have low bioavailability to the point that clinical efficacy is unattainable. In some embodiments, reference to an effective amount may refer to an amount measured in one or more specific tissues (e.g., tissues affected by a disease, disorder, or condition) or fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc.). Those skilled in the art will recognize that, in some embodiments, the effective amount can be formulated and / or administered in a single dose. In some embodiments, the effective amount can be formulated and / or administered in multiple doses, for example, as part of a dosing regimen.

[0058] In some embodiments, any of these strategies can be pursued to achieve controlled release, wherein the release rate exceeds the metabolic rate of the drug under consideration. In some embodiments, controlled release is achieved through a variety of dosage form parameters and components, including, for example, appropriate selection of various types of controlled-release drugs and coatings. Examples include single or multi-unit tablets or capsules, oil solutions, suspensions, emulsions, microcapsules, molecular complexes, microspheres, nanoparticles, patches, and liposomes.

[0059] This invention provides the application of a reagent for detecting miR-24 in a sample in the preparation of products for diagnosing diseases caused by hypoxia stress.

[0060] The reagents are selected from probes that specifically recognize miR-24 and primers that specifically amplify miR-24.

[0061] In some embodiments, a probe is a molecule capable of binding to a specific sequence, subsequence, or other portion of another molecule. Unless otherwise specified, a probe typically refers to a polynucleotide probe capable of binding to another polynucleotide (often called a target polynucleotide) through complementary base pairing. Depending on the stringency of the hybridization conditions, the probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. Probes can be labeled directly or indirectly, including primers. Hybridization methods include, but are not limited to, solution-phase, solid-phase, mixed-phase, or in situ hybridization assays.

[0062] In some implementations, the primer refers to a short nucleic acid sequence, which is a nucleic acid sequence having a short free 3' terminal hydroxyl group (free 3' hydroxyl), and can form a base pair with the complementary template and act as the starting point for replication template.

[0063] The primers or probes are labeled with a labeling substance.

[0064] In some embodiments, a label refers to a composition capable of generating a detectable signal indicating the presence of a target polynucleotide in a sample. Suitable labels include, but are not limited to, radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent components, magnetic particles, and bioluminescent components. Therefore, a label is any composition detectable by a device or method, including but not limited to spectroscopic, photochemical, biochemical, immunochemical, electrochemical, optical, chemical detection devices, or any other suitable device. In some embodiments, a label can be visually detected without the aid of a device. The term "label" is used to refer to any chemical group or portion having a detectable physical property, or any compound capable of causing a chemical group or portion to exhibit a detectable physical property, such as an enzyme that catalyzes the conversion of a substrate into a detectable product. Labels also encompass compounds that inhibit the expression of a particular physical property. A label can also be a compound that is a member of a binding pair, the other member of which has a detectable physical property.

[0065] Among them, radioactive isotopes include but are not limited to 3 H, 14 C 35 S, 125 I, 131 I.

[0066] Enzymes include, but are not limited to, horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase, and acetylcholinesterase.

[0067] Fluorescent molecules include, but are not limited to, FITC, rhodamine, and lanthanide phosphors.

[0068] The products include chips, test strips, reagent kits, or nucleic acid membrane strips.

[0069] In some implementations, a kit refers to a set of components provided in the context of a system for sequencing and / or isolating nucleotide sequences and / or diagnosing a subject with a disease based on the presence, absence, and / or amount of expressed nucleotide sequences from a sample or cell.

[0070] In some embodiments, the kit also includes one or more substances from the group consisting of: containers, positive controls, negative controls, buffers, preservatives, and protein stabilizers.

[0071] The kit may also include an instruction manual, which explains how to use the kit for testing and how to use the test results to assess disease progression and select treatment options.

[0072] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.

[0073] Example 1

[0074] 1. Experimental Materials

[0075] The specific experimental materials are shown in Table 1.

[0076] Table 1 Experimental Reagents

[0077]

[0078] 2 Experimental Methods

[0079] 2.1 Induction and Differentiation Culture of Mouse Brown Adipocytes

[0080] First, dissect brown adipose tissue (BAT) from the scapular region of newborn mice within five days of birth. After mincing the tissue, place it in a 37°C digestion incubator and digest with collagenase (Collagenase I, Collagenase II) using shaking for 40-70 min. Filter the digestion solution and centrifuge at 700 rpm for 10 min at room temperature. Discard the supernatant and floating cells, add erythrocyte lysis buffer, mix thoroughly by pipetting, and incubate for 10 min. Centrifuge again at 700 rpm for 10 min at room temperature. Discard the supernatant, add 4-5 mL of cell culture medium, mix thoroughly by pipetting, and seed into culture flasks. Culture in an incubator. Passage the progenitor adipocytes when they reach 70% confluence. Select second-generation progenitor adipocytes, culture until complete confluence and contact inhibition, and induce differentiation using standard differentiation induction medium to obtain the brown adipocyte cell line.

[0081] 2.2 Isolation and primary culture of mouse hippocampal neurons

[0082] Fetal mouse hippocampi were isolated from mouse E14–16 embryos under a stereomicroscope. The meninges were removed, and the hippocampi were dissected into small pieces and digested in 0.025% trypsin at 37°C for 30 minutes. The cell suspension was filtered through a cell filter, and the cells were then transferred to Neurobasal medium supplemented with B-27 (#17504-044; Gibco) and L-glutamine (2 mM; GlutaMAX, Invitrogen), and inoculated at 5 × 10⁶ cells per well. 4Primary neurons were seeded at a density of 1,000 cells onto poly-L-lysine-coated slides in 24-well plates for immunofluorescence staining of neurons. Alternatively, primary cells were directly seeded into 6-well plates for protein extraction. Primary neurons required 7-10 days of culture before downstream experiments.

[0083] 2.3 Extraction of exosomes from the supernatant of mature brown adipocyte culture

[0084] Collect the supernatant from hypoxic-stimulated and unstimulated brown adipose tissue and centrifuge at 3,000 ×g for 15 minutes to remove tissue debris. Then centrifuge at 10,000 ×g for 30 minutes to remove large vesicles. Then centrifuge the supernatant at 110,000 ×g for 70 minutes. Collect the precipitated exosome vesicles and resuspend them in PBS.

[0085] 2.4 Injection of AVVs virus into brown adipose tissue in mice

[0086] First, anesthetize the mice, and then administer a total of 1×10⁻⁶ doses over 30 seconds using a HAM1LTON syringe. 9 The AAVs virus of vg was injected into the left and right lobes of the brown adipose tissue in the back of mice, with 3 injection sites in each lobe (1 μl per site), and the needle was left in place for 1 minute.

[0087] Validation of the exogenous targeting of miR-47119-24 to the 3'UTR region of Chrna.

[0088] A miR-47119-24 mimic (mimic) was constructed using miR-47119-24 as the target (Raybo Biotechnology). The 3'UTR region of mouse CHRNA3 was cloned into the luciferase reporter gene vector psiCHECK-2 (Promega) and co-transfected with the miR-47119-24 mimic and a negative control mimic into HEK293T cells to verify the downregulation efficiency of luciferase signal after miR-47119-24 transfection, further confirming its targeting effect on CHRNA3. For experimental rigor, the predicted binding region of miR-47119-24 in the 3'UTR region of Chrna was added. Figure 4 B) mutant ( Figure 5 C) As a control.

[0089] 2.6 Injection of GW4869, an inhibitor of brown adipose tissue exosomes in mice

[0090] First, anesthetize the mice. Using a syringe, draw 100 μl of GW4869 solution (injection dose 2.5 μg / g) and inject 50 μl into each of the left and right lobes of the brown adipose tissue in the scapula of the mouse's back. Leave the needle in place for 10 seconds. Repeat the injection for five days.

[0091] 2.7 Inject varenicline into mice via abdominal injection

[0092] First, the mice were immobilized, and 120 μl of varenicline solution (injection dose 3 μg / g) was injected into the peritoneal cavity of the mice using a syringe. The injection was repeated for 14 days.

[0093] 2.8 Stereoscopic injection of miR-47119-24-blocker into the brain of mice

[0094] First, anesthetize the mouse. Insert the upper incisors into the crossbar and adjust the knob to press the nose bar firmly. Insert the ear bar into the mouse's ear canal, balancing the left and right ear bars until the line connecting the two ears is aligned with the ear bars. Ensure the scale positions of the left and right ear bars are the same, then adjust the knob to lock the ear bars. Select a location near the center of the brain. After shaving the hair on the top of the mouse's head, disinfect with alcohol, make a longitudinal incision in the scalp, and use hemostatic forceps to separate the skin left and right. Completely remove the periosteum to expose the Bregma point. Use a brain localization instrument to read the Bregma point value as the three-dimensional coordinate origin O. The stereotactic coordinates relative to the Bregma point are as follows: AP value (Y-axis), 2.4 mm; ML value (X-axis), ±2.2 mm; DV value (Z-axis), 2.5 mm below the surface. Use a microinjector to stereotactically inject a total of 2 μL (50 μM / L) into the hippocampus region.

[0095] 2.9 miRNA extraction

[0096] (1) Sample preparation (soak small steel balls in DEPC water in advance): Take out the sample stored at -80℃, add 50 mg of tissue to 1 ml of lysis buffer MZ, add two small steel balls soaked in DEPC water, and homogenize using a homogenizer. The sample volume should not exceed one-tenth of the volume of lysis buffer MZ.

[0097] (2) Place the homogenized sample at room temperature for 5 min to allow the nucleic acid protein complex to be completely separated.

[0098] (3) Centrifuge at 12,000 rpm (~13,400×g) at 4°C for 5 min, take the supernatant and transfer it into a new RNase-free centrifuge tube (the precipitate obtained by centrifugation includes the outer cell membrane, polysaccharides, high molecular weight DNA, and RNA is present in the supernatant).

[0099] (4) Add 200 μl of chloroform, cover the tube, shake vigorously for 15 seconds, and let stand at room temperature for 5 minutes.

[0100] (5) Centrifuge at 12,000 rpm (~13,400×g) at 4°C for 15 min. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. The RNA is mainly in the aqueous phase, which has a volume of about 50% of the MZ lysis buffer used. Transfer the aqueous phase to a new tube for the next step.

[0101] (6) Measure the volume of the transfer solution and slowly add 0.43 times the volume of anhydrous ethanol (e.g., 215 μl of anhydrous ethanol for 500 μl of transfer solution), and mix well (precipitation may occur at this time). Transfer the resulting solution and precipitate together into the adsorption column miRspin, centrifuge at 12,000 rpm (~13,400×g) for 30 sec at room temperature. If the entire solution and mixture cannot be added to the adsorption column miRspin at one time, please transfer it in two batches. After centrifugation, discard the adsorption column miRspin and retain the eluent.

[0102] (7) Measure the volume of the effluent and slowly add 0.75 times the volume of anhydrous ethanol (e.g., 525 μl of anhydrous ethanol for 700 μl of effluent), and mix well (precipitation may occur at this time). Transfer the resulting solution and precipitate together into the miRelute adsorption column and centrifuge at 12,000 rpm (~13,400×g) for 30 sec at room temperature. If the entire solution and mixture cannot be added to the miRelute adsorption column at once, please add it in two batches. After centrifugation, discard the effluent and retain the miRelute adsorption column.

[0103] (8) Add 500 μl of protein removal solution MRD to the adsorption column miRelute (please check whether ethanol has been added first), let stand at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30 sec at room temperature, and discard the waste liquid.

[0104] (9) Add 500 μl of wash buffer RW to the adsorption column miRelute (please check if ethanol has been added first), let stand at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30 sec at room temperature, and discard the waste liquid.

[0105] (10) Repeat step (9).

[0106] (11) Place the miRelute adsorption column into a 2 ml collection tube and centrifuge at 12,000 rpm (~13,400×g) for 1 min at room temperature to remove residual liquid.

[0107] Note: This step aims to remove residual wash solution from the adsorption column. After centrifugation, allow the miRelute adsorption column to air dry at room temperature for a short time, or place it on a clean bench for ventilation to ensure it is completely dry. Any residual wash solution may affect subsequent experimental procedures such as RT.

[0108] (12) Transfer the miRelute adsorption column into a new RNase-Free 1.5 ml centrifuge tube, add 15-30 μl of RNase-Free ddH2O, place at room temperature for 2 min, and centrifuge at 12,000 rpm (~13,400×g) for 2 min at room temperature.

[0109] Note: The elution buffer volume should not be less than 15 μl; a smaller volume will affect the recovery efficiency. RNA should be stored at -70°C to prevent degradation. Note: To increase RNA yield, the above step can be repeated once.

[0110] 2.10 miRNA reverse transcription

[0111] Table 2 miRNA reverse transcription reagents

[0112]

[0113] The miRNA reverse transcription reagents are shown in Table 2. Small RNA molecules can also be used as templates in this process, with an addition volume of 2-5 μl. The amount added depends on the abundance of the target miRNA, but for low-abundance miRNA samples (such as serum plasma extracts), the maximum volume added is 8 μl.

[0114] Reverse transcription program

[0115] Gently mix the prepared reaction solution with a pipette and perform the reverse transcription reaction of miRNA according to the procedure in Table 3.

[0116] Table 3. Reverse transcription procedure for miRNAs

[0117]

[0118] 2.11 Quantitative Detection of miRNA Fluorescence

[0119] Dilute the cDNA 10-fold as appropriate and prepare the reagents according to Table 4.

[0120] Table 4. Reagents for quantitative detection of miRNA fluorescence

[0121]

[0122] Forward Primer:CCCAGGAAGCCAGATACCCGTC (SEQ ID NO:1)

[0123] The PCR reaction procedure is shown in Table 5.

[0124] Table 5 PCR reaction procedure

[0125]

[0126] 2.12 Water Maze

[0127] First, a 5-day "platform hiding training period" was conducted. A bucket was filled with clean water to a depth of 26 cm and a temperature of 20–22°C. A circular platform with a diameter of 10 cm was placed inside the bucket, with the surface submerged in water by 0.5–1 cm. The pool was divided into four quadrants. Before the experiment, the water was whitened with food-grade titanium dioxide to prevent the animals from seeing the platform. The water maze test program was activated, and parameters such as the capture field of view, the platform itself, the virtual platform, and the entry point were calibrated. The animals were placed headfirst into the water from each of the four different quadrants. The mice swam freely in the bucket searching for the platform. A video system above the bucket captured their swimming trajectory and recorded the platform-finding latency. Training was conducted once daily for 5 consecutive days. During training, if the mouse found the platform within 60 seconds, it was allowed to stay on the platform for 20 seconds; if the mouse failed to find the platform within 60 seconds, it was guided to the platform and allowed to stay there for 20 seconds to memorize the platform's location. The time taken for the mouse to find the platform during the training period was recorded as the escape latency.

[0128] After training, mice were randomly divided into a control group and an experimental group. The control group was housed in a normoxic environment chamber for 72 hours; the experimental group mice were placed in a hypoxic chamber for 72 hours of hypoxic stimulation (10.3% O2). During the mouse modeling period, food and water were provided, and the culture chamber was kept at a suitable temperature and humidity (23±0.5℃, 40% humidity). After the hypoxic stress ended, the mice underwent space exploration experiments.

[0129] After the hypoxic stress period ended, mice underwent a spatial exploration experiment. First, the concealed platform was removed, and then the mice were placed in the water from the third quadrant. The swimming path of the mice within 60 seconds was recorded, as well as the time spent in the original platform quadrant, the number of times the mice crossed the original platform, and the latency period.

[0130] 2.13 Y Maze

[0131] New Heteroarm

[0132] (1) Randomly close the door at the entrance of one arm and allow the animal to explore freely in the remaining two arms for 5 minutes. Then remove the experimental animal from the maze and conduct the second phase of the experiment two hours later.

[0133] (2) Open the previously closed arm doors and allow the animal to move freely in the three arm spaces for 5 minutes. Observe whether the animal enters the previously closed maze arm during the free movement period, as well as the number of times and the time of entry.

[0134] Spontaneous alternation

[0135] (1) The Y-maze device is made of three opaque plastic arms (labeled as I, II and III respectively), with an angle of 120° between the two arms.

[0136] (2) Gently place the mouse in the center of the maze and allow it to explore freely for 5 minutes. The standard for the mouse to enter each arm is that all four limbs are fully engaged. The mouse enters three different arms in sequence (e.g., I II III, I III II, II III I, II I III, III I II, III II I, III I III, III I II, III II I) in an alternating manner.

[0137] (3) The maze of both mice needs to be wiped with 75% alcohol between experiments, and the alcohol needs to be completely evaporated to ensure that the odor does not interfere with the experiment. The detection indicators of the Y maze experiment are recorded by an image acquisition system.

[0138] 3 Experimental Results

[0139] 3.1 Screening of hypoxia-responsive adipose tissue exosomal miRNAs and their tissue / serum expression levels

[0140] Mice were exposed to a hypoxic-hypothermic combined stress environment simulation chamber (simulating an altitude of 6000 meters and a temperature of -12 degrees Celsius) for 72 hours. Brown adipose tissue from the model animals after exposure was collected for exosomal miRNA sequencing analysis. Exosomal miRNAs with significant hypoxic stress response were screened, and their expression levels in adipose tissue and serum were jointly validated to determine the expression profile of miRNAs that met the screening criteria.

[0141] The results showed that the expression level of miR-47119-24 (also known as PC-5p-47119_24, miR-24-5p, miRNA-24, miRNA24) was upregulated in brown adipose tissue exosomes after stress, and its expression level was upregulated in BAT and serum under hypoxic stress conditions. Figure 1 AB), but the same phenomenon was not found in neurons treated with the same hypoxic stress conditions. Figure 1 C), 20 non-high-altitude control samples and 43 high-altitude samples were collected to detect the expression of miR-47119-24 in serum. The ROC curve is shown below. Figure 1 As shown in D. Furthermore, testing revealed that under hypoxic stress conditions, the expression of miR-47119-24 in BAT exhibited significant diurnal rhythmic variations, which completely disappeared after hypoxic stress. Figure 2 This suggests that the function of miR-47119-24 may be related to the circadian rhythm disruption effects induced by hypoxia stress (such as sleep).

[0142] 3.2 Screening of adipose tissue exosomal miRNAs with brain function regulatory potential and their target genes in the brain

[0143] Bioinformatics methods were used to predict adipose tissue exosomal miRNAs with potential brain function regulation and their potential target molecules. Changes in the expression levels of exosomal miRNAs and their potential target molecules in important brain regions regulating sleep, rhythm, and cognitive function, such as the basal forebrain, hypothalamus, cortex, and hippocampus, before and after hypoxic stress were detected (using Western blotting and dual-luciferase reporter gene assays, etc.), to determine the "exosomal miRNA-brain target molecule" signal transduction pathway.

[0144] To investigate whether PC-5p-47119_24 derived from adipose tissue has a regulatory effect on brain function, we examined the expression levels of PC-5p-47119_24 in different brain regions, including the cortex, hippocampus, hypothalamus, and basal forebrain. The results showed that, after hypoxic stress, the expression level of PC-5p-47119_24 was upregulated in all of the above brain regions except the cortex. Figure 3 A). To investigate whether miR-47119-24 in the brain originates from exosome secretion and is transmitted to different brain regions, we conducted an in vivo brown adipose tissue exosome tracing experiment in mice. We injected rAVV-CMV-palm-mCherry-WPRE-hGHpA into the brown adipose tissue of mice to label exosome vesicles. Two weeks later, we found that exosome-labeled RFP signals were indeed detected in the hippocampus of mice. Figure 3 B) indicates that brown adipose exosomes can indeed reach the hippocampus.

[0145] To investigate the mechanism of action of miR-47119-24 after it enters the brain from the periphery, we used bioinformatics tools to predict the target genes of miR-47119_24. The results revealed that CHRNA3 is a potential target molecule regulated by miR-47119_24. Figure 4 AB). In subsequent detection of CHRNA3 expression levels in various brain regions, we found that the mRNA expression levels of CHRNA3 in the hippocampus, hypothalamus, and basal forebrain were downregulated after hypoxic stress, but the expression levels in the cortex remained unchanged. Figure 4 C). Protein level detection results were consistent with mRNA ( Figure 4 D).

[0146] Finally, we selected a brain region to further explore the functional relationship between miRNA24 and CHRNA3. We first found in the hippocampus that the downregulation of CHRNA3 expression mainly occurred in neurons (…). Figure 5A), but the response was not significant in astrocytes and microglia. Simultaneously, we also transfected miR-24 mimics into different types of nerve cells, and the results showed a downregulation of CHRNA3 expression only in neurons, with no significant response in astrocytes and microglia. Figure 5 B), consistent with in vivo results. To further confirm the expression regulatory relationship between miRNA24 and CHRNA3, we constructed a reporter gene expression plasmid containing the 3'UTR region of the CHRNA3 gene containing the miRNA24 binding site. The results showed that after co-transfection of the above reporter gene expression plasmid and miR-24 mimic in neuronal cells, CHRNA3-3'UTR-dependent luciferase activity was significantly downregulated (B). Figure 5 C). The above results collectively demonstrate that miRNA24, derived from adipose tissue exosomes, can enter the brain after hypoxic stress and inhibit CHRNA3 gene expression in specific brain regions. The downregulation of the acetylcholine receptor subunit encoded by this gene in the hypothalamus, basal forebrain, and hippocampus may play a role in mediating hypoxic stress-induced rhythm disturbances, sleep disorders, and cognitive impairment.

[0147] 3.3 The role and contribution of the lipid-brain axis in mediating hypoxic stress-induced abnormal brain function.

[0148] We used miRNA inhibitors and mimics to further confirm the source of miRNA target molecules in brain nerve cells; then, we used methods such as viral infection and drug treatment to specifically regulate the expression / activation level of miRNA or its target molecules in the brain, and simultaneously analyzed the changes in cognitive function and emotional state of model animals after hypoxia stress, to confirm the role and contribution of the "exosomal miRNA-brain target molecule" information transmission pathway in mediating hypoxia stress-induced abnormal changes in brain function.

[0149] After clarifying the gene expression regulatory relationship between miR-47119-24 and CHRNA3, we began to verify the biological function of this lipid-brain response pathway. We injected the exosome inhibitor GW4869 into BAT ( Figure 6 A), the results showed that the intensity of hypoxic stress response in BAT was weakened ( Figure 6 B); at the same time, the serum level of miR-47119-24 was significantly downregulated ( Figure 6 C).

[0150] Subsequently, we analyzed the expression changes of miRNA24 and its target gene CHRNA3 in the brain. The results showed that injection of GW4869 into the BAT not only blocked the hypoxia-induced miR-47119_24 secretion response, but also reduced the expression level of this miRNA in the hippocampus. Figure 7A). More importantly, the decrease in CHRNA3 expression was significantly suppressed ( Figure 7 B). Under the same conditions, the hypoxia-induced decline in learning and memory was alleviated, and the memory of mice could be restored to almost the same level as that of healthy mice. Figure 7 C). The above results indicate that exosome-secreted miR-47119-24 can affect the expression of target genes in the hippocampus through the lipid-brain axis pathway and mediate hypoxia-induced cognitive dysfunction.

[0151] Previous results indicated that hypoxia stress can induce sleep disturbances in mice. We found that GW4869 antagonized the secretion and expression of miR-47119-24 in BAT, which significantly improved hypoxia stress-induced reductions in total sleep and daytime sleep duration, as well as sleep fragmentation. Figure 8 This result indicates that miRNAs secreted by brown adipose tissue also play a crucial role in regulating sleep, providing a novel intervention strategy for addressing sleep disorders caused by environmental stress.

[0152] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. Application of miR-24 blockers in the preparation of drugs for treating sleep disorders.

2. The application according to claim 1, characterized in that, The sleep disorder mentioned is a hypoxia-induced sleep disorder.

3. The application according to claim 1, characterized in that, The miR-24 blocker is selected from substances that inhibit miR-24 secretion; Preferably, the substance that inhibits miR-24 secretion is selected from GW4869.

4. A medicine for treating sleep disorders, characterized in that, The drug includes miR-24 blockers; Preferably, the sleep disorder is a hypoxia-induced sleep disorder; Preferably, the miR-24 blocker is selected from substances that inhibit miR-24 secretion; Preferably, the substance that inhibits miR-24 secretion is selected from GW4869.

5. The drug according to claim 4, characterized in that, The drug also includes pharmaceutically acceptable excipients.

6. Application of miR-24 as a target in screening candidate drugs for the treatment of diseases caused by hypoxia stress; Preferably, the method for screening candidate drugs for treating diseases caused by hypoxia stress includes: Treat culture systems that express or contain the miR-24 gene or its encoded protein with the substance to be screened; The system is used to detect the expression or activity of the miR-24 gene or its encoded protein; wherein, when the substance to be screened inhibits the expression level or activity of the miR-24 gene or its encoded protein, the substance to be screened is a candidate drug for treating diseases caused by hypoxia stress. Preferably, the disease is a sleep disorder.

7. A method for screening candidate drugs for treating diseases caused by hypoxia stress, characterized in that, The method includes: treating a culture system expressing or containing the miR-24 gene or its encoded protein with a substance to be screened; and detecting the expression or activity of the miR-24 gene or its encoded protein in the system; wherein, when the substance to be screened inhibits the expression level or activity of the miR-24 gene or its encoded protein, the substance to be screened is a candidate drug for treating diseases caused by hypoxia stress. Preferably, the disease is a sleep disorder.

8. A method for preparing cells with reduced CHRNA3, characterized in that, The method includes administering a miR-24 blocker; Preferably, the miR-24 blocker is selected from substances that inhibit miR-24 secretion; Preferably, the substance that inhibits miR-24 secretion is selected from GW4869.

9. Application of miR-24 inhibitors in the preparation of cells with reduced CHRNA3; Preferably, the miR-24 blocker is selected from substances that inhibit miR-24 secretion; Preferably, the substance that inhibits miR-24 secretion is selected from GW4869.

10. Application of reagents for detecting miR-24 in test samples in the preparation of products for diagnosing diseases caused by hypoxia stress; Preferably, the reagent is selected from probes that specifically recognize miR-24 and primers that specifically amplify miR-24; Preferably, the sample includes adipose tissue, serum, hippocampus, hypothalamus, and basal forebrain; Preferably, the adipose tissue is selected from brown adipose tissue; Preferably, the disease is a sleep disorder.

Images