Benzopyrone compound as well as synthesis method and application thereof

By designing novel benzopyranone compounds as POLRMT inhibitors, the problems of insufficient activity and large side effects of existing inhibitors have been solved, achieving highly effective treatment for a variety of cancers and exhibiting good pharmacokinetic and metabolic properties.

CN121471187APending Publication Date: 2026-02-06SANOKIN PHARM TECH (WUXI) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411069102.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-06
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing POLRMT inhibitors, such as IMT1B, have insufficient inhibitory activity, lack structure-activity relationship (SAR) studies, and have significant side effects in cancer treatment.

Method used

A new class of benzopyranone compounds has been developed as POLRMT inhibitors for the treatment of cancer-related diseases such as melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer, or ovarian cancer. The compounds are optimized to improve inhibitory activity and reduce side effects.

Benefits of technology

It improves the inhibitory activity of POLRMT inhibitors, reduces drug side effects, has good drug metabolism and pharmacokinetic properties, and is suitable for the treatment of various cancers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121471187A_ABST
    Figure CN121471187A_ABST
Patent Text Reader

Abstract

The invention discloses a benzopyrone compound as well as a synthesis method and application thereof, and belongs to the field of chemical medicines. The benzopyrone compound as shown in the formula (I), or pharmaceutically acceptable salt, prodrug, hydrate or solvent compound, crystal form, stereoisomer or isotope variant thereof, provided by the invention, can be used for inhibiting the growth of cancer cells, treating and / or preventing melanoma, inhibiting cancer cells, and preventing cancer cells. Related diseases such as liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer or ovarian cancer can be treated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of chemical medicine, specifically relating to a benzopyranone compound, its synthesis method, and its uses. Background Technology

[0002] Mitochondrial RNA polymerase (POLRMT) is a single-subunit RNA polymerase that catalyzes the transcription of mtRNA into RNA. Due to the expression of its encoded gene, POLRMT is a crucial regulator of nuclear-mitochondrial signaling crosstalk. Both mitochondrial biosynthesis and mitochondrial DNA replication are inhibited by POLRMT. Studies have shown that POLRMT may be an important metabolic oncogene, promoting the development of OXPHOS and the growth of cancer cells.

[0003] Normal cells obtain energy from carbohydrates, fats, and proteins, while cancer cells rely solely on carbohydrates. When mitochondria send out distress signals, a set of genes in the DNA are activated, including oncogenes and genes that generate tumor blood vessels, transforming normal cells into cancer cells. The proliferation, drug resistance, and metastasis of various cancer cells are highly dependent on oxidative phosphorylation (OXPHOS), and the high-intensity operation of OXPHOS depends on high levels of mitochondrial transcription. Therefore, downregulating mitochondrial DNA transcription levels may be an important strategy for inhibiting cancer cell growth. Mitochondrial RNA polymerase (POLRMT) is a core component protein in mitochondria performing transcriptional functions; developing its inhibitors to downregulate mitochondrial transcriptional function holds promise as a new strategy for cancer treatment.

[0004] In 2015, Bonekamp et al. reported the first POLRMT inhibitor, IMT1B, which produced dose-dependent mtDNA transcriptional levels and reduced cancer cell viability. In a mouse model of human cancer cell xenografts, IMT1B treatment reduced mitochondrial gene expression in tumors, inhibiting tumor growth without causing toxic tissue damage under normal conditions.

[0005]

[0006] However, there is currently a lack of structure-activity relationship (SAR) studies on IMT1B and other available POLRMT inhibitors. Furthermore, the inhibitory activity of IMT1B needs further enhancement. Summary of the Invention

[0007] To address the aforementioned problems, this invention provides a new class of benzopyranone compounds, with the aim of finding a drug with good drug metabolism and pharmacokinetics (DMPK).

[0008] This invention provides benzopyranone compounds and their pharmaceutically acceptable salts, as well as their use in treating cancer-specific related diseases such as melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer, or ovarian cancer.

[0009] One object of the present invention is to provide benzopyranone compounds with the structure shown in general formula (I), or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope-labeled prodrugs thereof:

[0010]

[0011] In the formula:

[0012] R1 is independently selected from -OH, F, and Cl;

[0013] R2 and R3 are each independently selected from H and C. 1-4 Alkyl, F, Cl;

[0014] Y is selected from -NR3R4, where R3 is -H or C. 1-4 Alkyl group, R4 is C 14 Alkyl or C 3-6 Cycloalkyl; or -N, R3 and R4 forming unsubstituted or substituted C 5-10 Saturated heterocycles or C 5-10 Saturated bridged heterocyclic group, wherein the C 5-10 Saturated heterocycles or C 5-10 The saturated bridged heterocycle may be optionally substituted with one or more methyl or carboxyl groups.

[0015] In one embodiment of the present invention, C 5-10 Saturated heterocycles are selected from: piperidine, piperazine, tetrahydropyrrole, morpholine, etc.

[0016] In one embodiment of the present invention, C 5-10 The saturated bridged heterocyclic groups are selected from: C 5-10 The saturated bridged heterocyclic group can also be replaced by one or more methyl or carboxyl groups.

[0017] In one embodiment of the present invention, preferably: R1 is selected from F or Cl, and Y is selected from unsubstituted or substituted piperazine, unsubstituted or substituted tetrahydropyrrole, unsubstituted or substituted morpholine, unsubstituted or substituted C 5-10 Saturated bridged heterocyclic group; the substituted group is one or more methyl or carboxyl groups.

[0018] In one embodiment of the present invention, preferably: R1 is a hydroxyl group, Y is an unsubstituted or substituted piperidine; the substituted group is one or more methyl or carboxyl groups.

[0019] In one embodiment of the present invention, C 1-4 The alkyl group can be specifically selected from methyl, ethyl, or isopropyl.

[0020] In one embodiment of the present invention, C 3-6 The cycloalkyl group can be specifically selected from cyclopropyl.

[0021] In one embodiment of the present invention, the above-mentioned benzopyranone compounds may specifically be selected from:

[0022]

[0023] The present invention relates to compounds of general formula (I) or pharmaceutically acceptable salts thereof, wherein the pharmaceutically acceptable salt is an inorganic or organic salt, the inorganic salt including hydrochloride, hydrobromide, hydroiodide, sulfate, hydrogen sulfate, nitrate, phosphate, and acid phosphate; the organic salt is selected from acetate, trifluoroacetate, propionate, pyruvate, glycolate, oxalate, malonate, fumarate, maleate, lactate, malate, citrate, tartrate, methanesulfonate, sulfonate, benzenesulfonate, and salicylate.

[0024] On the one hand, the present invention provides the use of compounds of the above general formula (I) or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope labels or prodrugs thereof in the preparation of drugs for use as inhibitors of abnormal cell proliferation.

[0025] On the other hand, the present invention provides the use of compounds of the above general formula (I) or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope markers or prodrugs in the preparation of medicaments for diseases related to abnormal cell proliferation such as lung cancer and breast cancer.

[0026] The present invention also provides a method for preparing compounds of general formula (I).

[0027] The present invention also provides pharmaceutical compositions comprising the above-described compound of general formula (I) of the present invention or a pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label or prodrug, and a pharmaceutically acceptable carrier, excipient or diluent.

[0028] Pharmaceutically acceptable carriers include microspheres, nanoparticles, and liposomes.

[0029] In one embodiment of the present invention, the dosage form of the pharmaceutical composition includes injection, lyophilized powder for injection, suspension, implant, embolization, capsule, tablet, pill and oral liquid.

[0030] Beneficial effects:

[0031] The compounds of this invention can act as inhibitors of mitochondrial RNA polymerase (POLRMT), exhibiting significantly enhanced activity compared to the positive control (IMT1B). They can be used to treat and / or prevent diseases related to abnormal proliferation of cancer cells, such as melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer, or ovarian cancer. Furthermore, the compounds of this invention, or their salts, have virtually no side effects and exhibit favorable pharmacokinetic and metabolic properties. Therefore, the compounds designed in this invention have excellent prospects for development and application. Detailed Implementation

[0032] The technical solution of the present invention will be described in detail below with reference to the embodiments.

[0033] In this invention, "substituted" means that one or more hydrogen atoms in a group are replaced by the same or different substituents.

[0034] In this invention, “administering” or “giving” an individual compound means providing the compound of this invention to an individual in need of treatment.

[0035] The term "pharmaceutically acceptable salt" refers to a salt that, within reasonable medical judgment, is suitable for contact with the tissues of humans and lower animals without excessive toxicity, irritation, allergic reactions, etc., and has a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art.

[0036] <Pharmaceutical Composition>

[0037] The present invention also provides pharmaceutical compositions comprising the above-described compound of general formula (I) or a pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, and a pharmaceutically acceptable carrier, excipient, or diluent.

[0038] The compounds of the present invention or pharmaceutically acceptable salts thereof can be formulated into solid dosage forms for oral administration, including, but not limited to, capsules, tablets, pills, powders, granules, etc. In these solid dosage forms, the compound of general formula (I) of the present invention is mixed as the active ingredient with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate. Or it may be mixed with the following components: (1) fillers or solubilizers, such as starch, lactose, sucrose, glucose, mannitol and silica; (2) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, gum arabic; (3) humectants, such as glycerin; (4) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginic acid, certain silicates and sodium carbonate; (5) slowing agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glyceryl monostearate; (8) adsorbents, such as kaolin; (9) lubricants, such as talc, calcium stearate, solid polyethylene glycol, sodium dodecyl sulfate, etc., or mixtures thereof. Buffers may also be included in capsules, tablets and pills.

[0039] The solid dosage forms, such as tablets, sugar pills, capsules, pellets, and granules, can be coated or microencapsulated with coating and shell materials such as enteric coatings and other materials known in the art. They may contain opaque agents, and the release of the active ingredient from such compositions can be delayed in a portion of the digestive tract. Examples of encapsulating components that can be used are polymeric substances and waxes. If necessary, the active ingredient may also be formed into microcapsules with one or more of the excipients described above.

[0040] The compounds of the present invention or pharmaceutically acceptable salts thereof can be formulated into liquid dosage forms for oral administration, including, but not limited to, pharmaceutically acceptable emulsions, solutions, suspensions, syrups, tinctures, etc. In addition to the compound of general formula (I) or its pharmaceutically acceptable salt as the active ingredient, the liquid dosage form may contain inert diluents conventionally used in the art, such as water and other solvents, solubilizers and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn oil, olive oil, castor oil, sesame oil, etc., or mixtures thereof. In addition to these inert diluents, the liquid dosage forms of the present invention may also include conventional adjuvants, such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents, and fragrances.

[0041] The suspending agent includes, for example, ethoxylated octadecyl alcohol, polyoxyethylene sorbitol, and dehydrated sorbitol, microcrystalline cellulose, agar, or mixtures thereof.

[0042] The compounds of this invention and their pharmaceutically acceptable salts can be formulated into dosage forms for parenteral injection, including, but not limited to, physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions and dispersions. Suitable carriers, diluents, solvents, and excipients include water, ethanol, polyols, and suitable mixtures thereof.

[0043] The compounds of this invention or pharmaceutically acceptable salts thereof can be formulated into dosage forms for topical administration, including ointments, powders, suppositories, drops, sprays, and inhalers. The compounds of general formula (I) of this invention or pharmaceutically acceptable salts thereof, as active ingredients, are mixed under sterile conditions with a physiologically acceptable carrier and optionally with preservatives, buffers, and propellants, if necessary.

[0044] The pharmaceutical compositions of the present invention comprise a compound of general formula (I) or a pharmaceutically acceptable salt thereof as an active ingredient, and a pharmaceutically acceptable carrier, excipient, and diluent. In preparing the pharmaceutical compositions, the compound of general formula (I) or a pharmaceutically acceptable salt thereof is typically mixed with a pharmaceutically acceptable carrier, excipient, or diluent. The content of the compound of general formula (I) or a pharmaceutically acceptable salt thereof can be 0.01-1000 mg, for example 0.05-800 mg, 0.1-500 mg, 0.01-300 mg, 0.01-200 mg, 0.05-150 mg, 0.05-50 mg, etc.

[0045] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. The technical solutions of the present invention will be described in detail below with reference to the embodiments.

[0046] The following examples are illustrative and not limiting of the synthesis of compounds of general formula (I). All temperatures are in degrees Celsius. Unless otherwise specified, all evaporations were performed under reduced pressure. Unless otherwise specified, reagents were purchased from commercial suppliers and used without further purification (e.g., 4-hydroxy-7-methoxy-2H-chromene-2-one, (2,4-dimethylphenyl)boronic acid, 2-chloro-4-fluorophenylboronic acid, etc., are commercially available). The structures of the final products, intermediates, and starting materials were confirmed by standard analytical methods, such as elemental analysis and spectroscopic characterization, such as MS and NMR. Abbreviations used are conventional abbreviations in the art.

[0047] Preparation of intermediate a-5:

[0048]

[0049] Preparation of intermediate a-2: 4-chloro-7-methoxy-2H-chromen-2-one

[0050] 50 g (260 mmol) of 4-hydroxy-7-methoxy-2H-chromen-2-one was dissolved in 500 mL of phosphorus oxychloride and heated under reflux for 1 hour. After the reaction was complete, the mixture was cooled to room temperature, and the solvent was concentrated under reduced pressure. The mixture was then extracted three times with 500 mL of dichloromethane and 500 mL of ice water. The organic phases were combined, and the solvent was concentrated under reduced pressure to give intermediate a-2, 49.7 g, yield: 91%. MS-ESI (m / z): 211.01 [M+l] + .

[0051] Preparation of intermediate a-3: 4-chloro-7-hydroxy-2H-chromene-2-

[0052] Intermediate a-2 (49.7 g, 236.6 mmol) was dissolved in 500 mL of dichloromethane, and boron tribromide (97.5 g, 390 mmol) was added. The reaction was carried out at room temperature for 24 hours. After the reaction was completed, the mixture was extracted three times with 400 mL of dichloromethane and 400 mL of ice water. The organic phases were combined and concentrated under reduced pressure to give intermediate a-3, 12.8 g, yield 27.7%. MS-ESI (m / z): 196.99 [M+l] + .

[0053] Preparation of intermediate a-4: 4-(2,4-dimethylphenyl)-7-hydroxy-2H-chromen-2-one

[0054] Under nitrogen atmosphere, (2,4-dimethylphenyl)boric acid (11.5 g, 76.6 mmol) and anhydrous potassium carbonate (31.0 g, 224.4 mmol) were added to intermediate a-3 (12.5 g, 64.1 mmol). Tetraphenylphosphine palladium (3.8 g, 3.32 mmol) was fully dissolved in 150 mL of dioxane and then rapidly added to the reaction system. 30 mL of water was added, and the mixture was refluxed at 110 °C with stirring overnight. TLC analysis showed that starting material a-3 had been consumed. 1000 mL of water was added, and after solid precipitation, the mixture was extracted with dichloromethane (3 × 1000 mL). The organic phases were combined, washed with water (2 × 1500 mL), washed with saturated sodium chloride (2 × 1500 mL), dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by column chromatography to give 12.7 g of a yellow solid (intermediate a-4), yield: 74.2%. MS-ESI (m / z): 267.09 [M+l] + .

[0055] Preparation of intermediate a-5: Ethyl (R)-2-(4-(2,4-dimethylphenyl-2-oxo-2H-chromen-7-yl)oxy)propionate

[0056] Intermediate a-4 (4.35 g, 16.3 mmol) and triphenylphosphine (4.7 g, 17.9 mmol) were dissolved in anhydrous tetrahydrofuran (50 mL), and ethyl 5-2-hydroxypropionate (2.9 g, 24.5 mmol) was added. The reaction mixture was cooled to 0 °C, and DIAD (3.6 g, 17.9 mmol) was added dropwise. The mixture was then allowed to react at room temperature for 4 hours. After the reaction was complete, the mixture was cooled to room temperature, and extracted three times with 500 mL of ethyl acetate and 500 mL of ice water. The organic layer was concentrated, and column chromatography with petroleum ether:ethyl acetate (V / V) = 10:1 gave intermediate a-5, 4.27 g, in 65.3% yield. MS-ESI (m / z): 367.11 [M+l] + .

[0057] Preparation of intermediate b-5:

[0058]

[0059] Intermediate b-5 was synthesized using a similar procedure to that used for intermediate a-5. MS-ESI (m / z): 391.14 [M+l] + .

[0060] Preparation of intermediate a-7:

[0061]

[0062] Preparation of intermediate a-6: Ethyl (R)-2-((3-chloro-4-(2,4-dimethylphenyl)-2-oxo-2H-chromen-7-yl)oxy)propionate

[0063] Ethyl (R)-2-(4-(2,4-dimethylphenyl-2-oxo-2H-chromen-7-yl)oxy)propionate (intermediate a-5, 17.25 g, 47 mmol) was dissolved in NaCl (5.5 g, 94 mmol) and potassium peroxymonosulfonate (24.4 g, 70.5 mmol) in acetonitrile:water (1:1) = 75 mL:75 mL. The mixture was refluxed at 50 °C. After the reaction was complete, the mixture was cooled to room temperature. The solvent was removed by concentration under reduced pressure. The residue was dispersed in 250 mL of 5% sodium bisulfite (NaHSO3) aqueous solution and extracted three times with 250 mL of ethyl acetate (EtOAc). The organic layers were combined, washed with 200 mL of water, and dried over anhydrous sodium sulfate (Na2SO4). The solvent was removed by concentration under reduced pressure, and the crude product (intermediate a-6), 5.0 g, yield: 35%, was purified by silica gel (300-400 mesh) column chromatography. MS-ESI (m / z): 401.05 [M+l] + .

[0064] Preparation of intermediate a-7: (R)-2-((3-chloro-4-(2,4-dimethylphenyl)-2-oxo-2H-chromen-7-yl)oxy)propionic acid

[0065] Intermediate a-6 (4.2 g, 8.60 mmol) was dissolved in 500 mL of tetrahydrofuran, cooled to 0 °C, and 500 mL of 2 M NaOH solution was added. The mixture was then allowed to react at room temperature for 3 hours. After the reaction was complete, 2 M HCl was added to adjust the pH to 2, and the mixture was stirred for 30 minutes. Ethyl acetate (500 mL) was added, and the mixture was extracted three times. The organic layer was concentrated to obtain intermediate a-7, which was directly used in the next step.

[0066] Preparation of intermediate b-7: (R)-2-((3-chloro-4-(2-chloro-4-fluorophenyl)-2-oxo-2H-benzopyran-7-yl)oxy)propionic acid

[0067]

[0068] Intermediate b-7 was synthesized using a similar procedure to that used for intermediate a-7. MS-ESI (m / z): 396.04 [M+l] + .

[0069] Preparation of intermediate c-7: (R)-2-((3-fluoro-4-(2,4-dimethylphenyl)-2-oxo-2H-chromen-7-yl)oxy)propionic acid

[0070]

[0071] Preparation of intermediate c-6: Ethyl (R)-2-((3-fluoro-4-(2,4-dimethylphenyl)-2-oxo-2H-chromen-7-yl)oxy)propionate

[0072] Intermediate a-5 (312.0 mg, 0.85 mmol) was added to a stirred solution of CH3CN (10 mL) containing Selectfluor (509.0 mg, 1.44 mmol), and the reaction mixture was stirred at room temperature for 24 hours. The solvent was removed under vacuum, and the mixture was purified by silica gel column chromatography to give intermediate c-6 (134.2 mg, 41%). MS-ESI (m / z): 385.16 [M+l] + .

[0073] Step 2: Intermediate c-7 was synthesized using a similar procedure to that used for intermediate a-7. MS-ESI (m / z): 357.04 [M+l] + .

[0074] Preparation of intermediate d-7: (R)-2-((3-fluoro-4-(2-chloro-4-fluorophenyl)-2-oxo-2H-benzopyran-7-yl)oxy)propionic acid

[0075]

[0076] Intermediate d-7 was synthesized using a similar procedure to that used for intermediate c-7. MS-ESI (m / z): 381.04 [M+l] + .

[0077] Preparation of intermediate e-7: (R)-2-((3-hydroxy-4-(2,4-dimethylphenyl)-2-oxo-2H-chromen-7-yl)oxy)propionic acid

[0078]

[0079] Intermediate a-5 (366.0 mg, 1.0 mmol) was added to a stirred solution of acetone (10 mL) containing dimethyl ethylene oxide (111.0 mg, 1.5 mmol), and the reaction mixture was stirred at room temperature for 24 hours. The solvent was removed under vacuum, and the mixture was purified by silica gel column chromatography to give intermediate e-6 (134.1 mg, 35%). MS-ESI (m / z): 383.06 [M+l] + .

[0080] Step 2: Intermediate e-7 was synthesized using a similar procedure to that used for intermediate a-7. MS-ESI (m / z): 355.04 [M+l] + .

[0081] Preparation of intermediate f-7: (R)-2-((3-hydroxy-4-(2-chloro-4-fluorophenyl)-2-oxo-2H-benzopyran-7-yl)oxy)propionic acid

[0082]

[0083] Intermediate f-7 was synthesized using a similar procedure to that used for intermediate e-7. MS-ESI (m / z): 379.04 [M+l] + .

[0084] Example 1: Preparation of (R)-3-chloro-4-(2,4-dimethylphenyl)-7-((1-(4-methylpiperazin-1-yl)-1-oxopropyl-2-yl)oxy)-2H-chromen-2-one

[0085]

[0086] Intermediate a-7 (100 mg, 0.27 mmol) was dissolved in 1 mL of anhydrous dichloromethane, followed by the addition of HATU (152.76 mg, 0.4 mmol). The mixture was stirred for 30 minutes, then 1-methylpiperazine (32 mg, 0.32 mmol) and DIPEA (52 mg, 0.4 mmol) were added. The reaction was allowed to proceed for 1 hour. After the reaction was complete, the mixture was extracted three times with 10 mL of dichloromethane and 10 mL of ice water. The organic layer was concentrated, and the target compound was obtained by column chromatography with petroleum ether:ethyl acetate (V / V) = 2:1, yielding 98.5 mg of the target compound (Example 1), in 81.4% yield. MS-ESI (m / z): 455.16 [M+l] + .

[0087] 1 H NMR(400 MHz, DMSO-d6)δ:7.46-7.38(m,1H),7.38-7.32(m,1H),7.26-7.21(m,1H),7.01-6.75(m,3H),4 .78(m,1H),3.30(m,4H),2.48(s,3H),2.3(s,3H),2.26(m,4H),2.18(s,3H),1.48-1.41(m,3H).

[0088] By using the corresponding intermediates instead of the raw materials synthesized in Example 1, Examples 4-13 (see Table 1) were synthesized in a similar manner to Example 1, thereby obtaining the desired products.

[0089] Example 2: Preparation of (S)-1-((R)-2-((3-chloro-4-(2-chloro-4-fluorophenyl)-2-oxo-2H-benzopyran-7-yl)oxy)propionyl)piperidine-3-carboxylic acid

[0090]

[0091] Preparation of intermediate b-8: (S)-1-((R)-2-((3-chloro-4-(2-chloro-4-fluorophenyl)-2-oxo-2H-benzopyran-7-yl)oxy)propionyl)piperidine-3-carboxylic acid methyl ester

[0092] Intermediate a-7 (107.0 mg, 0.27 mmol) was dissolved in 5 mL of anhydrous dichloromethane, followed by the addition of HATU (152.76 mg, 0.4 mmol). The mixture was stirred for 30 minutes, then methyl (S)-3-piperidincarnate (45.8 mg, 0.32 mmol) and DIPEA (52 mg, 0.4 mmol) were added. The reaction was allowed to proceed for 1 hour. After the reaction was complete, the mixture was extracted three times with 10 mL of dichloromethane and 10 mL of ice water. The organic layer was concentrated, and column chromatography with petroleum ether:ethyl acetate (V / V) = 2:1 yielded Example 1, 100.1 mg, yield 71%. MS-ESI (m / z): 522.06 [M+l] + .

[0093] Preparation of (S)-1-((R)-2-((3-chloro-4-(2-chloro-4-fluorophenyl)-2-oxo-2H-benzopyran-7-yl)oxy)propionyl)piperidine-3-carboxylic acid

[0094] Intermediate b-8 (52.2 mg, 0.1 mmol) was dissolved in THF (5 mL), and 2 M NaOH solution (1 mL) was added at 0 °C, followed by a few drops of MeOH until the mixture was homogeneous. The reaction mixture was heated to room temperature and stirred for 2 hours, neutralized with 2 M HCl, and stirred for another 30 minutes. The mixture was extracted with ethyl acetate (3 x 5 mL), the combined organic phases were washed with water, dried over Na₂SO₄, filtered, and evaporated under vacuum. Purification was performed by column chromatography on silica gel to obtain the desired product, Example 2. 43.7 mg, yield 86%. MS-ESI (m / z): 508.06 [M+l] + .

[0095] 1 H NMR(400MHz, DMSO-d6)δ:12.42(br.s,1H),7.85(d,J=7.5Hz,1H),7.30(d,J=7.5H z, 1H), 7.21 (d, J=1.9Hz, 1H), 7.16 (dd, J=7.4, 1.9Hz, 1H), 7.06 (dd, J=7.5, 2.0Hz ,1H), 6.93(d,J=1.9Hz,1H),5.55-5.35(m,1H),4.33-3.88(m,1H),3.88-3.47(m, 1H),3.29-2.70(m,2H),2.33-2.20(m,1H),2.03-1.48(m,4H),1.48-1.38(m,3H).

[0096] By using the corresponding intermediates to replace the raw materials synthesized in Example 2, Examples 3 and 14 were synthesized in a similar manner to Example 2 (see Table 1) to obtain the desired products.

[0097] Table 1

[0098]

[0099]

[0100]

[0101] Example 15 Bioactivity Test

[0102] Screening for benzopyranone inhibitors on A2780 cells that primarily express POLRMT.

[0103] Mechanism of measurement: POLRMT is an RNA polymerase with a single subunit that catalyzes the transcription of mtRNA into DNA. It is an important regulator of nuclear-mitochondrial signaling interference. The proliferation, drug resistance, and metastasis of various cancer cells are highly dependent on oxidative phosphorylation, and the high-load operation of oxidative phosphorylation depends on high-level mitochondrial transcription. Therefore, downregulating mitochondrial DNA transcription levels is an important strategy for inhibiting cancer cell growth.

[0104] Experimental methods:

[0105] Anti-cell proliferation activity assay:

[0106] 1) Cell fixation: 168 hours after drug administration, aspirate the culture medium from the wells and add 200 μL of 10% TCA (trichloroacetic acid) solution pre-cooled at 4°C to each well to fix the cells. After standing for 5 min, transfer to a 4°C refrigerator for 1 h of fixation. Remove and rinse 5 times with deionized water, then air dry at room temperature.

[0107] 2) Staining: After the 96-well plate has dried at room temperature, add 100 μL of 0.4% (w / v) SRB staining solution (prepared with 1% acetic acid) to each well. After staining for 30 min, discard the staining solution and rinse 5 times with 1% (v / v) acetic acid to remove unbound dye. Let it air dry at room temperature.

[0108] 3) Detection: Dissolve the dye bound to cellular proteins in 100 μL of unbuffered Tris-base solution (10 mM, pH = 10.5), shake on a horizontal shaker for 20 min, and measure the absorbance at 545 nM using a microplate reader. The inhibition rate is calculated as: [1 - (change in absorbance of experimental group / change in absorbance of blank group)] × 100%. The compound is then subjected to IC50 assay. 50 The determination method is to select the target

[0109] The inhibition rate (ICP) of the analyte was determined at six concentrations (1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM). A linear regression was performed between the negative logarithm of the molar concentration and the inhibition rate. The concentration at which the inhibition rate reached 50% was then obtained as the IC50 of the corresponding compound. 50 value.

[0110] Real-time quantitative PCR assay for RNA:

[0111] Using the MDA-MB-468 cell line, 500,000 cells / well were seeded in 6-well plates. The next day, a specific concentration of the test compound was added, and after 6 hours of incubation, RNA was extracted using a kit. RNA concentration was then measured and reverse transcribed. ND1 primers (F: TCCTGCATCATGACCCTTG, R: CTGCGGCGTATTCGATGTTG) were added, and amplification was performed using real-time quantitative PCR to obtain the change in the amount of ND1-related RNA in the compound. The inhibition rate was calculated as: [(Amount of RNA in the experimental group - Amount of RNA in the blank group) / Amount of RNA in the blank group)] × 100%.

[0112] The inhibition rate (ICP) of the analyte was determined at six concentrations (1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM). A linear regression was performed between the negative logarithm of the molar concentration and the inhibition rate. The concentration at which the inhibition rate reached 50% was then obtained as the IC50 of the corresponding compound. 50 value.

[0113] Experimental results:

[0114] The activity evaluation results are shown in Table 2 below:

[0115] Table 2 shows the in vitro inhibitory activity of a series of compounds against A2780 and MDA-MB-468.

[0116]

[0117]

[0118] The series of compounds were tested for A2780 inhibition rate and RNA level changes in MDA-MB-468 cells using real-time quantitative RCR assays. Three parallel experiments were performed, and the average results were taken. The results indicate that the benzopyranone compounds of this invention are all highly effective POLRMT inhibitors.

[0119] Furthermore,

[0120] When R1 is selected from F or Cl, and Y is selected from unsubstituted or substituted piperazine, unsubstituted or substituted tetrahydropyrrole, unsubstituted or substituted morpholine, or unsubstituted or substituted saturated bridged heterocyclic group (the substituted group is one or more methyl or carboxyl groups), the inhibitory activity of the compound is better (as in Examples 1, 4-5, 7-8, 10).

[0121] Alternatively, when R1 is a hydroxyl group and Y is an unsubstituted or substituted piperidine (the substituted group is one or more methyl or carboxyl groups), the inhibitory activity of the compound is even better.

[0122] For compounds of general formula (I), the linking and substituent groups have a significant impact on the pharmacodynamic properties of the compound. Although this disclosure has been described in some detail and some specificity has been used with respect to several described embodiments, it is not intended to limit it to any such details or embodiments or any particular embodiment, but should be interpreted with reference to the appended claims in order to provide the broadest possible interpretation of such claims in light of the prior art, and thus effectively cover the intended scope of this disclosure.

Claims

1. Benzopyranone compounds having the structure shown in general formula (I) or pharmaceutically acceptable salts, hydrates, solvates, stereoisomers, tautomers, cis-trans isomers, isotope-labeled prodrugs: In the formula: R1 is independently selected from -OH, F, and Cl; R2 and R3 are each independently selected from H and C. 1-4 Alkyl, F, Cl; Y is selected from -NR3R4, where, R3 is -H or C 1-4 Alkyl group, R4 is C 1-4 Alkyl or C 3-6 Cycloalkyl; or -N, R3 and R4 forming unsubstituted or substituted C 5-10 Saturated heterocyclic or saturated bridged heterocyclic group; wherein the C 5-10 The saturated heterocycle or saturated bridged heterocycle may be optionally substituted with one or more methyl or carboxyl groups.

2. The benzopyranone compound or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug according to claim 1, characterized in that, C 5-10 The saturated heterocycles are selected from: piperidine, piperazine, tetrahydropyrrole, and morpholine.

3. The benzopyranone compound or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug according to claim 1, characterized in that, C 5-10 The saturated bridged heterocyclic groups are selected from:

4. The benzopyranone compound according to claim 1, or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug, characterized in that, The compounds specifically include:

5. The benzopyranone compound or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug according to any one of claims 1-4, characterized in that, The pharmaceutically acceptable salt is an inorganic or organic salt. The inorganic salt is selected from hydrochloride, hydrobromide, hydroiodide, sulfate, hydrogen sulfate, nitrate, phosphate, and acid phosphate. The organic salt is selected from acetate, trifluoroacetate, propionate, pyruvate, glycolate, oxalate, malonate, fumarate, maleate, lactate, malate, citrate, tartrate, methanesulfonate, benzenesulfonate, and salicylate.

6. The use of the benzopyranone compound of any one of claims 1-5, or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug in the preparation of a drug for use as a mitochondrial RNA polymerase inhibitor.

7. Use of the benzopyranone compound of any one of claims 1-5, or its pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, or prodrug in the preparation of a medicament for treating cancer-related diseases; said cancer-related diseases include melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer, or ovarian cancer.

8. A pharmaceutical composition, characterized in that, The compound comprises any one of the benzopyranone compounds of claims 1-5 or a pharmaceutically acceptable salt, hydrate, solvate, stereoisomer, tautomer, cis-trans isomer, isotope label, prodrug, and a pharmaceutically acceptable carrier.

9. The pharmaceutical composition according to claim 8, characterized in that, Pharmaceutically acceptable carriers include microspheres, nanoparticles, and liposomes.

10. The pharmaceutical composition according to claim 8, characterized in that, The dosage forms of the pharmaceutical composition include injections, lyophilized powder for injection, suspensions, implants, embolic agents, capsules, tablets, pills, and oral solutions.