Kluyveromyces marxianus engineering strain for efficiently expressing bovine beta-lactoglobulin and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a kluyveromyces marxianus engineering strain for efficiently expressing bovine beta-lactoglobulin and application of the kluyveromyces marxianus engineering strain. According to the invention, disulfide bond forming enzyme genes ERO1 and ERV2 of a disulfide bond isomerization pathway of pichia pastoris and disulfide bond isomerase genes PDI1 and MPD1 are introduced into a kluyveromyces marxianus chromosome interface, so that a disulfide bond synthesis pathway is enhanced, and folding of beta-lactoglobulin and formation of disulfide bonds are promoted; the glucose phosphate isomerase gene PGI1 of a glycolytic pathway is knocked out, and NADPH and synthesis of an amino acid precursor are improved; through fermentation condition optimization, the secretory expression beta-lactoglobulin yield of beta-lactoglobulin A and B recombinant expression engineering strains reaches 5.1 g / L and 7.3 g / L. The kluyveromyces marxianus engineering strain is used for preparing two subtypes of beta-lactoglobulins, is high in yield, short in fermentation period and low in cost, and can be applied to the fields of food, nutrient supplements, medical care and the like.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to an engineered strain of *Kluyveromyces martensii* and its application in the preparation of β-lactoglobulin. Background Technology

[0002] Milk proteins mainly include casein and whey proteins. Whey proteins represent a rich mixture of secretory proteins with diverse compositions, possessing a wide range of nutritional, biological, and food functional properties. They primarily include β-lactoglobulin, α-lactalbumin, bovine serum albumin, immunoglobulins, and lactoferrin. β-lactoglobulin is the main bovine whey protein, typically accounting for 50% of total whey protein in ruminants and 10% of total bovine milk protein. It consists of a single polypeptide chain containing 178 amino acid residues and a molecular weight of approximately 18.3 kDa. The bovine β-lactoglobulin molecule contains two disulfide bonds (Cys). 106 -Cys 119 Cys 66 -Cys 160 ) and a free thiol group Cys 121 .

[0003] Bovine β-lactoglobulin exists in two main isoforms, A and B. In isoform A, amino acids at positions 64 and 118 are aspartic acid and valine, respectively, while in isoform B, these are replaced by glycine and alanine, respectively. β-lactoglobulin is a nutritionally balanced protein, particularly rich in branched-chain amino acids (over 25%), which promote muscle growth. Its first limiting amino acid, lysine, is also present in 9.3% of its content, making it an important nutritional supplement. β-lactoglobulin also belongs to the lipid transporter family. Its unique barrel-shaped structure provides binding sites for low-polarity molecules such as vitamins, fatty acids, and flavonoids, as well as hydrophobic bioactive substances such as alkaloids, curcumin, and cholesterol. Therefore, β-lactoglobulin has broad applications and market demand in the fields of nutritional fortification and biomedicine.

[0004] Most commercially available β-lactoglobulin is currently produced by separating it from cow's milk using membrane separation technology (Sigma-Aldrich, catalog number L3908; Macklin, catalog number L890177; Aladdin, catalog number L304933; Solarbio, catalog number L8590). The low efficiency of this production process leads to high costs, and the livestock industry is also compelled to adopt cleaner and more environmentally friendly green technologies. Using bioengineering technology to express recombinant proteins is an effective and mature strategy for preparing high-yield and high-purity proteins. Although β-lactoglobulin has been successfully recombinantly expressed in prokaryotic expression systems such as Escherichia coli (15-40 mg / L), Lactobacillus casei (1 mg / L), and Lactococcus lactis (8 μg / mL), as well as eukaryotic expression systems such as insect cells (5 mg / L), Saccharomyces cerevisiae (1.1 mg / L), Pichia pastoris (>1 g / L), Kluyveromyces lactis (40-50 mg / L), and transgenic mice (1-2 mg / mL), the expression levels are generally low, and therefore there is still great potential for improvement.

[0005] Kluyveromyces martensii, as a novel yeast expression system, has successively obtained GRAS certification from the US Food and Drug Administration, QPS certification from the European Food Safety Authority, and has been approved by the National Health Commission of China as a new food ingredient. Industrial biomanufacturing targeting β-lactoglobulin relies on the recombinant expression of β-lactoglobulin using microbial cell factories. Considering that β-lactoglobulin is mainly used in food and biopharmaceutical nutritional products, selecting food-grade microbial cell factories is more conducive to its production. Achieving high-yield and efficient secretory expression of β-lactoglobulin in microbial cells is a requirement of the industrial biotechnology industry. This invention provides an engineered strain of Kluyveromyces martensii containing subtype A or subtype B β-lactoglobulin and its construction method, and utilizes the engineered strain for secretory expression to prepare subtype A or subtype B β-lactoglobulin. Summary of the Invention

[0006] The purpose of this invention is to provide a Kluyveromyces martensii engineered strain that efficiently secretes and expresses bovine β-lactoglobulin, as well as its preparation method and application.

[0007] The Kluyveromyces martensii strains that efficiently secrete and express bovine β-lactoglobulin provided by this invention are recombinant strains LHP1480 and LHP1466 that secrete and express β-lactoglobulin A, and strains LHP1481 and LHP1467 that secrete and express β-lactoglobulin B; they are constructed by the following steps: (1) Using the strong promoter and terminator of Kluyveromyces martensii, disulfide bond forming enzyme genes in the disulfide bond isomerization pathway of Pichia pastoris were constructed respectively. ERO1 and ERV2 and disulfide bond isomerase gene PDI1 and MPD1 Expression box; then put ERO1 and ERV2 Expression frame tandem integration into Kluyveromyces martensii Fim-1 Δ hurray3 Chromosome 101 site interface of the strain ( PDC1 (273-292 bp downstream of the gene CDS). Similarly, ERO1 and ERV2 The expression cassette was tandemly integrated into the Kluyveromyces macrocarpa chromosome 201 interface (358-377 bp downstream of the CDS of the HSP60 gene), and the resulting disulfide isomer pathway-enhanced strain was designated Fim-1 Δ. hurray3 SE1.

[0008] (2) Using CRISPR-Cas9 gene editing technology, knock out Kluyveromyces martensii Fim-1 Δ hurray3 glucose phosphoisomerase gene of SE1 strain PGI1 A strain with enhanced disulfide isomerization and pentose phosphate pathways was constructed and designated Fim-1 Δ. hurray3 SE / PE1.

[0009] (3) Based on the codon characteristics of Kluyveromyces macrocarpa, the genes of bovine β-lactoglobulin A and B were designed and synthesized, and cloned into the Kluyveromyces macrocarpa secretory expression vector pUKDN132, respectively, to obtain recombinant plasmids pLHZ1777 and pLHZ1778 that secrete and express β-lactoglobulin A and B.

[0010] (4) Recombinant plasmids pLHZ1777 and pLHZ1778 were transformed into Kluyveromyces martensii Fim-1 Δ hurray3 and Fim-1 Δ hurray3 SE / PE1 was used to obtain recombinant secretory β-lactoglobulin A strains LHP1480 and LHP1466, and secretory β-lactoglobulin B strains LHP1481 and LHP1467.

[0011] In step (1), the disulfide bond forming enzyme gene ERO1 and ERV2 The gene was derived from Pichia pastoris, with GenBank accession numbers XM_002489600 and XM_002492510; disulfide isomerase gene. PDI1 and MPD1 Also derived from Pichia pastoris, GenBank accession numbers XM_002494247 and XM_002489421.

[0012] A preferred method is to use Kluyveromycin. ENO2、PDC1、INU1 and HXT4 Gene promoters and terminators regulate respectively ERO1 ERV2、PDI1 and MPD1 The expression.

[0013] In step (2), the glucose phosphate isomerase gene is mentioned. PGI1 The GenBank accession number is XM_022822454.1.

[0014] In step (3), the bovine β-lactoglobulin A subtype has the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2.

[0015] In step (3), the bovine β-lactoglobulin B subtype has the nucleotide sequence shown in SEQ ID NO.3 and the amino acid sequence shown in SEQ ID NO.4.

[0016] In step (3), the secretory expression vector expression includes the expression of the promoter, signal peptide, and terminator of the Kluyveromyces martensii inulinase gene, as well as the yeast's own autonomous replication sequence pKD1 and nutrient selection marker gene. URA3 .

[0017] In step (4), the Kluyveromyces Marcius Fim-1 Δ hurray3 It is the uracil synthase gene that has been knocked out of the genome of Kluyveromyces martensii FIM-1 strain. URA3 The obtained strain, Kluyveromyces masculinus FIM-1, is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 10621.

[0018] This invention also provides a method for preparing β-lactoglobulin using engineered strains of *Kluyveromyces martensii*. Specifically, using recombinant β-lactoglobulin-secreting strains LHP1466 or LHP1467, and LHP1480 or LHP1481, the β-lactoglobulin is efficiently secreted and expressed through fed-batch fermentation in a fermenter; the method includes the following steps: (1) Activation of strain: streak the recombinant expression strain LHP1466 or LHP1467 of Kluyveromyces martensii on YPD (1-3% polypeptone, 1-3% glucose, 0.5-1.5% yeast extract, 1-3% agar) solid plates and incubate at 25-35℃ for 36-48h until clones are formed; (2) Seed culture preparation: The activated Kluyveromyces martensii recombinant expression strain was inoculated into a shake flask containing seed culture medium and cultured at 25-35℃ and 200-250 rpm for 16-22 h to obtain the seed culture; (3) Fermentation tank culture: The above-mentioned Kluyveromyces martensii seed liquid was inoculated into a fermentation tank containing fermentation medium at a ratio of 5-10%, and fermented at 25-35 ℃. The pH was controlled with ammonia water to control the pH to 5.0-6.0. After 6-8 h of fermentation, 50% glucose feed medium was added. The feed rate was dynamically adjusted according to the dissolved oxygen control (15-20%), with a flow rate range of 15-25 ml / hL and a feed time of 56-72 h.

[0019] Furthermore: In step (2), the seed culture medium comprises: 0.5-1.5% glucose, 0.5-1.5% glycerol, 0.05-0.15% xylose, 0.1-1% corn steep liquor, 0.1-1% yeast extract, 0.1-1% ammonium sulfate, 0.1-1% magnesium sulfate, 0.5-2% potassium dihydrogen phosphate, 0.05-0.2% calcium chloride, 1-5 μg / L zinc sulfate, 0.1-0.5 μg / L manganese chloride, 0.1-0.5 μg / L cobalt chloride, 1-5 μg / L ferrous sulfate, 0.1-1 μg / L sodium borate, 0.01-0.1 μg / L sodium iodide, 0.1-0.5 ng / L biotin, 10-100 ng / L inositol, 0.5-2 ng / L thiamine, 0.5-2 10-100 ng / L pyridoxine, 10-100 ng / L para-aminobenzoic acid, 1-20 ng / L riboflavin, 0.05-0.2 μg / L calcium pantothenate, 0.05-0.2 ng / L folic acid.

[0020] In step (3), the fermentation medium comprises: 2% glucose, 2% glycerol, 1% xylose, 1.5% corn steep liquor, 0.5-1.5% yeast extract, 0.5-1.5% ammonium sulfate, 0.1-1% magnesium sulfate, 0.5-2% potassium dihydrogen phosphate, 0.05-0.2% calcium chloride, 1-5 mg / L zinc sulfate, 0.1-0.5 mg / L manganese chloride, 0.1-0.5 mg / L cobalt chloride, 1-5 mg / L ferrous sulfate, 0.1-1 mg / L sodium borate, 0.01-0.1 mg / L sodium iodide, 0.1-0.5 μg / L biotin, 10-100 μg / L inositol, 0.5-2 μg / L thiamine, 0.5-2 μg / L pyridoxine, 10-100 μg / L para-aminobenzoic acid, 1-20 0.05-0.2 μg / L riboflavin, 0.05-0.2 μg / L calcium pantothenate, and 0.05-0.2 μg / L folic acid.

[0021] In step (3), the glucose-supplemented culture medium contains: 55-65% glucose, 5-15% glycerol, 1-3% xylose, 0.5-2% yeast extract, 0.1-0.5 mg / L biotin, 10-20 mg / L inositol, 0.5-2 mg / L thiamine, 0.5-2 mg / L pyridoxine, 10-100 mg / L para-aminobenzoic acid, 1-20 mg / L riboflavin, 0.05-0.2 mg / L calcium pantothenate, and 0.05-0.2 mg / L folic acid.

[0022] The present invention also provides a method for preparing bovine β-lactoglobulin A or B subtype protein by high-density fermentation using engineered strains of *Kluyveromyces martensii*.

[0023] Specifically, the engineered strain of *Kluyveromyces martensii* is used as the fermentation strain and inoculated into a culture medium. The culture medium for fermentation of the engineered strain can be a rich culture medium containing glucose and yeast extract, more preferably a synthetic culture medium containing glucose, ammonium sulfate, magnesium sulfate, potassium dihydrogen phosphate, vitamins and trace elements, etc. The culture temperature is controlled at 25-35℃, the pH is controlled at 5.0-6.0, and the culture time is 48-96 hours.

[0024] Through the above-described method, the *Kluyveromyces martensii* engineered strain provided by this invention can efficiently prepare bovine β-lactoglobulin A or B subtypes, with an expression level of up to 7.3 g / L in a 5L fermenter. This is the highest level reported in existing literature and the highest yield reported in existing patents (CN118726120A, CN118240675A, CN116200397A), demonstrating significant technological advancement.

[0025] Using engineered strains of Kluyveromyces martensii and β-lactoglobulin A or B subtypes obtained through efficient preparation, these products can be used in food and biopharmaceutical fields such as formula milk powder, dairy processing, high-protein dairy products, functional beverages, high-protein nutritional supplements, and bioactive peptides or drug delivery carriers. Attached Figure Description

[0026] Figure 1 This is an amino acid sequence comparison of bovine β-lactoglobulin A and B isoforms.

[0027] Figure 2 For Kluyveromyces Marcius Fim-1 Δ hurray3 SE / PE1 growth phenotypes were observed in synthetic media containing YNB, uracil, and different carbon sources.

[0028] Figure 3 The growth curve of the *Kluyveromyces martensii* strain expressing recombinant β-lactoglobulin fermented in a 5L fermenter.

[0029] Figure 4 To detect the yield of β-lactoglobulin in the fermentation supernatant of a Kluyveromyces marxoiris strain expressing recombinant β-lactoglobulin in a fermenter using SDS-PAGE. Detailed Implementation

[0030] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0031] Example 1: Construction of a chassis strain that enhances the disulfide bond isomerization pathway β-lactoglobulin is a core component of bovine whey protein, a globular protein with a molar mass (Mw) of 18.3 kDa. It possesses a complex structure of β-barrel and α-helix, accounting for 7%–12% of the total protein. Bovine β-lactoglobulin has at least six genetic variants, with variants A and B being the most abundant, differing at positions 64 and 118, respectively. In variant A, Asp and Val are replaced by Gly and Ala. Natural β-lactoglobulin contains two disulfide bonds and a free thiol group embedded in the protein structure. To improve the efficiency and correct folding of β-lactoglobulin expression in *Kluyveromyces martensii*, this invention first describes the expression of β-lactoglobulin in the *Kluyveromyces martensii* expression host strain Fim-1Δ... hurray3 The disulfide isomerization pathway of Pichia pastoris was introduced.

[0032] Pichia pastoris, as one of the most widely used eukaryotic expression systems, possesses strong secretory capabilities and high levels of heterologous protein expression. Its disulfide isomerization pathway mainly includes disulfide bond forming enzymes Ero1 and Erv2, as well as disulfide bond isomerases Pdi1 and Mpd1. PDI1 The gene encodes the disulfide isomerase Pdi1, a redox enzyme in the endoplasmic reticulum lumen crucial for the formation of disulfide bonds in secretory proteins. Pdi1 also acts as a molecular chaperone, assisting in the folding process of nascent proteins. Therefore, selecting a protein that enhances the disulfide isomerase pathway, which contains the disulfide bond-forming enzyme, can improve... K. marxianus The ability of yeast to secrete and express heterologous proteins.

[0033] Pichia pastoris Using the GS115 genome as a template, amplification was performed using specific primers. ERO1 , ERV2 , PDI1 and MPD1 Genes. The promoters and terminators used to construct the gene expression cassette are all in... K. marxianus The strong promoters and terminators in yeast that have been characterized are shown in Table 1. ERO1 and ERV2The expression cassettes were tandemly assembled into a dual expression cassette on the pMD18-T vector and then integrated into the Kluyveromyces chromosome 101 interface. PDC1 (273-292 bp downstream of the gene CDS). Similarly... ERO1 and ERV2 The expression cassette was tandemly integrated into the Kluyveromyces macrocarpa chromosome 201 interface (358-377 bp downstream of the CDS of the HSP60 gene), and the resulting disulfide isomer pathway-enhanced strain was designated Fim-1 Δ. hurray3 SE1.

[0034] Table 1: Construction of the disulfide bond isomerization pathway overexpression in Kluyveromyces martensii .

[0035] Example 2: Construction of a chassis strain with enhanced pentose phosphate pathway Glucose phosphate isomerase (PGI, EC 5.3.1.9) is a key enzyme in glycolysis and gluconeogenesis. Its core function is to catalyze a reversible isomerization reaction. As the second step in glycolysis, PGI is essential for cells to obtain energy through glucose breakdown and connects several important metabolic pathways. In the pentose phosphate pathway (PPP), G6P is the entry substrate. The PPP pathway is crucial for the production of NADPH (used for biosynthesis and antioxidant activity) and the synthesis of protein precursors ribose-5-phosphate and erythrose-4-phosphate. pgi1 indirectly influences whether cells favor glycolysis or the pentose phosphate pathway by controlling G6P levels. Therefore, knocking out the PGI gene can fundamentally alter the metabolic flow in yeast, increasing the NADPH required for biosynthesis and antioxidant activity. This is significant for enhancing protein synthesis, particularly metabolic modification related to disulfide bond formation.

[0036] The pCrispr-PGI1 vector was constructed using primer pair PGI1-F / R (tcatggcaactgagttgtccgca / aactgcggacaactcagttgcca (SEQ ID NO.5 / SEQ ID NO.6)) to knock out the PGI1 gene (protein ID: QGN13438.1). The gene was amplified using primer pairs PGI11-F / R (ttgtatcgaccatagaaaagtacatccc / aagggaaggttcacaaaggtatccttgctgtaatgtgttattgtgtgatgtgg (SEQ ID NO.7 / SEQ ID NO.8)) and PGI12-F / R (catcacacaataacacattacagcaaggatacctttgtgaacc ttccctttcc / gacgccaaaatacctacaagattatgg (SEQ ID NO.9 / SEQ ID NO.10)). PGI1 (GenBank: XM_022822454.1) The donor sequence was formed by ligating 500 bp sequences upstream and downstream of the open reading frame using overlap PCR. The CRISPR plasmid pCrispr-PGI1 and the donor sequence were then co-transformed into Fim-1 Δ using the lithium acetate method. hurray3 SE1 strain. The specific procedure is as follows: Pick *Kluyveromyces martensii* cells into a test tube containing 3 mL of liquid YPD medium and incubate at 30°C on a shaker for 12-16 h; take 1 mL of the bacterial culture, centrifuge at 8000 rpm, discard the supernatant, wash with 1 mL of sterile water, centrifuge at 8000 rpm, discard the supernatant; wash with 1 mL of 1×TE / LiAc (0.1 M / L LiAc, 10 mM / L Tris, 1 mM / L EDTA), centrifuge at 8000 rpm, discard the supernatant, and repeat once; add 10 μL of ligation product (or 3-4 μL of plasmid), 600 μL of PEG solution (0.1 M / L LiAc, 10 mM / L Tris, 1 mM / L EDTA, 40% PEG 4000) and DTT (final concentration 10 mmol); incubate at 30°C for 15 min, then transfer to 47°C and incubate for 15 min; briefly centrifuge, discard the supernatant, add 100... After thoroughly resuspending the bacterial cells in μL of sterile water, they were plated onto uridine-free complete synthesis medium (SC-Ura) and incubated statically at 30°C. Transformants were verified by PCR. PGI1 The gene deletion mutant strain, resulting in an expression strain with enhanced disulfide isomerism and pentose phosphate pathway, is denoted as Fim-1 Δ. hurray3 SE / PE1.

[0037] Example 3: Construction of a recombinant *Kluyveromyces marxoiris* chassis strain expressing β-lactoglobulin In the construction of the recombinant expression β-lactoglobulin-expressing Kluyveromyces martensii chassis strain, this invention uses the bovine β-lactoglobulin A isoform nucleotide sequence (GenBank: CAA32835.1), removes the N-terminal signal peptide nucleotide sequence, and then optimizes the codons (nucleotide sequence as shown in SEQ ID NO.1). The nucleotide sequence was then synthesized by Anshengda Biotechnology Co., Ltd., and this sequence was constructed into plasmid pUKDN132 (Chinese Invention Patent ZL201810153542.0) using a seamless cloning method. Good morning I and Note Between the I restriction sites, a recombinant plasmid expressing β-lactoglobulin A was obtained, denoted as pLHZ1777.

[0038] Because the B and A isoforms of β-lactoglobulin differ by only two amino acids (e.g. Figure 1 As shown in the figure, this invention utilizes primers AATCAATTAAATCCGGGGTAAG (SEQ ID NO.11) and primers GCGACCGGCACATGATAAAGATATA (SEQ ID NO.12) via PCR to construct the coding nucleotide sequence for subtype B (nucleotide sequence shown in SEQ ID NO.2), and similarly loads this sequence into plasmid pUKDN132 via seamless cloning. Good morning I and Note Between the I restriction sites, a recombinant plasmid expressing the β-lactoglobulin B isoform was obtained, denoted as pLHZ1778.

[0039] Recombinant plasmids pLHZ1777 and pLHZ1778 were chemically transformed into the Kluyveromyces martensii expression host strain Fim-1 Δ. hurray3 and Fim-1 Δ hurray3 SE / PE1 competent cells were plated on SD-URA plates and incubated statically at 30°C until single colonies formed. Colony PCR screening was performed using primers PUKD16F (CAGCAATTAAATCCGGGGTAA (SEQ ID NO. 13)) and YY151R (TATAAAATGTCGCTGTGACCAGGC (SEQ ID NO. 14)). Clones capable of amplifying the same size as the β-lactoglobulin gene were considered positive recombinants. Among these, Fim-1 Δ... hurray3 The engineered strains expressing β-lactoglobulin, subtypes A and B, obtained from the host bacteria, were named LHP1480 and LHP1481, respectively, and were transformed into Fim-1Δ hurray3The engineered strains expressing β-lactoglobulin, namely subtype A and subtype B, obtained from the SE / PE1 host strain, were named LHP1466 and LHP1467, respectively.

[0040] Example 4, Fim-1 Δ hurray3 Growth phenotype of SE / PE1 strain Fim-1 Δ hurray3 The SE / PE1 strain exhibited slow growth in basal medium with glucose as the sole carbon source, but in YPD, it showed similar growth ability to the wild-type strain as the control strain. This indicates that the free amino acids and other nutrients in YPD contribute to the growth of Fim-1 Δ hurray3 Glucose metabolism in SE / PE1 strain. Fim-1 Δ hurray3 The deletion of the PGI gene in the SE / PE1 strain leads to impaired glycolysis in yeast, but the flow to the PPP pathway remains unaffected. Activation of the C2, C3, or C5 metabolic pathways may compensate for the growth defect. Commonly used C2 carbon sources for fermentation include ethanol, acetic acid, and ammonium acetate (NH4Ac), while glycerol is a C3 carbon source, and arabinose and xylose are C5 carbon sources. (Fim-1 Δ) hurray3 The SE / PE1 strain cannot grow using xylose as the sole carbon source, nor can it grow using glycerol as the sole carbon source. However, by combining carbon sources, such as glucose supplemented with ethanol, xylose, or glycerol, the growth rate of Fim-1 ΔC can be significantly increased. hurray3 Growth ability of SE / PE1 strain ( Figure 2 Among the various growth parameters, glucose and xylose, or a mixture of glucose and glycerol, showed the best growth. However, xylose was significantly more effective than glycerol, presumably because the addition of xylose increased the xylulose-5-phosphate content, leading to the production of more fructose-6-phosphate and glyceraldehyde-3-phosphate by the phosphoketone enzyme TKL1, thus restoring the glycolytic pathway. Under conditions of acetic acid supplementation, the lower pH caused by acetic acid inhibited growth. After switching to ammonium acetate supplementation, the growth of Fim-1 Δ... hurray3 The growth capacity of the SE / PE1 strain was also promoted.

[0041] Example 5: Fed-batch fermentation high-density fermentation method for recombinant β-lactoglobulin-expressing Kluyveromyces marxoiris. A high-density fermentation method for recombinant β-lactoglobulin-expressing Kluyveromyces martensii includes the following steps: (1) Activation of strains: The recombinant expression strains of Kluyveromyces martensii (LHP1480, LHP1481, LHP1466 and LHP1467) were streaked on YPD (2% polypeptone, 2% glucose, 1% yeast extract, 2% agar) solid plates and incubated at 30℃ for 36-48h until clones were formed; (2) Seed culture preparation: The activated Kluyveromyces martensii recombinant expression strain was inoculated into a shake flask containing seed culture medium and cultured at 30℃ and 220 rpm for 18 h to obtain the seed culture. (3) Fermentation tank culture: The above-mentioned Kluyveromyces masculinus seed liquid was inoculated into a fermenter containing synthetic fermentation medium (40% liquid volume) at a ratio of 1:10. Fermentation culture was carried out at 30℃, and the pH was controlled with ammonia water to control the pH=5.5. After 8 hours of fermentation, 50% glucose feed medium was added. The feed rate was dynamically adjusted according to the dissolved oxygen control (15-20%), with a flow rate range of 15-25 ml / hL and a feed time of 64 h.

[0042] In step (2), the seed culture medium comprises: 1% glucose, 0.5% glycerol, 0.1% xylose, 0.5% corn steep liquor, 0.5% yeast extract, 0.5% ammonium sulfate, 0.5% magnesium sulfate, 1% potassium dihydrogen phosphate, 0.03% calcium chloride, 3 μg / L zinc sulfate, 0.3 μg / L manganese chloride, 0.3 μg / L cobalt chloride, 3 μg / L ferrous sulfate, 0.5 μg / L sodium borate, 0.05 μg / L sodium iodide, 0.13 ng / L biotin, 50 ng / L inositol, 1 ng / L thiamine, 1.5 ng / L pyridoxine, 50 ng / L para-aminobenzoic acid, 10 ng / L riboflavin, 0.1 μg / L calcium pantothenate, and 0.1 ng / L folic acid.

[0043] In step (3), the fermentation medium comprises: 2% glucose, 2% glycerol, 1% xylose, 1.5% corn steep liquor, 1% yeast extract, 1% ammonium sulfate, 1% magnesium sulfate, 1.5% potassium dihydrogen phosphate, 0.1% calcium chloride, 3 mg / L zinc sulfate, 3 mg / L manganese chloride, 3 mg / L cobalt chloride, 3 mg / L ferrous sulfate, 0.5 mg / L sodium borate, 0.05 mg / L sodium iodide, 0.3 μg / L biotin, 50 μg / L inositol, 1 μg / L thiamine, 1 μg / L pyridoxine, 1 μg / L para-aminobenzoic acid, 10 μg / L riboflavin, 0.01 μg / L calcium pantothenate, and 0.01 μg / L folic acid.

[0044] In step (3), the 60% glucose supplemented culture medium contains: 60% glucose, 10% glycerol, 2% xylose, 1% yeast extract, 0.3 mg / L biotin, 15 mg / L inositol, 1 mg / L thiamine, 1 mg / L pyridoxine, 50 mg / L para-aminobenzoic acid, 10 mg / L riboflavin, 0.1 mg / L calcium pantothenate, and 0.1 mg / L folic acid.

[0045] The carbon sources glycerol and xylose contained in the seed culture and fermentation medium are intended to induce the yeast C3 and C5 metabolic pathways, promote glucose metabolism via the PPP pathway, and provide precursors and energy for cell growth and the expression of recombinant proteins.

[0046] This invention involved high-density fermentation (5L) of a strain recombinantly expressing β-lactoglobulin A and B isoforms, and the growth and secretion properties of the strain were tested. Growth curves are shown below. Figure 3 As shown, compared with strains LHP1480 and LHP1481, strains LHP1466 and LHP1467 showed reduced growth rate and density, especially after entering the stationary phase (48 h), the cell density no longer increased, while the density of strains LHP1480 and LHP1481 continued to grow slowly.

[0047] Protein yield in the fermentation supernatant of the strain at different time points was detected by SDS-PAGE, and the results are as follows: Figure 4 As shown, all engineered strains began secreting recombinant β-lactoglobulin after 12 hours of high-density fermentation, and β-lactoglobulin gradually accumulated with increasing fermentation time, reaching its maximum yield after 72 hours of high-density fermentation. (Fim-1 Δ) hurray3 In the LHP1480 and LHP1481 strains used as the expression host, the secretion yields of β-lactoglobulin A and B isoforms reached 1.6 g / L and 3.4 g / L respectively after 72 h of fermentation. However, in the expression host Fim-1 Δ, which incorporates a disulfide isomerization pathway and knocks out the PGI gene... hurray3 In the SE / PE1 strain, expression strains LHP1466 and LHP1467, obtained by transforming vectors expressing β-lactoglobulin A and B, showed increased yields of β-lactoglobulin A and B to 5.1 g / L and 7.3 g / L, respectively. Compared with existing technologies such as invention patents CN118726120A, CN118240675A, and CN116200397A, the implementation effects achieved by this invention have significant advantages.

[0048] Table 2: Fermentation supernatant of *Kluyveromyces martensii* strain expressing β-lactoglobulin .

Claims

1. A Kluyveromyces martensii engineered strain that efficiently secretes and expresses bovine β-lactoglobulin, characterized in that, The recombinant lactoglobulin A secretory strains LHP1480 and LHP1466, and the lactoglobulin B secretory strains LHP1481 and LHP1467, were constructed using the following steps: (1) Using the strong promoter and terminator of Kluyveromyces martensii, disulfide bond forming enzyme genes in the disulfide bond isomerization pathway of Pichia pastoris were constructed respectively. ERO1 and ERV2 and disulfide bond isomerase gene PDI1 and MPD1 Expression box; then put ERO1 and ERV2 Expression frames were tandemly integrated into Kluyveromyces martensii Fim-1 Δ ura3 The chromosome 101 interface of the strain, i.e. PDC1 273-292 bp downstream of the gene CDS; similarly, ... ERO1 and ERV2 The expression cassette was tandemly integrated into the Kluyveromyces macrocarpa chromosome 201 interface, specifically 358-377 bp downstream of the CDS of the HSP60 gene. The resulting disulfide isomer pathway-enhanced strain was designated Fim-1 Δ. ura3 SE1; (2) Using CRISPR-Cas9 gene editing technology, knock out Kluyveromyces martensii Fim-1 Δ ura3 glucose phosphoisomerase gene of SE1 strain PGI1 A strain with enhanced disulfide isomerization and pentose phosphate pathways was constructed and designated Fim-1 Δ. ura3 SE / PE1; (3) Based on the codon characteristics of Kluyveromyces macrocarpa, the genes of bovine β-lactoglobulin A and B were designed and synthesized, and cloned into the Kluyveromyces macrocarpa secretory expression vector pUKDN132, respectively, to obtain recombinant plasmids pLHZ1777 and pLHZ1778 that secrete and express β-lactoglobulin A and B. (4) Recombinant plasmids pLHZ1777 and pLHZ1778 were transformed into Kluyveromyces martensii Fim-1 Δ ura3 and Fim-1Δ ura3 SE / PE1, obtained recombinant strains that secrete β-lactoglobulin A, denoted as LHP1480 and LHP1466, and strains that secrete β-lactoglobulin B, denoted as LHP1481 and LHP1467. In step (1), the disulfide bond forming enzyme gene ERO1 and ERV2 The gene was derived from Pichia pastoris, with GenBank accession numbers XM_002489600 and XM_002492510; disulfide isomerase gene. PDI1 and MPD1 Also derived from Pichia pastoris, GenBank accession numbers XM_002494247 and XM_002489421; In step (2), the glucose phosphate isomerase gene is mentioned. PGI1 The GenBank accession number is XM_022822454.1; In step (3), the bovine β-lactoglobulin A isoform has the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2; In step (3), the bovine β-lactoglobulin B isoform has the nucleotide sequence shown in SEQ ID NO.3 and the amino acid sequence shown in SEQ ID NO.4; In step (4), the Kluyveromyces Marcius Fim-1 Δ ura3 It is the uracil synthase gene that has been knocked out of the genome of Kluyveromyces martensii FIM-1 strain. URA3 The obtained strain, Kluyveromyces masculinus FIM-1, is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 10621.

2. A method for preparing β-lactoglobulin using the engineered strain of *Kluyveromyces martensii* according to claim 1, characterized in that, Using recombinant lactoglobulin-secreting strains LHP1466 or LHP1467, and LHP1480 or LHP1481, β-lactoglobulin was efficiently secreted and expressed by fed-batch fermentation in a fermenter; the specific steps are as follows: (1) Activation of strains: streak the recombinant expression strains of Kluyveromyces martensii LHP1466 or LHP1467, LHP1480 or LHP1481 on YPD solid plates and incubate at 25-35℃ for 36-48h until clones are formed. (2) Seed culture preparation: The activated Kluyveromyces martensii recombinant expression strain was inoculated into a shake flask containing seed culture medium and cultured at 25-35℃ and 200-250 rpm for 16-22 h to obtain the seed culture; (3) Fermentation tank culture: The above-mentioned Kluyveromyces martensii seed liquid was inoculated into a fermentation tank containing fermentation medium at a ratio of 5-10%, and fermented at 25-35 ℃. The pH was controlled with ammonia water to control the pH to 5.0-6.

0. After 6-8 h of fermentation, 50% glucose feed medium was added. The feed rate was dynamically adjusted according to the dissolved oxygen control (15-20%), with a flow rate range of 15-25 ml / hL and a feed time of 56-72 h.

3. The method for preparing β-lactoglobulin according to claim 2, characterized in that, The seed culture medium in step (2) comprises: 0.5-1.5% glucose, 0.5-1.5% glycerol, 0.05-0.15% xylose, 0.1-1% corn steep liquor, 0.1-1% yeast extract, 0.1-1% ammonium sulfate, 0.1-1% magnesium sulfate, 0.5-2% potassium dihydrogen phosphate, 0.05-0.2% calcium chloride, 1-5 μg / L zinc sulfate, 0.1-0.5 μg / L manganese chloride, 0.1-0.5 μg / L cobalt chloride, 1-5 μg / L ferrous sulfate, 0.1-1 μg / L sodium borate, 0.01-0.1 μg / L sodium iodide, 0.1-0.5 ng / L biotin, 10-100 ng / L inositol, 0.5-2 ng / L thiamine, 0.5-2 10-100 ng / L pyridoxine, 10-100 ng / L para-aminobenzoic acid, 1-20 ng / L riboflavin, 0.05-0.2 μg / L calcium pantothenate, 0.05-0.2 ng / L folic acid.

4. The method for preparing β-lactoglobulin according to claim 2, characterized in that, The fermentation medium in step (3) comprises: 2% glucose, 2% glycerol, 1% xylose, 1.5% corn steep liquor, 0.5-1.5% yeast extract, 0.5-1.5% ammonium sulfate, 0.1-1% magnesium sulfate, 0.5-2% potassium dihydrogen phosphate, 0.05-0.2% calcium chloride, 1-5 mg / L zinc sulfate, 0.1-0.5 mg / L manganese chloride, 0.1-0.5 mg / L cobalt chloride, 1-5 mg / L ferrous sulfate, 0.1-1 mg / L sodium borate, 0.01-0.1 mg / L sodium iodide, 0.1-0.5 μg / L biotin, 10-100 μg / L inositol, 0.5-2 μg / L thiamine, 0.5-2 μg / L pyridoxine, 10-100 μg / L para-aminobenzoic acid, 1-20 0.05-0.2 μg / L riboflavin, 0.05-0.2 μg / L calcium pantothenate, and 0.05-0.2 μg / L folic acid.

5. The method for preparing β-lactoglobulin according to claim 2, characterized in that, The glucose-supplemented culture medium in step (3) comprises: 55-65% glucose, 5-15% glycerol, 1-3% xylose, 0.5-2% yeast extract, 0.1-0.5 mg / L biotin, 10-20 mg / L inositol, 0.5-2 mg / L thiamine, 0.5-2 mg / L pyridoxine, 10-100 mg / L para-aminobenzoic acid, 1-20 mg / L riboflavin, 0.05-0.2 mg / L calcium pantothenate, and 0.05-0.2 mg / L folic acid.

Images