Autotrophic biocatalyst for producing indigo blue and derivatives thereof and application of autotrophic biocatalyst
By expressing codon-optimized phosphite dehydrogenase and flavin monooxygenase in Synechococcus, an autotrophic biocatalyst was constructed, solving the problems of resource dependence and environmental pollution in indigo production and realizing efficient and low-cost production of indigo and its derivatives.
Patent Information
- Application Number
- CN202511735705.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-24
- Publication Date
- 2026-02-06
AI Technical Summary
Existing chemical synthesis methods for producing indigo are costly, energy-intensive, and cause serious environmental pollution. In heterotrophic biosynthesis, carbon source utilization efficiency is low, and the NADPH regeneration rate limits the efficiency of indigo synthesis.
An autotrophic biocatalyst engineered strain of *Synechococcus* was constructed. By expressing codon-optimized phosphite dehydrogenase and flavin monooxygenase in *Synechococcus*, it can grow autotrophically using light energy and CO2, providing an independent supply of NADPH for the production of indigo and its derivatives.
This method enables efficient, low-cost, and environmentally friendly production of indigo and its derivatives, solving the problems of resource dependence and environmental pollution in traditional methods, and improving the synthesis rate and product titer of indigo.
Smart Images

Figure CN121472115A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering, and more particularly to an autotrophic biocatalyst for the production of indigo and its derivatives and its applications. Background Technology
[0002] Indigo is an important blue dye with a history spanning thousands of years. Thanks to its unique color and excellent colorfastness, it remains one of the most widely used and indispensable core dyes in the global textile industry (especially in denim manufacturing), with an annual global demand of tens of thousands of tons. This enormous market size makes it a major industrial target for biotechnology to replace traditional chemical processes. Furthermore, various derivatives of indigo, such as royal violet (6,6'-dibromoindigo), not only possess unique and vibrant colors but also show great application potential in the fields of biomedicine and materials science. For example, it has extremely high added value and market prospects as a lead compound for highly effective anti-tumor drugs or an organic semiconductor material.
[0003] Currently, the vast majority of commercial indigo production still relies on chemical synthesis methods developed over a century ago. This method typically begins with non-renewable petrochemical feedstocks such as aniline, making production costs closely linked to fluctuating fossil fuel prices. The chemical production of indigo involves multiple chemical reactions under extremely harsh conditions, including high temperatures, high pressures, strong acids and alkalis, and the use of highly toxic reagents such as cyanide or chloroacetic acid. This fossil-reliant production method is not only energy-intensive, complex, and costly, but also generates large amounts of toxic and hazardous industrial wastewater containing aniline, formaldehyde, and heavy metals that are difficult to degrade. This imposes a severe and lasting environmental burden on water bodies and soil, failing to meet the requirements of modern green chemistry and global sustainable development, and facing increasingly stringent environmental regulations.
[0004] In recent years, biosynthesis using microbial fermentation has been considered a promising green alternative to traditional chemical methods. This method typically involves heterologously expressing key enzymes such as flavin monooxygenase (FMO) in heterotrophic hosts like *E. coli* to convert indole into indole. However, the FMO-catalyzed indole hydroxylation and subsequent dimerization are enzymatic reactions highly dependent on molecular oxygen (O2) and cellular reducing power (NADPH or NADH). In traditional heterotrophic fermentation, both cell growth and reducing power regeneration consume expensive organic carbon sources (such as glucose). During this process, a significant portion of the carbon source (up to 50% or more) is inevitably lost as CO2 through respiration or used to synthesize the host's own biomass, rather than for the synthesis of the target product. This not only leads to high raw material costs and competition for food supplies but also results in extremely low carbon conversion efficiency. Therefore, the regeneration rate and limited supply of endogenous NADPH directly compete with the needs of maintaining basal cell growth and respiration, becoming the core metabolic bottleneck limiting the efficiency and final yield of biosynthetic indole.
[0005] Therefore, those skilled in the art are dedicated to developing an autotrophic biocatalyst for the production of indigo and its derivatives. Summary of the Invention
[0006] In view of the above-mentioned deficiencies of the prior art, the technical problem to be solved by the present invention is to develop an autotrophic biocatalyst for the production of indigo and its derivatives and its applications.
[0007] To achieve the above objectives, the present invention provides an autotrophic biocatalyst for the production of indigo and its derivatives and its application.
[0008] Furthermore, an autotrophic biocatalyst for the production of indigo and its derivatives, wherein the autotrophic biocatalyst is an engineered strain of *Synechococcus*, which is constructed by: tandem cloning a foreign gene into a plasmid, and introducing the foreign gene fragment from the plasmid into *Synechococcus* via homologous recombination. Synechococcus elongatus The genome was analyzed to obtain positive recombinant strains, which are then used to obtain engineered Synechococcus strains. The exogenous gene includes a codon-optimized phosphite dehydrogenase encoding gene. ptdh And the flavin monooxygenase encoding gene, wherein the flavin monooxygenase encoding gene is Ptfmo or Mafmo The codon-optimized phosphite dehydrogenase encoding gene ptdh The nucleotide sequence is shown in SEQ ID NO: 1; the codon-optimized flavin monooxygenase encoding gene Ptfmo The nucleotide sequence is shown in SEQ ID NO: 2, representing the codon-optimized flavin monooxygenase encoding gene.Mafmo The nucleotide sequence is shown in SEQ ID NO: 3.
[0009] Furthermore, the gene structure formed by the tandem exogenous genes contains a promoter that is operatively linked to the first gene in the tandem structure, or each gene has its own operatively linked promoter.
[0010] Furthermore, the promoter is the psbA2 promoter.
[0011] Furthermore, the phosphite dehydrogenase gene is derived from *Pseudomonas*. stutzeri ).
[0012] Furthermore, the flavin monooxygenase gene Ptfmo Derived from Polygonum tinctorium ( Persicaria tinctoria The flavin monooxygenase gene Mafmo Derived from thiamine-metaphoretic bacteria ( Methylophaga thiooxydans ).
[0013] Furthermore, the flavin monooxygenase gene Ptfmo A nucleotide sequence capable of hybridizing under stringent conditions with the complementary strand of the nucleotide sequence shown in SEQ ID NO: 2, and encoding a protein with flavin monooxygenase activity; the flavin monooxygenase gene. Mafmo A nucleotide sequence that can hybridize under stringent conditions with the complementary strand of the nucleotide sequence shown in SEQ ID NO: 3 and encodes a protein with flavin monooxygenase activity.
[0014] Furthermore, the specific preparation method of the catalyst includes the following steps: Step 1: Inoculate the engineered Synechococcus strain onto BG11 solid medium containing 20 μg / mL spectinomycin, and incubate at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days. Step 2: Inoculate a single colony into 50 mL of 5xBG phosphite liquid medium containing 20 μg / mL spectinomycin for activation at 30°C and light intensity of 100 μE·s. -1 ·m -2 Seed culture was prepared by continuous light cultivation for 7-10 days under the specified conditions. Step 3: Inoculate the seed culture into a plate-type photoreactor at a 1% (v / v) inoculation rate. Expand the culture using 5xBG phosphite liquid medium containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphate. Culture conditions: 32°C, continuous 3% (v / v) CO2 gas purging, and initial light intensity of 80 μE·s.-1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 Cultivate for 3 days; Step 4: After culture, wash the cells twice with 50 mM HEPES buffer (pH 7.0) and resuspend them at OD. 730 = 5, thus obtaining the catalyst.
[0015] Furthermore, the application of the autotrophic biocatalyst for producing indigo and its derivatives in the preparation of indigo is specifically described as follows: 10 mM potassium dihydrogen phosphite and 2.0 mM indole are added to the catalyst, and the mixture is heated at 30°C under light irradiation of 150 μE·s. -1 ·m -2 Indigo was obtained by reacting the sample in a shaker at 200 rpm for 4 h.
[0016] Furthermore, the application of the autotrophic biocatalyst for producing indigo and its derivatives in the preparation of indigo derivatives is specifically described as follows: 10 mM potassium dihydrogen phosphate and 2.0 mM indole substrate selected from 5'-chloroindole, 6'-chloroindole, 5'-bromoindole, 6'-bromoindole, 6'-methylindole, or 6'-nitroindole are added to the catalyst, and the mixture is irradiated at 30°C with 150 μE·s light. -1 ·m -2 The indigo derivative was obtained by reacting in a shaker at 200 rpm for 4 h.
[0017] Further, the indigo derivative is 5,5'-dichloroindigo, 6,6'-dichloroindigo, 5,5'-dibromoindigo, 6,6'-dibromoindigo, 6,6'-dimethylindigo, or 6,6'-dinitroindigo.
[0018] In a preferred embodiment 1 of the present invention, the expression plasmid pSyn_ is described in detail. ptdh _ Ptfmo The construction process; In another preferred embodiment 2 of the present invention, the expression plasmid pSyn_ is described in detail. ptdh _ Mafmo The construction process; In another preferred embodiment 3 of the present invention, the preparation process of the engineered bacteria S-Pt and S-Ma of Synechococcus is described in detail. In another preferred embodiment 4 of the present invention, the process of producing indigo using the engineered bacteria S-Pt of Synechococcus is described in detail. In another preferred embodiment 5 of the present invention, the process of producing indigo using the engineered bacteria Synechococcus S-Ma is described in detail. In another preferred embodiment 6 of the present invention, the process of producing 5,5'-dichloroindigo using the engineered bacteria Synechococcus faecium S-Pt is described in detail. In another preferred embodiment 7 of the present invention, the process of producing 6,6'-dichloroindigo using the engineered bacteria Synechococcus S-Pt is described in detail. In another preferred embodiment 8 of the present invention, the process of producing 5,5'-dibromoindigo using the engineered bacteria Synechococcus S-Pt is described in detail. In another preferred embodiment 9 of the present invention, the process of producing 6,6'-dibromoindigo using the engineered bacteria Synechococcus S-Pt is described in detail. In another preferred embodiment 10 of the present invention, the process of producing 6,6'-dimethyl indigo using the engineered bacteria Synechococcus S-Pt is described in detail. In another preferred embodiment 11 of the present invention, the process of producing 6,6'-dinitroindigo using the engineered bacteria Synechococcus S-Pt is described in detail. Technical effects: 1. This invention constructs a novel engineered photosynthetic microbial catalyst. By innovatively modularly assembling the indigo synthesis pathway with a phosphite-dependent reducing power regeneration system, an autotrophic production system independent of organic carbon sources is created. Specifically, the obtained engineered Synechococcus can utilize light energy and CO2 for photosynthetic autotrophy and simultaneously utilize its expressed phosphite dehydrogenase to oxidize inexpensive phosphite in the culture medium into phosphate, thereby generating a sufficient additional NADPH supply flux independent of central carbon metabolism. This design fundamentally solves the cofactor limitation bottleneck in traditional biosynthesis. This additional reducing power is specifically directed to key oxygenases such as flavin monooxygenase (FMO), effectively resolving the intense competition for NADPH between the indigo synthesis pathway and endogenous Calvin cycle carbon fixation pathways, forming a dual reducing power supply system synergistically combining photosynthesis and phosphite oxidation. This system solves the problem of slow photosynthetic autotrophic growth during the growth stage, achieving high-density catalyst preparation; and significantly improves the synthesis rate, product titer, and conversion efficiency of indigo during the catalytic stage.
[0019] 2. This invention employs a two-stage process of "high-density growth - high-efficiency catalysis". This process is clear, easy to control, and has good scale-up characteristics, enabling large-scale production directly in a standard photobioreactor.
[0020] In summary, this invention uses inexpensive light energy, CO2, and industrial-grade phosphite as the main raw materials, thus eliminating the dependence on expensive sugars. It has multiple advantages such as low raw material costs, high production efficiency, and environmental friendliness, providing a practical and feasible industrialization path for the large-scale, low-cost, and clean production of indigo and its high-value-added derivatives.
[0021] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description
[0022] Figure 1 This is a schematic diagram illustrating the principle of the method of the present invention; Figure 2 This is a schematic diagram of exogenous gene integration in a preferred embodiment 3 of the present invention; Figure 3 This is a graph showing the change in indigo catalytic titer as a function of indole concentration in preferred embodiments 4-5 of the present invention; Figure 4 This is a catalytic titer diagram of different indigo derivatives in the preferred embodiments 6-11 of the present invention. Detailed Implementation
[0023] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.
[0024] The strains and growth conditions used in this invention are as follows: The cloning host DH5α was purchased from Invitrogen. All E. coli were cultured in LB medium containing 100 mg / L spectinomycin at 37°C.
[0025] Synechococcus ( Synechococcus elongatus PCC7942 was purchased from the American Type Culture Collection. During the construction phase, *Synechococcus* was grown in BG11 liquid medium with 1.3% agar powder added to the solid medium. Culture conditions: 32°C, light intensity 100 μE·s. -1 ·m -2 The transformed genetically engineered algal strains were cultured in 5xBG medium supplemented with 20 mg / L spectinomycin under the following conditions: 32°C, continuous purging of 3% CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2It increased to 400 μE·s after 2 days. -1 ·m -2 .
[0026] The LB medium formulation is as follows: peptone 10 g / L; yeast extract 5 g / L; NaCl 5 g / L; pH 7.0; The formula for the BG11 liquid culture medium is as follows: 10 ml of BG11 stock solution; 1 ml of ferric ammonium citrate solution (6 g / L); 1 ml of Na2CO3 solution (20 g / L); 1 ml of K2HPO4 solution (30.5 g / L); and distilled water to a final volume of 1 L. The formula for the above BG11 mother liquor is as follows: NaNO3 149.6 g; MgSO4·7H2O 7.5 g; CaCl2·2H2O 3.6 g; citric acid 0.6 g; EDTA-2Na solution (pH 8.0, concentration 0.25 M) 1.12 ml; 100 ml trace element solution; distilled water to a final volume of 1 L; The formula for the above trace element solution is as follows: H3BO3 2.86 g; MnCl2·7H2O 1.81 g; ZnSO4·7H2O 0.22 g; Na2MoO4·2H2O 0.39 g; CuSO4·5H2O 0.079 g; Co(NO3)2·6H2O 0.049 g; distilled water to a final volume of 1 L; The formulation of the 5xBG phosphite liquid culture medium is as follows: 50 ml of BG11 stock solution; 5 ml of ferric ammonium citrate solution (6 g / L); 5 ml of Na2CO3 solution (20 g / L); 5 ml of KH2PO3 solution (120.1 g / L); and distilled water to a final volume of 1 L.
[0027] All plasmids were pSyn_6 (purchased from Invitrogen) derived plasmids, used to express the target gene by homologous recombination integration into the genome of Synechococcus.
[0028] Example 1: Construction of expression plasmid pSyn_ ptdh _ Ptfmo
[0029] (1) Extraction of pSyn_6 plasmid: Escherichia coli DH5α containing pSyn_6 plasmid was inoculated at a rate of 1% into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.) according to the instructions.
[0030] (2) Synthesis ptdh , Ptfmo Gene fragments: Using the online software JCat, the gene encoding phosphite dehydrogenase in *Synechococcus* was identified based on codon bias. ptdh The gene encoding flavin monooxygenase in Polygonum tinctoria Ptfmo Perform codon optimization, after optimization ptdh The nucleotide sequence is shown in SEQ ID NO: 1. Ptfmo The nucleotide sequence is shown in SEQ ID NO: 2. All sequences were synthesized by Genewiz.
[0031] (3) Amplifying gene fragments: Using the gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. The PCR primers for each fragment are as follows, and the nucleotide sequences are shown in SEQ ID NO: 4-7: Segment 1: ptdh (SEQ ID NO: 4-5) Upstream primer ptdh.F: GAAGGAGCGTCAGATCTCATATGCTGCCGAAACTGGTTATCACTC, Downstream primer ptdh.R: tacctcctttagaatagtttcgagTTAACATGCGGCCGGCTC.
[0032] Segment 2: Ptfmo (SEQ ID NO: 6-7)
[0033] Upstream primer Ptfmo.F: aaactattctaaaggaggtaaactatggaattcGAGCGCAAGGTTGG, Downstream primer Ptfmo.R: TTGCCTGGTACCGCGGATCCTTAGCCAATATAGTCCAGCGGGCC.
[0034] (4) The pSyn_6 plasmid extracted in step (1) was double-digested with NEB restriction endonucleases NdeI and BamHI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the method described in the instruction manual. The plasmid obtained in step (3) ptdh , PtfmoThe fragment and the recovered pSyn_6 plasmid were seamlessly cloned using the Vazyme ClonExpress Ultra One Step Cloning Kit according to the method described in the instruction manual to obtain the recombinant plasmid pSyn_ ptdh _ Ptfmo .
[0035] Example 2: Construction of expression plasmid pSyn_ ptdh _ Mafmo
[0036] (1) Extraction of pSyn_6 plasmid: Escherichia coli DH5α containing pSyn_6 plasmid was inoculated at a rate of 1% into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.) according to the instructions.
[0037] (2) Synthesis ptdh , Mafmo Gene fragments: Using the online software JCat, the gene encoding phosphite dehydrogenase in *Synechococcus* was identified based on codon bias. ptdh The gene encoding flavin monooxygenase in Thiamine methylphage Mafmo Perform codon optimization, after optimization ptdh The nucleotide sequence is shown in SEQ ID NO: 1. Mafmo The nucleotide sequence is shown in SEQ ID NO: 3. All sequences were synthesized by Genewiz.
[0038] (3) Amplifying gene fragments: Using the gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. The PCR primers for each fragment are as follows, and the nucleotide sequences are shown in SEQ ID NO: 4-5 and SEQ ID NO: 8-9, respectively: Segment 1: ptdh (SEQ ID NO: 4-5) Upstream primer ptdh.F: GAAGGAGCGTCAGATCTCATATGCTGCCGAAACTGGTTATCACTC, Downstream primer ptdh.R: tacctcctttagaatagtttcgagTTAACATGCGGCCGGCTC.
[0039] Segment 2: Mafmo(SEQ ID NO: 8-9)
[0040] Upstream primer Mafmo.F: aaactattctaaaggaggtaaactatggaattcGCAACTCGTATTGCGATCCTGG, Downstream primer Mafmo.R: TTGCCTGGTACCGCGGATCCTTAAGCTTCTTTAGCCACCGGAATTTCG.
[0041] (4) The pSyn_6 plasmid extracted in step (1) was double-digested with NEB restriction endonucleases NdeI and BamHI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the method described in the instruction manual. The plasmid obtained in step (3) Ptdh , Mafmo The fragment and the recovered pSyn_6 plasmid were seamlessly cloned using the Vazyme ClonExpress Ultra One Step Cloning Kit according to the method described in the instruction manual to obtain the recombinant plasmid pSyn_ Ptdh _ Mafmo .
[0042] Example 3: Transformation of Synechococcus and Obtaining Engineered Synechococcus bacteria
[0043] (1) Transformation of Synechococcus strains
[0044] Take the logarithmic growth phase (OD) 730 Collect 10 ml of *Synechococcus* cells (0.4-0.8 g / mL), centrifuge at 5000 rpm for 5 minutes, wash once with sterile 10 mM NaCl, and resuspend the cells in 5 ml of fresh BG11 medium. Transfer 500 μL of the bacterial culture to an EP tube, add the recombinant plasmid prepared in Example 1 or Example 2 to a final concentration of 100 ng / mL, mix well, and incubate at 30°C in the dark for 12-18 hours. Spread the mixture of photosynthetic microbial cells and recombinant plasmid DNA onto BG11 solid medium (containing 20 μg / mL spectinomycin) and incubate at 32°C, 100 μE·s⁻¹. -1 ·m -2 Cultured under continuous light intensity for 10-14 days until single colonies appear on solid culture medium.
[0045] (2) Obtaining engineered Synechococcus strains
[0046] Positive transformants were picked from the solid culture medium after transformation as described in step (1) and inoculated into 5 ml of fresh BG11 liquid culture medium (containing 20 μg / mL spectinomycin) and placed at 32°C and 100 μE·s. -1 ·m -2 The microorganisms were cultured under continuous light intensity for 7-10 days. Genomic DNA of the genetically engineered photosynthetic microorganisms was prepared using conventional methods, referring to the small-scale preparation method of biological genomes in "A Concise Guide to Molecular Biology" published by Science Press. Using the genome of the genetically engineered photosynthetic microorganisms as a template, PCR amplification was performed using primers for the amplification of exogenous genes on the recombinant plasmid, according to the method described in "Molecular Cloning: A Laboratory Manual (Third Edition)".
[0047] Recombinant plasmid pSyn_ ptdh _ Ptfmo pSyn_ ptdh _ Mafmo The exogenous gene was integrated into the neutral site 1 (NSI) of the Synechococcus genome via homologous recombination, such as... Figure 2 As shown, engineered strains of Synechococcus were obtained, namely S-Pt and S-Ma.
[0048] (3) Preservation of engineered Synechococcus strains
[0049] The engineered Synechococcus strains S-Pt and S-Ma obtained in step (2) were inoculated into BG11 liquid medium containing 20 μg / mL spectinomycin and placed at 32°C and 100 μE·s. -1 ·m -2 Under continuous light intensity, culture for 7-10 days. Under aseptic conditions, add 1 mL of the overnight culture to a sterile 1.5 mL centrifuge tube and centrifuge at 5000 rpm for 3 min. Discard the supernatant, resuspend the bacterial pellet in sterile 15% glycerol solution to prepare glycerol stock tubes, which can be stored at -20°C for 6 months to 1 year. Every 6 months, reactivate the engineered Synechococcus strains S-Pt and S-Ma stored in the glycerol stock tubes and re-store the glycerol stock tubes.
[0050] Example 4: Production of indigo using the engineered bacteria S-Pt from Synechococcus.
[0051] (1) Solid culture: The engineered Synechococcus strain S-Pt was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days.
[0052] (2) Seed culture: The S-Pt engineered strain cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0053] (3) Scale-up culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculum rate of 1% (v / v). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (v / v) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0054] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730 = 5, thus obtaining the S-Pt catalyst.
[0055] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst prepared in step (4), and the indole concentrations were set to 0.0, 0.5, 1.0, 1.5, 2.0 and 2.5 mM, respectively. The reaction was carried out at 30°C under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker at 200 rpm for 4 h.
[0056] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without added indole substrate (0 mM) showed no color and no product was detected; the extracts of the experimental groups (0.5, 1.0, 1.5, 2.0, and 2.5 mM) turned blue. Figure 3 As shown, the indigo concentrations corresponding to different indole concentrations (0.5, 1.0, 1.5, 2.0 and 2.5 mM) were 0.23 ± 0.012, 0.45 ± 0.037, 0.69 ± 0.033, 0.88 ± 0.051 and 0.36 ± 0.038 mM (three biological parallels).
[0057] Example 5: Production of indigo using the engineered strain S-Ma of Synechococcus.
[0058] (1) Solid culture: The engineered Synechococcus strain S-Ma was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies of the engineered Synechococcus strain S-Ma were obtained by continuous culturing under light intensity for 10-15 days.
[0059] (2) Seed culture: The S-Ma engineered Synechococcus strain cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0060] (3) Scale-up culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculum rate of 1% (v / v). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (v / v) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0061] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730 = 5, thus obtaining the S-Ma catalyst.
[0062] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst, and the indole concentrations were set to 0.0, 0.5, 1.0, 1.5, 2.0 and 2.5 mM, respectively. The reaction was carried out at 30°C under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker at 200 rpm for 4 h.
[0063] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without added indole substrate (0 mM) showed no color and no product was detected; the extracts of the experimental groups (0.5, 1.0, 1.5, 2.0, and 2.5 mM) turned blue. Figure 3 As shown, the indigo concentrations corresponding to different indole concentrations (0.5, 1.0, 1.5, 2.0 and 2.5 mM) were 0.13 ± 0.009, 0.21 ± 0.031, 0.24 ± 0.012, 0.04 ± 0.015 and 0.03 ± 0.020 mM (three biological parallels).
[0064] Example 6: Production of 5,5'-dichloroindigo using the engineered strain S-Pt of Synechococcus.
[0065] (1) Solid culture: The engineered Synechococcus strain S-Pt was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days.
[0066] (2) Seed culture: The S-Pt engineered strain cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0067] (3) Scale-up culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculum rate of 1% (v / v). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (v / v) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0068] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730= 5, thus obtaining the S-Pt catalyst, which is used to produce 5,5'-dichloroindigo.
[0069] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst, and the concentrations of 5'-chloroindole were set to 0.0 and 2.0 mM, respectively. The reaction was carried out at 30°C and 200 rpm under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker for 4 hours.
[0070] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without 5'-chloroindole (0 mM) showed no color and no product was detected; the extract of the group with 2.0 mM 5'-chloroindole showed a blue color, and the concentration of 5,5'-dichloroindole was 0.61 ± 0.092 mM (three biological parallels). Figure 4 As shown.
[0071] Example 7: Production of 6,6'-dichloroindigo using the engineered Synechococcus strain S-Pt
[0072] (1) Solid culture: The engineered Synechococcus strain S-Pt was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days.
[0073] (2) Seed culture: The single colony of photosynthetic microorganism S-Pt cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0074] (3) Scale-up culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculum rate of 1% (v / v). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (v / v) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0075] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730 = 5, thus obtaining the S-Pt catalyst, which is used to produce 6,6'-dichloroindigo.
[0076] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst, and the concentrations of 6'-chloroindole were set to 0.0 and 2.0 mM, respectively. The reaction was carried out at 30°C under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker at 200 rpm for 4 h.
[0077] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without 6'-chloroindole (0 mM) showed no color and no product was detected; the extract of the group with 2.0 mM 6'-chloroindole showed a purple color, and the concentration of 6,6'-dichloroindole was 0.81 ± 0.031 mM (three biological parallels). Figure 4 As shown.
[0078] Example 8: Production of 5,5'-dibromoindigo using the engineered Synechococcus strain S-Pt
[0079] (1) Solid culture: The engineered Synechococcus strain S-Pt was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days.
[0080] (2) Seed culture: The S-Pt engineered strain cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seeds were obtained by culturing the seeds under continuous light intensity for 7-10 days.
[0081] (3) Scale-up culture: The seeds obtained in step (2) were inoculated into a flat-plate photoreactor at an inoculum rate of 1% (volume ratio). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (volume ratio) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0082] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730 = 5, thus obtaining the S-Pt catalyst, which is used to produce 5,5'-dibromoindigo.
[0083] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst, and the concentrations of 5'-bromoindole were set to 0.0 and 2.0 mM, respectively. The reaction was carried out at 30°C under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker at 200 rpm for 4 h.
[0084] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without 5'-bromoindole (0 mM) showed no color and no product was detected; the extract of the group with 2.0 mM 5'-bromoindole showed a blue color, and the concentration of 5,5'-dibromoindole was 0.44 ± 0.033 mM (three biological parallels). Figure 4 As shown.
[0085] Example 9 Production of 6,6'-Dibromoindigo using the engineered Synechococcus strain S-Pt
[0086] (1) Solid culture: The engineered Synechococcus strain S-Pt was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days.
[0087] (2) Seed culture: The single colony of photosynthetic microorganism S-Pt cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0088] (3) Scale-up culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculum rate of 1% (v / v). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (v / v) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0089] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730 = 5, thus obtaining the S-Pt catalyst, which is used to produce 6,6'-dibromoindigo.
[0090] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst, and the concentrations of 6'-bromoindole were set to 0.0 and 2.0 mM, respectively. The reaction was carried out at 30°C under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker at 200 rpm for 4 h.
[0091] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without 6'-bromoindole (0 mM) showed no color and no product was detected; the extract of the group with 2.0 mM 6'-bromoindole showed a deep purple color, and the concentration of 6,6'-dibromoindole was 0.73 ± 0.064 mM (three biological parallels). Figure 4 As shown.
[0092] Example 10 Production of 6,6'-dimethyl indigo using the engineered strain S-Pt of Synechococcus: (1) Solid culture: The engineered Synechococcus strain S-Pt was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days.
[0093] (2) Seed culture: The single colony of photosynthetic microorganism S-Pt cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s-1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0094] (3) Scale-up culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculum rate of 1% (v / v). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (v / v) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0095] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730 = 5, thus obtaining the S-Pt catalyst, which is used to produce 6,6'-dimethylindigo.
[0096] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst, and the concentrations of 6'-methylindole were set to 0.0 and 2.0 mM, respectively. The reaction was carried out at 30°C under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker at 200 rpm for 4 h.
[0097] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without 6'-methylindole (0 mM) showed no color and no product was detected; the extract of the group with 2.0 mM 6'-methylindole showed a gray-blue color, and the concentration of 6,6'-dimethylindole was 0.67 ± 0.074 mM (three biological parallels). Figure 4 As shown.
[0098] Example 11 Production of 6,6'-dinitroindigo using the engineered strain S-Pt of Synechococcus: (1) Solid culture: The engineered Synechococcus strain S-Pt was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days.
[0099] (2) Seed culture: The S-Pt engineered strain cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0100] (3) Scale-up culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculum rate of 1% (v / v). The culture was scaled up in 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphite). The culture conditions were: 32°C, continuous introduction of 3% (v / v) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , 3 days of cultivation.
[0101] (4) Catalyst preparation: After culture, the cells were collected by centrifugation, washed twice with 50 mM HEPES buffer (pH 7.0), and resuspended at OD. 730 = 5, thus obtaining the S-Pt catalyst, which is used to produce 6,6'-dinitroindigo.
[0102] (5) Catalytic reaction: 10 mM potassium dihydrogen phosphite was added to the catalyst, and the concentrations of 6'-nitroindole were set to 0.0 and 2.0 mM, respectively. The reaction was carried out at 30°C under light irradiation of 150 μE·s. -1 ·m -2 The reaction was carried out in a shaker at 200 rpm for 4 h.
[0103] (6) Sample processing and detection: Take 100 μL of the reaction sample, add 900 μL of anhydrous ethanol, and analyze the yield by HPLC. The extract of the control group without 6'-nitroindole (0 mM) showed no color and no product was detected; the extract of the group with 2.0 mM 6'-nitroindole showed a brownish-yellow color, and the concentration of 6,6'-dinitroindole was 0.43 ± 0.040 mM (three biological parallels). Figure 4 As shown.
[0104] The principle of this invention: This invention addresses the cost deficiencies of heterotrophic catalysts and the efficiency deficiencies of autotrophic catalysts by innovatively introducing the encoding genes of key oxygenases (flavin monooxygenase, FMO) for indigo synthesis and phosphite dehydrogenase (Ptdh) into photosynthetic microorganisms (such as cyanobacteria).
[0105] In the preparation (growth) stage of the catalyst, i.e., the engineered photosynthetic microorganism, this invention simultaneously supplies carbon dioxide and inexpensive inorganic salt phosphite in the culture medium. The engineered photosynthetic microorganisms of this invention utilize their endogenous photosynthetic system to grow autotrophically based on light energy and carbon dioxide, thus solving the dependence on organic carbon sources. Furthermore, their expressed phosphite dehydrogenase oxidizes phosphite in the culture medium to phosphate, generating an additional reducing power supply independent of photosynthesis in the process. This additional reducing power flux is introduced into the cell's central carbon metabolism, enhancing the efficiency of carbon dioxide fixation in the Calvin cycle, thereby converting more carbon into cell biomass and accelerating cell growth. This invention simultaneously solves two core problems in catalyst preparation: economically and socially, it uses free light energy, carbon dioxide, and inexpensive inorganic salts to replace expensive glucose, reducing raw material costs and avoiding competition with food; technically, it overcomes the bottleneck of slow photosynthetic autotrophic growth through the additional reducing power provided by phosphite, enabling the catalyst to rapidly proliferate and achieve the high cell density required for industrial production, greatly shortening the preparation cycle.
[0106] In the biocatalytic (production) stage of indigo, a dual reducing power supply system is constructed by simultaneously supplying light and phosphite to a high-density cell suspension, utilizing a phosphite dehydrogenase system already stably expressed in the catalyst. During the catalytic stage, the total reducing power supply within the cell is provided by two parallel pathways: first, the photosynthetic system absorbs light energy to generate reducing power; second, phosphite dehydrogenase oxidizes phosphite to generate reducing power. These two reducing powers converge into the cell's reducing power pool, forming an extremely rich and powerful reducing power supply. This vast reducing power supply pool is sufficient to simultaneously meet the high-speed catalytic needs of flavin monooxygenase and the needs of maintaining the cell's basic vitality. This invention provides reducing power far exceeding the cell's basic needs through the dual input of light energy and phosphite inorganic chemical energy, fundamentally eliminating the competition between product synthesis and cell maintenance. This allows the FMO enzyme to operate at high load, maximizing the synthesis rate and final yield of indigo. Technically, this dual supply model ensures that the catalyst maintains high bioactivity while being produced efficiently, extending the catalyst's lifespan and achieving the highest efficiency production of indigo and its derivatives.
[0107] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.
Claims
1. An autotrophic biocatalyst for the production of indigo and its derivatives, characterized in that, The autotrophic biocatalyst is a Synechococcus engineered bacterium, which is constructed by the following method: tandem cloning of a foreign gene into a plasmid, and then introducing the foreign gene fragment from the plasmid into Synechococcus through homologous recombination. Synechococcus elongatus The genome was analyzed to obtain positive recombinant strains, which are then used to obtain engineered Synechococcus strains. The exogenous gene includes a codon-optimized phosphite dehydrogenase encoding gene. ptdh And the flavin monooxygenase encoding gene, wherein the flavin monooxygenase encoding gene is Ptfmo or Mafmo The codon-optimized phosphite dehydrogenase encoding gene ptdh The nucleotide sequence is shown in SEQ ID NO: 1; the codon-optimized flavin monooxygenase encoding gene Ptfmo The nucleotide sequence is shown in SEQ ID NO: 2, representing the codon-optimized flavin monooxygenase encoding gene. Mafmo The nucleotide sequence is shown in SEQ ID NO:
3.
2. The autotrophic biocatalyst for producing indigo and its derivatives as described in claim 1, characterized in that, The specific preparation method of the catalyst includes the following steps: Step 1: Inoculate the engineered Synechococcus strain onto BG11 solid medium containing 20 μg / mL spectinomycin, and incubate at 32°C and 100 μE·s. -1 ·m -2 Single colonies were obtained by culturing under continuous light intensity for 10-15 days. Step 2: Inoculate a single colony into 50 mL of 5xBG phosphite liquid medium containing 20 μg / mL spectinomycin for activation at 30°C and light intensity of 100 μE·s. -1 ·m -2 Seed culture was prepared by continuous light cultivation for 7-10 days under the specified conditions. Step 3: Inoculate the seed culture into a plate-type photoreactor at a 1% (v / v) inoculation rate. Expand the culture using 5xBG phosphite liquid medium containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphate. Culture conditions: 32°C, continuous 3% (v / v) CO2 gas purging, and initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 Cultivate for 3 days; Step 4: After culture, wash the cells twice with 50 mM HEPES buffer (pH 7.0) and resuspend them at OD. 730 =5, thus obtaining the catalyst.
3. The autotrophic biocatalyst for producing indigo and its derivatives as described in claim 1, characterized in that, A gene structure formed by tandem exogenous genes contains a promoter that is operatively linked to the first gene in the tandem structure, or each gene has its own operatively linked promoter.
4. The autotrophic biocatalyst for producing indigo and its derivatives as described in claim 3, characterized in that, The promoter is the psbA2 promoter.
5. The autotrophic biocatalyst for producing indigo and its derivatives as described in claim 1, characterized in that, The phosphite dehydrogenase gene is derived from *Pseudomonas schistosomiasis* (…). Pseudomonas stutzeri ).
6. The autotrophic biocatalyst for producing indigo and its derivatives as described in claim 1, characterized in that, The flavin monooxygenase gene Ptfmo Derived from Indigofera tinctoria ( Persicaria tinctoria The flavin monooxygenase gene Mafmo Derived from thiamine-metaphoretic bacteria ( Methylophaga thiooxydans ).
7. The autotrophic biocatalyst for producing indigo and its derivatives as described in claim 1, characterized in that, The flavin monooxygenase gene Ptfmo A nucleotide sequence capable of hybridizing under stringent conditions with the complementary strand of the nucleotide sequence shown in SEQ ID NO: 2, and encoding a protein with flavin monooxygenase activity; the flavin monooxygenase gene. Mafmo A nucleotide sequence that can hybridize under stringent conditions with the complementary strand of the nucleotide sequence shown in SEQ ID NO: 3 and encodes a protein with flavin monooxygenase activity.
8. The application of the autotrophic biocatalyst for producing indigo and its derivatives as described in claim 1 in the preparation of indigo, characterized in that, The specific method is as follows: 10 mM potassium dihydrogen phosphite and 2.0 mM indole are added to the catalyst, and the mixture is heated at 30°C under light at 150 μE·s. -1 ·m -2 Indigo was obtained by reacting the sample in a shaker at 200 rpm for 4 h.
9. The application of the autotrophic biocatalyst for producing indigo and its derivatives as described in claim 1 in the preparation of indigo derivatives, characterized in that, The specific method is as follows: 10 mM potassium dihydrogen phosphite and 2.0 mM indole substrate selected from 5'-chloroindole, 6'-chloroindole, 5'-bromoindole, 6'-bromoindole, 6'-methylindole, or 6'-nitroindole are added to the catalyst, and the mixture is irradiated at 30°C with light at 150 μE·s. -1 ·m -2 The indigo derivative was obtained by reacting in a shaker at 200 rpm for 4 h.
10. The application of the autotrophic biocatalyst for producing indigo and its derivatives as described in claim 9 in the preparation of indigo derivatives, characterized in that, The indigo derivative is 5,5'-dichloroindigo, 6,6'-dichloroindigo, 5,5'-dibromoindigo, 6,6'-dibromoindigo, 6,6'-dimethylindigo, or 6,6'-dinitroindigo.