A method for constructing an aflatoxin b1-degrading enzyme

Abstract

The application provides a construction method of aflatoxin B1 degrading enzyme, which takes original aflatoxin B1 degrading enzyme as a starting enzyme, only mutates alanine at the 367th position of the original aflatoxin B1 degrading enzyme into glutamic acid, glutamic acid at the 445th position into lysine, isoleucine at the 477th position into glutamic acid, or only mutates threonine at the 258th position of the original aflatoxin B1 degrading enzyme into alanine, alanine at the 367th position into glutamic acid, glutamic acid at the 445th position into lysine, isoleucine at the 477th position into glutamic acid, and the amino acid sequence of the original aflatoxin B1 degrading enzyme is shown in SEQ ID NO:1; and the method of the application utilizes a combined mutation method to improve the specific enzyme activity of the aflatoxin B1 degrading enzyme without the need of an electron donor.

Description

TECHNICAL FIELD

[0001] The present application relates to a construction method of aflatoxin B1 degrading enzyme, and belongs to the technical field of enzyme engineering. BACKGROUND

[0002] Fungal toxins are secondary metabolites synthesized by filamentous fungi such as Aspergillus, Fusarium and Penicillium, which can cause serious diseases in humans and animals; aflatoxin B1 can exist in soil, water, animal bodies and food for a long time, and aflatoxin B1 has high biological accumulation efficiency, and is carcinogenic, nephrotoxic, hepatotoxic, genotoxic and neurotoxic to humans and animals.

[0003] Aflatoxin B1 is chemically stable, and can exist stably and accumulate gradually in the natural environment, such as soil, water, etc.; aflatoxin B1 in soil, water, etc. enters the human body through the food chain, thereby producing toxic effects on the human body; environmental aflatoxins have become one of the objects of increasing concern in environmental protection; using a green and efficient method to degrade environmental fungal toxins-aflatoxin B1 is a problem to be solved for protecting the environment and maintaining the health of the people.

[0004] Enzymatic degradation of aflatoxin B1 is a green and environmentally friendly method; compared with physical or chemical methods for degrading aflatoxin B1, enzymatic degradation has the advantages of low cost, no pollution, easy handling, convenient operation, and high efficiency; enzymatic degradation is the most promising and potential green method for removing aflatoxin B1 in the environment, but aflatoxin B1 degrading enzyme often needs an electron donor to degrade aflatoxin; the addition of an electron donor such as ABTS (3-ethylbenzothiazoline-6-sulfonic acid) not only increases the complexity of the operation process, but also causes environmental pollution; therefore, improving the degradation performance of aflatoxin B1 degrading enzyme without an electron donor has a broad application prospect.

[0005] Increasing the specific activity of aflatoxin B1 degrading enzyme not only helps to improve the degradation efficiency of aflatoxin B1 in the environment, but also reduces the amount of enzyme used and the cost of enzyme, thereby being more conducive to environmental protection in a green and low-cost way; therefore, how to provide a degrading enzyme that can efficiently degrade aflatoxin B1 without an electron donor is a problem to be solved by those skilled in the art. SUMMARY

[0006] The present application provides a construction method of aflatoxin B1 degrading enzyme, which aims to improve the specific activity of aflatoxin B1 degrading enzyme without an electron donor.

[0007] The technical solution of the present application is a construction method of aflatoxin B1 degrading enzyme, which takes original aflatoxin B1 degrading enzyme as starting enzyme, only mutates alanine at the 367th position of the original aflatoxin B1 degrading enzyme into glutamic acid, glutamic acid at the 445th position into lysine, and isoleucine at the 477th position into glutamic acid, and the amino acid sequence of the original aflatoxin B1 degrading enzyme is shown in SEQ ID NO: 1.

[0008] The technical solution of the present application is a construction method of aflatoxin B1 degrading enzyme, which takes original aflatoxin B1 degrading enzyme as starting enzyme, only mutates alanine at the 367th position of the original aflatoxin B1 degrading enzyme into glutamic acid, glutamic acid at the 445th position into lysine, and isoleucine at the 477th position into glutamic acid, and the amino acid sequence of the original aflatoxin B1 degrading enzyme is shown in SEQ ID NO: 1.

[0009] Further, a mutant for constructing aflatoxin B1 degrading enzyme is a three-site combination mutant E6, and the amino acid sequence of the three-site combination mutant E6 is shown in SEQ ID NO: 13.

[0010] Further, a mutant for constructing aflatoxin B1 degrading enzyme is a four-site combination mutant E5, and the amino acid sequence of the four-site combination mutant E5 is shown in SEQ ID NO: 11.

[0011] Further, the construction method of the four-site combination mutant E5 comprises: first obtaining a degrading enzyme optimized coding sequence and constructing a basic expression vector pET28a(+)-B1H; then screening four candidate mutation sites, and constructing the four-site combination mutant E5 according to the four candidate mutation sites.

[0012] Further, the four-site combination mutant E5 is suitable for expression in E.coli.

[0013] Further, the constructed degrading enzyme is suitable for degradation of aflatoxin B1 without an electron donor.

[0014] Further, the constructed degrading enzyme is suitable for environmental conditions with a temperature of 80 DEG C and a pH value of 9.

[0015] The present application uses the method of combination mutation to improve the specific enzyme activity of aflatoxin B1 degrading enzyme without the need for an electron donor. BRIEF DESCRIPTION OF DRAWINGS

[0016] ATTACH Figure 1Figure 1 is an electrophoresis picture of PCR products of colonies transformed in Example 1; Lane M: Marker; Lanes 1-5: five single colony PCR products picked up.

[0017] Figure 2 is an agarose gel electrophoresis picture of PCR products of site-directed mutation T258A in Example 1; Lane M: Marker; Lane 1: mutation at site 258 (T258A). Figure 2 Figure 3 is an agarose gel electrophoresis picture of PCR products of A367E, E445K, I477E mutations in Example 1; Lane M: Marker; Lane 1: mutation at site 367; Lane 2: mutation at site 445; Lane 3: mutation at site 477.

[0018] Figure 3 Figure 4 is an SDS-PAGE electrophoresis picture of purified products of recombinant protein; Lane M: Marker; Lane 1: protein purification.

[0019] Figure 5 is a specific embodiment of the present application. Figure 4 DETAILED DESCRIPTION

[0020] The present application is a construction method of aflatoxin B1 degrading enzyme, which relates to a method of combined mutation, and improves the specific enzyme activity of aflatoxin B1 degrading enzyme; the method of the present application comprises the following steps: firstly, obtaining an optimized coding sequence of degrading enzyme suitable for expression in E. coli and constructing a basic expression vector pET28a(+)-B1H; then, screening four candidate mutation sites T258, A367, E445 and I477, and constructing single-point mutant E1, single-point mutant E2, single-point mutant E3 and single-point mutant E4 according to the four candidate mutation sites, and constructing four-site combined mutant E5 (T258A / A367E / E445K / I477E) on the basis.

[0021] The experimental results show that the specific enzyme activity of the four-site combined mutant E5 is significantly improved (up to 0.953 U / mg, 15.88 times of the original enzyme) under the optimal reaction conditions without an electron donor, thereby improving the degradation efficiency of aflatoxin B1 in the environment.

[0022] The present application is further illustrated by the following examples, and the experimental methods in the following examples not specified in the specific conditions are basically operated according to the conditions described in the common molecular cloning manual.

[0023] Example 1

[0024] ​​The original aflatoxin B1 degrading enzyme is used as the starting enzyme in this embodiment, and the technical route of "molecular three-dimensional model construction - molecular docking and affinity analysis with AFB1 - candidate positive mutation site screening - single point mutation verification - combination mutation construction - expression and purification and evaluation of specific enzyme activity without electron donor" is used to obtain a mutant that can efficiently degrade aflatoxin B1 without additional electron donor.

[0025] The construction method of aflatoxin B1 degrading enzyme in this embodiment specifically includes the following steps:

[0026] 1) Construction of initial aflatoxin B1 degrading enzyme expression vector;

[0027] 2) Transformation of the constructed vector E. coli BL21;

[0028] 3) Construction of aflatoxin B1 degrading enzyme mutant E1, E2, E3, E4 expression vector;

[0029] 4) Construction of aflatoxin B1 degrading enzyme mutant E5;

[0030] 5) Expression of aflatoxin B1 degrading enzyme E5;

[0031] 6) Purification of aflatoxin B1 degrading enzyme E5;

[0032] 7) Optimum temperature, optimum pH analysis, and specific enzyme activity determination of aflatoxin B1 degrading enzyme E5.

[0033] The construction of the initial aflatoxin B1 degrading enzyme expression vector specifically includes the following steps:

[0034] 1-1) Extract plasmid pET-28a(+) using plasmid extraction kit, which is purchased from Shenguo Bioengineering (Shanghai) Co., Ltd.;

[0035] 1-2) Synthesis of aflatoxin B1 degrading enzyme coding base sequence, and restriction enzyme digestion of plasmid pET-28a(+) and optimized coding base sequence of aflatoxin B1 degrading enzyme; This step aims to obtain an optimized coding sequence of aflatoxin B1 degrading enzyme suitable for expression in E. coli with EcoR I and Not I restriction enzyme sites, and to obtain a linearized pET-28a(+) vector paired therewith, in order to construct an expression vector later and serve as the basis for site-directed mutation and expression verification;

[0036] 1-3) Recovery of fragments, digestion of plasmids, and ligation of enzyme-optimized coding base sequence and plasmids.

[0037] The plasmid pET-28a(+) extraction using plasmid extraction kit specifically includes the following steps:

[0038] 1-1-1) Equilibration of the adsorption column: The adsorption column was first placed in a collection tube, then 400 μL of equilibration buffer Buffer BL2 was added to the adsorption column, centrifuged at 12,000 r / m for 60 s, the filtrate in the collection tube was discarded, and the adsorption column was placed back into the collection tube;

[0039] 1-1-2) Bacterial cell precipitation: The DH5a bacterial solution carrying the plasmid pET-28a(+) preserved in the refrigerator was inoculated into LB culture medium containing 50 μg / mL kanamycin and cultured for 10 h; 12 mL of the cultured bacterial solution was centrifuged at 12,000 r / m for 1 min at room temperature, then the supernatant was removed to obtain the precipitated bacterial cells; E. coli

[0040] 1-1-3) Resuspension of the bacterial cells: 500 μL of Buffer S1 was added to the tube containing the precipitated bacterial cells, vortexed for 10 s, and then the bacterial cells were resuspended by slowly blowing with a pipette gun for about 5 times;

[0041] 1-1-4) Bacterial cell lysis: 500 μL of Buffer S2 was added and mixed well by inverting until the bacterial solution became clear, thereby obtaining the lysed bacterial solution;

[0042] 1-1-5) Precipitation and separation of the bacterial lysis solution: 500 μL of Buffer S3 was added to the lysed bacterial solution, and the solution was immediately gently inverted; the precipitate was produced in the liquid, and the inversion was continued until the liquid was completely yellow, and then the solution was allowed to stand for 2 min, and centrifuged at 12,000 r / m for 5 min; the supernatant was the supernatant;

[0043] 1-1-6) Adsorption: The supernatant was transferred to a new centrifuge tube, and 0.3 times the volume of isopropanol was added to the supernatant, and the mixture was uniformly mixed by shaking after covering; then the liquid was transferred into the adsorption column, allowed to stand for 2 min, and then centrifuged at 12,000 rpm for 30 s, and the filtrate in the collection tube was discarded;

[0044] 1-1-7) Elution of impurities from the adsorption column:

[0045] 500 μL of Buffer ToxOut was added to the adsorption column, and the solution was allowed to stand at room temperature for 5 min, and then centrifuged at 12,000 r / m for 60 s, and the filtrate in the collection tube was discarded;

[0046] 1-1-8) Elution of impurities from the adsorption column twice:

[0047] 600 μL of Buffer W2 was added to the adsorption column, and the solution was centrifuged at 12,000 r / m for 30 s at room temperature, and the filtrate in the collection tube was discarded, and the operation was repeated once;

[0048] 1-1-9) Elution of the plasmid: ​

[0049] The adsorption column was placed in a new 1.5 mL centrifuge tube, 200 μL of elution buffer EB2 was added, and the column was placed at room temperature for 2 min. After centrifugation at 12000 r / m for 1 min, the eluted plasmid pET-28a(+) solution was collected into a new centrifuge tube.

[0050] The synthesis of the aflatoxin B1 degrading enzyme encoding base sequence, and the enzymatic digestion of plasmid pET-28a(+) and the optimized encoding base sequence of aflatoxin B1 degrading enzyme, specifically include the following steps:

[0051] 1-2-1) with E. coli To optimize the encoding base sequence of the original aflatoxin B1 degrading enzyme in the host, using EcoR I and Not I. Double enzyme digestion to synthesize enzymes with restriction enzyme sites EcoR I and Not The optimized coding base sequence of the aflatoxin B1 degrading enzyme of Ⅰ; the amino acid sequence of the original aflatoxin B1 degrading enzyme is shown in SEQ ID NO: 1, and the optimized coding base sequence of the aflatoxin B1 degrading enzyme is shown in SEQ ID NO: 2;

[0052] 1-2-2) using EcoR I and Not I. Plasmid pET-28a(+) was extracted by double enzyme digestion.

[0053] The enzyme digestion system used in step 1-2-1) (restriction endonucleases purchased from Sangon Biotech (Shanghai) Co., Ltd.) included: 10× QuickCut Green Buffer* 5.0 μL, EcoR I 1.0 μL, Not I. 1.0 μL, ddH2O 42 μL; the enzyme digestion system was incubated at 16℃ for 12 h, and the double enzyme digestion resulted in the synthesis of a product with restriction enzyme sites. EcoR I and Not Optimized coding base sequence for aflatoxin B1 degrading enzyme I.

[0054] The enzyme digestion system used in step 1-2-2) (restriction endonucleases purchased from Sangon Biotech (Shanghai) Co., Ltd.) included: 10× QuickCut Green Buffer* 5.0 μL, EcoR I 1.0 μL, Not I. 1.0 μL of plasmid pET-28a(+), 1.0 μg of ddH2O, and 42 μL of ddH2O were added; the enzyme digestion system was incubated at 16℃ for 12 h to obtain enzymes containing restriction enzyme sites. E. coli I and E. coliThe linearized plasmid pET-28a(+) vector matched with the optimized base sequence coding Aspergillus flavus toxin B1 degradation enzyme.

[0055] The specific process of the fragment recovery, plasmid digestion, and connection of the enzyme-optimized coding base sequence and the plasmid includes the following steps:

[0056] 1-3-1) Recovering the coding sequence of the target enzyme and linearizing the vector: under the ultraviolet imaging system, quickly and accurately cut off the gel block containing the target band, and try to reduce the volume of the gel block to reduce impurities. Heat the agarose gel to completely dissolve it, and then use a gel recovery kit for recovery; add the agarose gel to a centrifuge tube, then add agarose gel dissolution buffer and adsorption buffer; gently invert or shake the centrifuge tube, mix and dissolve the agarose gel; centrifuge the centrifuge tube at 5000 r / m for 20 s, transfer the supernatant to an adsorption column, centrifuge at 5000 r / m for 20 s after standing for 10 min, then elute with elution buffer to obtain the coding sequence solution of the enzyme or the solution of the linearized plasmid pET-28a(+);

[0057] 1-3-2) Connection of the linearized plasmid pET-28a(+) and the enzyme-digested synthesized Aspergillus flavus toxin B1 degradation enzyme-optimized coding base sequence, the reaction system used includes: linearized plasmid pET28a(+) solution 4.0 μL, enzyme-digested enzyme coding sequence solution 1.0 μL, 2× MultiF seamless Assembly Mix 5.0 μL; the reaction system 16 o C incubate overnight to obtain the constructed vector pET28a(+)-B1H liquid.

[0058] The gel recovery kit and ligase used in the process of fragment recovery, plasmid digestion, and connection of the enzyme-optimized coding base sequence and the plasmid are purchased from Sheng Wu Bioengineering (Shanghai) Co., Ltd.

[0059] The constructed vector is transformed Figure 1 BL21, specifically including the following steps:

[0060] 2-1) Transformation: the constant temperature water bath temperature is kept at 42℃; put 100 μL competent cells into a tube, and incubate at 42℃ for 45 s, then put the tube into ice water for 2 min, and then add 50 μL LB medium to the tube, and incubate at 37℃ for 1 h. E. coliDH5α cells were taken from -80℃ ultra-low temperature freezer, and then placed in ice bath for 10 min; 10 μL of the constructed vector pET28a(+)-B1H liquid was added to 100 μL of competent cells, which were gently shaken and then placed on ice for 20 min; after gentle shaking, they were placed in 42℃ water bath for 90 s, and then quickly placed back on ice for 5 min; 700 μL of LB medium was added respectively, and then gently mixed, and placed in a 37℃ shaker for 50 min to obtain the transformation mixture; 300 μL of the transformation mixture was added dropwise to a LB plate containing kanamycin, and then evenly coated; the coated plate was first placed in a 37℃ constant temperature incubator for 40 min, and then placed upside down in a 37℃ constant temperature incubator for 16 h to grow single colonies;

[0061] 2-2) Colony PCR: The single colonies were picked for colony PCR to identify the recombinant plasmid; the PCR primers were: T7-F: CGACTCACTATAGGGGAATTG, the coding base sequence of T7-F is shown in SEQ ID NO: 15; T7-R: CCCCCAAGGGGTTATGCTAG, the coding base sequence of T7-R is shown in SEQ ID NO: 16; the amplification system included: 2.0 μL of primer each, 25 μL of 2×Taq Plus PCR Master Mix, 21 μL of ddH2O, and the PCR reaction program is shown in Table 1; the colony PCR product of the transformed pET28a(+)-B1Hd is shown in Figure 1; E. coli ;

[0062] 2-3) After the PCR was completed, 1% agarose gel electrophoresis analysis was performed; the positive colonies were inoculated in 5.0 mL of LB liquid medium containing kanamycin, and cultured at 37℃, 200 r / min for 16 h; part of the bacterial liquid was preserved in a glycerol tube to preserve the strain, and the transformed E. coli DH5α cells were obtained;

[0063] 2-4) The transformed Figure 2 DH5α cells were inoculated in LB liquid medium containing kanamycin, and cultured at 37℃, 200 r / min for 16 h; the plasmid was extracted, and the extracted plasmid was transformed into competent Figure 3 BL21; the plasmid extraction, transformation, and colony PCR method were the same as above.

[0064]

[0065] Note: The colony PCR reaction program listed in Table 1 is the general condition for rapid screening of recombinant plasmid of transformed colonies in this example; the annealing temperature and extension time can be adjusted appropriately according to the length of the target fragment and the primer Tm value by those skilled in the art.

[0066] The construction of the aflatoxin B1 degrading enzyme mutant E1, E2, E3, E4 expression vector specifically includes the following steps:

[0067] 3-1) Establish a molecular three-dimensional model of the aflatoxin B1 degrading enzyme, perform molecular docking with the AFB1 molecular three-dimensional model, perform affinity analysis using Discovery Studio, and speculate the amino acid residue candidate mutation site that may be a positive mutation; the above molecular docking and affinity analysis are used to screen key residues related to substrate binding / entry into the channel, thereby improving the targeting of mutation design and reducing blind screening;

[0068] 3-2) Based on the analysis results, the application first constructs the corresponding single-point mutant E1, mutant E2, mutant E3, and mutant E4 for verifying the contribution of each candidate site to enzyme activity and providing a basis for subsequent combined mutation; unit point mutation is performed on the recommended candidate sites, and the four positive mutation sites are:

[0069] Mutant E1: the 258th threonine is mutated to alanine, the amino acid sequence is shown as SEQ ID NO: 3, the coding base sequence is shown as SEQ ID NO: 4, and the mutation is marked as T258A;

[0070] Mutant E2: the 367th alanine is mutated to glutamic acid, the amino acid sequence is shown as SEQ ID NO: 5, the coding base sequence is shown as SEQ ID NO: 6, and the mutation is marked as A367E;

[0071] Mutant E3: the 445th glutamic acid is mutated to lysine, the amino acid sequence is shown as SEQ ID NO: 7, the coding base sequence is shown as SEQ ID NO: 8, and the mutation is marked as E445K;

[0072] Mutant E4: the 477th isoleucine is mutated to glutamic acid, the amino acid sequence is shown as SEQ ID NO: 9, the coding base sequence is shown as SEQ ID NO: 10, and the mutation is marked as I477E;

[0073] To ensure the comparability of different mutants under the same expression element conditions, four pairs of mutant primers were designed using the constructed vector pET28a(+)-B1H as a template, and the mutant primers are shown in Table 2. The mutant primers were amplified respectively; the amplification kit was purchased from Sheng Wu Bioengineering (Shanghai) Co., Ltd.; the mutant PCR reaction system includes: 2×Phanta FlashMaster Mix (Dye Plus) 10.0 μL, primer 0.5 μL each, pET28a(+)-B1H liquid 0.5 μL, ddH2O 8.5 μL;

[0074] The mutation PCR procedure is: pre-denaturation at 98℃ for 30s, 34 cycles of denaturation at 98℃ for 10s, annealing at 65℃ for 5s, extension at 72℃ for 5s / kb, and final extension at 72℃ for 5s;

[0075] The agarose gel electrophoresis picture of the T258A mutation PCR product is as shown in FIG. 2B. E. coli The agarose gel electrophoresis picture of the A367E, E445K, I477E mutation PCR product is as shown in FIG. 2C. E. coli The sequencing of the mutation PCR product, after the sequencing is correct, the PCR product is transformed into the DH5α competent cell by the chemical transformation method, the transformed strain is cultured overnight, the plasmid is extracted, and the single-point mutation plasmid is obtained; finally, the single-point mutation plasmid is transformed into BL21; the plasmid extraction, transformation, and colony PCR method are the same as above. E. coli The sequencing of the mutation PCR product, after the sequencing is correct, the PCR product is transformed into the DH5α competent cell by the chemical transformation method, the transformed strain is cultured overnight, the plasmid is extracted, and the single-point mutation plasmid is obtained; finally, the single-point mutation plasmid is transformed into BL21; the plasmid extraction, transformation, and colony PCR method are the same as above. E. coli The sequencing of the mutation PCR product, after the sequencing is correct, the PCR product is transformed into the DH5α competent cell by the chemical transformation method, the transformed strain is cultured overnight, the plasmid is extracted, and the single-point mutation plasmid is obtained; finally, the single-point mutation plasmid is transformed into BL21; the plasmid extraction, transformation, and colony PCR method are the same as above.

[0076]

[0077] The coding base sequence of the mutation primer corresponding to the mutation site T258A-F in Table 2 is as shown in SEQ ID NO: 17, the coding base sequence of the mutation primer corresponding to the mutation site T258A-R in Table 2 is as shown in SEQ ID NO: 18; the coding base sequence of the mutation primer corresponding to the mutation site A367E-F in Table 2 is as shown in SEQ ID NO: 19, the coding base sequence of the mutation primer corresponding to the mutation site A367E-R in Table 2 is as shown in SEQ ID NO: 20; the coding base sequence of the mutation primer corresponding to the mutation site E445K-F in Table 2 is as shown in SEQ ID NO: 21, the coding base sequence of the mutation primer corresponding to the mutation site E445K-R in Table 2 is as shown in SEQ ID NO: 22; the coding base sequence of the mutation primer corresponding to the mutation site I477E-F in Table 2 is as shown in SEQ ID NO: 23, and the coding base sequence of the mutation primer corresponding to the mutation site I477E-R in Table 2 is as shown in SEQ ID NO: 24.

[0078] The construction of the aflatoxin B1 degrading enzyme mutant E5 specifically includes: to further evaluate the synergistic effect of multiple candidate positive mutation sites and obtain a mutant with higher specific enzyme activity, the above sites are combined on the basis of single-point mutation; taking the mutant E1 (T258A) mutant vector as a template, three sites A367E, E445K and I477E are sequentially mutated to generate a four-site mutant E5 (T258A / A367E / E445K / I477E); the amino acid sequence of the mutant E5 is shown in SEQ ID NO: 11, and the base sequence is shown in SEQ ID NO: 12, to obtain a recombinant vector pET28a(+)-B1H-4M with four mutation sites, and the mutation primers are shown in Table 3:

[0079]

[0080] The coding base sequence of the mutation primer corresponding to the mutation site A367E-F in Table 3 is shown in SEQ ID NO: 19, and the coding base sequence of the mutation primer corresponding to the mutation site A367E-R in Table 3 is shown in SEQ ID NO: 20; the coding base sequence of the mutation primer corresponding to the mutation site E445K-F in Table 3 is shown in SEQ ID NO: 21, and the coding base sequence of the mutation primer corresponding to the mutation site E445K-R in Table 3 is shown in SEQ ID NO: 22; the coding base sequence of the mutation primer corresponding to the mutation site I477E-F in Table 3 is shown in SEQ ID NO: 23, and the coding base sequence of the mutation primer corresponding to the mutation site I477E-R in Table 3 is shown in SEQ ID NO: 24.

[0081] The mutation PCR reaction system and the mutation PCR procedure are referred to the mutation PCR reaction system and the mutation PCR procedure in step 3); the four-site mutant vector is transformed into E. coli DH5α, and the plasmid is extracted and then transformed into E. coli BL21, and the transformation method is the same as step 3); the positive colonies of the pET28a(+)-B1H-4M transformed colonies are picked and inoculated to obtain the pET28a(+)-B1H-4M transformed E. coli BL21 strain.

[0082] The expression of the aflatoxin B1 degrading enzyme E5 specifically includes: using an inoculation loop to take the pET28a(+)-B1H-4M transformed Figure 4BL21 strain, streaked on LB plates containing kanamycin, and incubated in a 37℃ constant temperature incubator for 12 h; a single colony was inoculated into 50 mL of LB liquid medium containing kanamycin; 1 mL of seed liquid was inoculated into LB shake flask medium containing kanamycin, and cultured at 37℃, 220 r / m, until the OD 600 was 0.6; the expression was induced by adding an inducer: IPTG was used as the inducer to a final concentration of 0.1 mM, and the pET28a(+)-B1H-4M transformed E. coli The BL21 strain expressed the degradation enzyme containing four mutation sites, and was cultured at 18℃, 150 r / m for 18 h, and then collected by centrifugation at 6500 r / m for 5.0 min; the bacterial cells were washed twice with 0.9% physiological saline; at the same time, the recombinant bacteria without the inducer were used as a control, and the same operation was performed.

[0083] The wet bacterial cells were mixed with the bacterial disruption buffer (0.3 M NaCl, 20 mM NaH2PO4, pH 7.4) at a ratio of 1:10, and stirred to fully suspend the bacterial cells; the bacterial cells were disrupted by ultrasonic treatment under ice bath conditions, with the following ultrasonic treatment conditions: power 60 W, working for 20 min, running for 3 s, and stopping for 5 s; the ultrasonic treatment was performed twice; then the supernatant and the precipitate were collected by centrifugation at 12000 r / m and 4℃ for 35 min, and the supernatant containing the soluble expressed degradation enzyme was obtained.

[0084] The purification of the aflatoxin B1 degradation enzyme E5 specifically includes the following steps:

[0085] 6-1) The Ni-column affinity chromatography method was used to purify the aflatoxin B1 degradation enzyme E5; the Ni-column affinity chromatography kit was purchased from GenScript Biotech (Shanghai) Co., Ltd., and the specific steps of the Ni-column affinity chromatography method included: removing ethanol in the column with 5 times the column volume of distilled water; equilibrating the column with 6 times the column volume of buffer (0.3 M NaCl, 20 mM NaH2PO4, pH 7.4); adding the supernatant containing the soluble expressed degradation enzyme to the column, collecting the effluent, and adding it to the column again; washing the column with 7 times the column volume of binding buffer; and eluting with 20 times the column volume of different gradient elution buffers (0.3 M NaCl, 20 mM NaH2PO4, 5-500 mM imidazole, pH 7.4), and collecting the eluate;

[0086] 6-2) The collected eluate is concentrated and collected by ultrafiltration concentration tube, 4°C, 3500g / min, centrifugation for 20 min, about 1.5 mL of enzyme solution is collected, the liquid in the collection tube is discarded, the buffer desalination (0.3 M NaCl, 20 mM NaH2PO4, pH 7.4) is replaced, the above centrifugation step is repeated for 5 times, then the protein in the ultrafiltration tube is sucked into an EP tube, frozen in liquid nitrogen for about 20 s, and stored at -80°C; the purified product is subjected to SDS-PAGE electrophoresis, and the results are shown in FIG. 6-2. E. coli

[0087] The optimal temperature, optimal pH analysis, and specific enzyme activity determination of the aflatoxin B1-degrading enzyme E5 specifically include: the total volume of the enzyme reaction system without an electron donor is 500 μL, containing: 10.0 μL of purified enzyme solution, 10.0 μL of aflatoxin B1 (purchased from Qingdao Purui Bang Biological Engineering Co., Ltd.) (concentration 10 g / mL), 480.0 μL of buffer; the above enzyme reaction system is placed at 37°C, and after reaction for 30 min, it is immediately inactivated with 500 μL of methanol, ice bath for 10 min, filtered with a 0.22 μm organic filter membrane, and the concentration of aflatoxin B1 is detected by HPLC; the enzyme activity of the aflatoxin B1-degrading enzyme is defined as: the amount of enzyme required to consume 1.0 μg of substrate per 1.0 min is 1.0 U; the specific enzyme activity is defined as: the enzyme activity possessed by each milligram of degrading enzyme, and the specific enzyme activity unit is U / mg; the HPLC detection conditions are: the detector is a fluorescence detector, the excitation wavelength is 360 nm, the emission wavelength is 440 nm, the chromatographic column is a WondaSil-C18 chromatographic column (150×4.6 mmol / L, 5 μm), the mobile phase is acetonitrile: 0.1% formic acid = 4:6, the flow rate is 1 mL / min, and the column temperature is 30°C; 1 mg / mL of aflatoxin B1 stock solution is diluted to 0.05 μg / mL, 0.10 μg / mL, 0.15 μg / mL, 0.20 μg / mL, 0.25 μg / mL, and 0.30 μg / mL, respectively, and filtered with a 0.22 μm filter membrane; a standard curve is drawn according to the concentration of aflatoxin B1 and the peak area by linear regression; the enzyme activity is analyzed at temperatures of 40°C, 50°C, 60°C, 70°C, 80°C, and 90°C, and the temperature with the maximum enzyme activity is the optimal temperature; the enzyme activity is detected in pH 7, pH 8, pH 9, and pH 10 buffers, and the pH with the maximum enzyme activity is the optimal pH.

[0088] It is detected and analyzed that the optimal temperature of the aflatoxin B1-degrading enzyme E5 using the mutant E5 is 80°C, the pH is 9, and the specific enzyme activity under the optimal conditions is 0.953 U / mg; compared with the original aflatoxin B1-degrading enzyme, the specific enzyme activity under the optimal conditions is 15.88 times that of the original.

[0089] ​Comparative Example 1

[0090] The initial amino acid coding sequence of aflatoxin B1 degrading enzyme (amino acid sequence is SEQ ID NO: 1, base sequence is SEQ ID NO: 2) was ligated to the vector, and transformed into ​ BL21, induced expression; the optimum temperature after purification was 80℃, the optimum pH was 9; the specific enzyme activity under the optimum condition was 0.06 U / mg; the vector ligation, transformation, purification, and specific enzyme activity detection were the same as in Example 1.

[0091] Comparative Example 2

[0092] The plasmid with A367E mutation was used as a template, and E445K and I477E mutations were sequentially performed to obtain the (A367E / E445K / I477E) mutant vector; the mutant vector was transformed into ​ BL21, induced expression, and purified aflatoxin B1 degrading enzyme E6 (A367E / E445K / I477E); the amino acid sequence of aflatoxin B1 degrading enzyme E6 (A367E / E445K / I477E) was SEQ ID NO: 13, and the coding base sequence of aflatoxin B1 degrading enzyme E6 (A367E / E445K / I477E) was SEQ ID NO: 14); the vector construction, transformation, colony PCR, induced expression, purification, specific enzyme activity detection, optimum temperature analysis, and optimum pH analysis were the same as in Example 1.

[0093] The optimum temperature of aflatoxin B1 degrading enzyme E6 was 80℃, the optimum pH was 9; the specific enzyme activity under the optimum condition was 0.23 U / mg; compared with the original aflatoxin B1 degrading enzyme, the specific enzyme activity under the optimum condition was 3.8 times that of the original.

Claims

1. A method for constructing an aflatoxin B1 degrading enzyme, characterized by using... The original aflatoxin B1 degrading enzyme was used as the starting enzyme, with only the alanine at position 367 of the original aflatoxin B1 degrading enzyme mutated to glutamic acid, the glutamic acid at position 445 mutated to lysine, and the isoleucine at position 477 mutated to glutamic acid. The amino acid sequence of the original aflatoxin B1 degrading enzyme is shown in SEQ ID NO:

1.

2. A method for constructing an aflatoxin B1 degrading enzyme, characterized by using... The original aflatoxin B1 degrading enzyme was used as the starting enzyme, with only the following mutations made: threonine at position 258 was mutated to alanine, alanine at position 367 was mutated to glutamic acid, glutamic acid at position 445 was mutated to lysine, and isoleucine at position 477 was mutated to glutamic acid. The amino acid sequence of the original aflatoxin B1 degrading enzyme is shown in SEQ ID NO:

1.

3. The method for constructing an aflatoxin B1 degrading enzyme according to claim 1, characterized in that: The three-site combination mutant E6 was constructed; the amino acid sequence of the three-site combination mutant E6 is shown in SEQ ID NO:

13.

4. The method for constructing an aflatoxin B1 degrading enzyme according to claim 2, characterized in that... The four-site combined mutant E5 was constructed; the amino acid sequence of the four-site combined mutant E5 is shown in SEQ ID NO:

11.

5. The method for constructing an aflatoxin B1 degrading enzyme according to claim 4, characterized in that: The method for constructing the four-site combined mutant E5 includes: firstly obtaining the optimized coding sequence of the degrading enzyme and constructing the basic expression vector pET28a(+)-B1H; then screening to obtain recombinant vectors with four candidate mutation sites, and constructing the four-site combined mutant E5 based on the recombinant vectors with four candidate mutation sites.

6. A method for constructing an aflatoxin B1 degrading enzyme according to claim 1 or 2, characterized in that: The constructed degradative enzyme is suitable for the degradation of aflatoxin B1 in the absence of electron donors.

7. A method for constructing an aflatoxin B1 degrading enzyme according to claim 1 or 2, characterized in that... The constructed degradative enzyme is suitable for environmental conditions of 80℃ and pH 9.

Images