Method for drawing human full-coverage protein interaction network based on digital PCR next-generation sequencing

By constructing a human open reading frame library and utilizing a modified BACTH bacterial dual-hybrid system and droplet digital PCR technology, high-throughput, low-cost protein interaction network mapping was achieved, solving the high-throughput and cost problems of protein interaction screening in existing technologies and providing data support for systems biology and artificial intelligence.

CN121472383AActive Publication Date: 2026-02-06LIANGZHU LAB
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202610024293.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-09
Publication Date
2026-02-06
Estimated Expiration
2046-01-09

AI Technical Summary

Technical Problem

Existing methods for studying protein interactions are insufficient to achieve high-throughput, low-cost, and highly specific screening across the entire spectrum, failing to meet the needs of systems biology and AI-driven protein design.

Method used

A high-throughput screening method based on digital PCR and next-generation sequencing was adopted. Human open reading frame libraries were constructed, homologous recombination was performed using a modified BACTH bacterial double hybrid system, and next-generation sequencing was used for identification in combination with single-cell labeling and amplification by droplet digital PCR to map a complete human protein interaction network.

Benefits of technology

It enables high-throughput, high-accuracy, and low-cost protein interaction network mapping, breaking through the bottlenecks of traditional methods and providing data support for systems biology and artificial intelligence to drive protein design.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472383A_ABST
    Figure CN121472383A_ABST
Patent Text Reader

Abstract

The invention discloses a method for drawing a human full-coverage protein interaction network based on digital PCR next-generation sequencing. After the advanced pedestrian 293T cell line obtains mRNA, a modified random primer or an oligo-dT primer is adopted to obtain a cDNA library; carrying out homogenization treatment on the human cDNA library; the method comprises the following steps: transforming plasmids of a BACTH bacteria double-hybrid system to obtain transformed plasmids; carrying out homologous recombination on the transformed plasmids of the sample library and the double-impurity system, and introducing into escherichia coli for screening to obtain positive PPI clones of the library with interaction; and carrying out digital PCR-based next-generation sequencing on the screened clones to draw the human full-coverage protein interaction network. The method is suitable for performing high-throughput screening after thousands of positive PPI combinatorial clones are obtained by'library-to-library 'bacteria or yeast double hybrids, identifying the same cell bar code cDNA combinatorial pairs, and realizing PPI network identification in different species, among species and in hybridization technology system extensive scenes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of protein processing and screening, and in particular to a method for mapping a full-coverage human protein interaction network based on digital PCR next-generation sequencing. Background Technology

[0002] Protein-protein interactions (PPIs) are among the most fundamental molecular events in living systems, determining the core mechanisms of signal transduction, metabolic regulation, cell differentiation, and disease development. Systematic analysis of the human proteome-wide interactome map is crucial for revealing disease molecular networks, target discovery, and drug screening. However, current mainstream protein-protein interaction research methods, such as yeast two-hybrid (Y2H), co-immunoprecipitation (Co-IP), and analog-assisted mass spectrometry (AP-MS), are limited by throughput, operational complexity, and high cost, making it difficult to achieve comprehensive, high-precision, and high-throughput interaction screening of the human proteome. Furthermore, these traditional methods typically rely on one-to-one or small-scale screening, resulting in sparse interaction data with limited reproducibility and dynamic range, failing to meet the demands of systems biology and artificial intelligence-driven protein design for large-scale interaction data.

[0003] To address the aforementioned issues, a novel technological system capable of combining high throughput, low cost, and high specificity is urgently needed to realize protein-protein interactions. This invention proposes a high-throughput, low-cost method for mapping a complete human protein-protein interaction network based on digital PCR and next-generation sequencing. After obtaining positive clones with complete protein-protein interaction coverage using traditional bacterial double-hybrid "library-to-library" homologous recombination, microfluidics based on droplet digital PCR is used to encapsulate individual clones in nanoliter droplets for single-cell labeling and amplification. Next-generation sequencing is then used for high-throughput identification of barcode cDNA pairs from the same cells, achieving full-coverage human PPI network identification. This method overcomes the technical bottlenecks of traditional PPI screening, providing a new technical approach for the systematic mapping of human protein-protein interaction atlases, and offering important data support and application prospects for disease mechanism analysis, precision medicine, and AI-driven protein design. Summary of the Invention

[0004] To address the current lack of high-throughput library-to-library protein interaction screening methods, this invention provides a library-to-library high-throughput screening system and its usage method, and constructs a human full-coverage protein interaction network. The system mainly includes a human open reading frame acquisition system, a library-to-library PPI screening system, and a single-cell transcriptome sequencing identification system based on random primers.

[0005] like Figure 1 As shown, the technical solution of the present invention is as follows: 1) Construction of human protein library mRNA was extracted from isolated human kidney epithelial cell line (293T cells), and then a human protein library was obtained using modified primers as the open reading frame of the target sample. 2) Homogenization of the human protein library; 3) Modify the plasmid of the BACTH bacterial two-hybrid system to obtain the modified plasmid; 4) The human protein library and the modified T18 and T25 plasmids of the double hybrid system were homologously recombined and introduced into DHM1 Escherichia coli. The bacteria were screened in M63 medium containing Amp and Kan resistance and IPTG inducer to obtain human full-coverage positive PPI clones. 5) After obtaining bacteria with positive PPI clones, high-throughput PPI pair identification was performed using next-generation sequencing based on digital PCR. A pair of open reading frames in a cell is a pair of protein interaction pairs, and a human full-coverage protein interaction network was constructed.

[0006] Step 1) Human protein library construction specifically includes: firstly, extracting human mRNA, and using modified 3'RT Oligo-dT primers and TSO primers to obtain a full-length human open reading frame library using Smart-seq 3; then, fusing the human open reading frame library to the N-terminus of a plasmid vector. When obtaining the library, Oligo(dT) magnetic beads are first used to specifically capture eukaryotic mRNA via the Poly-A tail, and then modified 3'RT random primers are used for reverse transcription to obtain a cDNA library as the human protein library. The modified 3'RT random primer sequence is SEQ ID No. 1, i.e., ACTCTGCGTTGATACCACTGCNNNNNNNN, to avoid false negatives caused by fusion sites and improve the full coverage and sensitivity of interaction detection.

[0007] The modified 3'RT Oligo-dT primer sequence is SEQ ID No. 4, namely ACTCTGCGTTGATACCACTGCTTTTTTTTTTTTTTTTTTTTT, and the modified TSO primer sequences include SEQ ID Nos. 5-7, namely TCGACTCTAGAGGATCCCrGrGrG, TCGACTCTAGAGGATCCCrG, and TCGACTCTAGAGGATCCCrGrG.

[0008] The above sequences were optimized based on the sequence of the plasmid vector. The 3'RT sequence was added to the vector through modification and also corresponds to the sequence on the hydrogel-encoded microspheres. The TSO primers were designed based on the homologous arm sequence at the 5' end of the vector cloning site.

[0009] Step 2) specifically involves using a double-stranded specific nuclease to homogenize the human protein library, reducing the abundance of high-copy genes, making the gene concentration in the library more uniform, improving the efficiency of protein interaction network mapping, and discovering interaction networks of low-abundance genes.

[0010] Specifically, step 3) involves modifying the plasmid of the BACTH bacterial double hybrid system, linking it with a linker sequence containing a homologous arm, performing single-cell labeling, and forming the modified plasmid. The linker sequence is SEQ ID No. 2, namely AAGCGTGGTATCAACGCAGAGT, which has a homologous sequence with the modified 3'RT Oligo-dT primer. The linker in the plasmid is located at the 3' position of the MSC multiple cloning site of the vector, and the linker sequence is SEQ ID No. 3, namely ACTCTGCGTTGATACCACTGCTT.

[0011] Step 4) specifically involves: First, human protein libraries were homologously fused with the C-terminus of pUT18C and pKT25 plasmids modified using the BACTH bacterial double-hybrid system to form pUT18C and pKT25 protein-particle libraries. Alternatively, open reading frame libraries obtained using random primers were homologously fused with the N-terminus of pUT18 and pKNT25 plasmids modified using the BACTH bacterial double-hybrid system to form pUT18 and pKNT25 protein-particle libraries. Subsequently, the plasmid libraries were electrotransduced into DHM1 or BTH101 Escherichia coli, and positive PPI clones were screened in M63 medium containing Amp and Kan resistance and IPTG inducer to obtain bacteria with positive PPI clones.

[0012] The screening medium is such as M63 medium (5x M63 medium formula: weigh 10 g of (NH4)2SO4, 68 g of KH4PO4, 2.5 mg of FeSO4·7H2O and 5 mg of vitamin B1, add deionized water to make up to 1 L, adjust the pH to 7.0 with KOH and then autoclave).

[0013] The modified plasmid contains the linker sequence AAGCGTGGTATCAACGCAGAGT, and bacteria with positive PPI clones appear blue on the selection medium plate.

[0014] Step 5) specifically refers to: Since the transfected plasmid contains more than 5 copies, modified hydrogel-encoded microspheres containing linker sequences were directly added to the screened bacteria along with heat-resistant droplet-generating oil and an aqueous phase stabilizer for single-cell encapsulation before PCR amplification. After amplification, the amplified products were fragmented using a transposase DNA library construction kit (Novi Station UTD521). Then, cDNA sequencing libraries containing cell barcode sequences were constructed using P5 / P7 adapter primers containing cell barcode linkers. Finally, the obtained cDNA sequencing libraries were sequenced at 150 bp at both ends using an Illumina X plus 25B sequencer. The sequences obtained were compared with the human genome reference to identify interacting protein pairs and cDNA combinations with the same cell barcode, thus constructing an interacting protein network.

[0015] The P5 primer sequence is: SEQ ID No. 8, AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAGTGATGGTTGAGGATGTGTGGAGATA; The P7 primer sequence is: SEQ ID No. 9, CAAGCAGAAGACGGCATACGAGATTAAGGCGAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG.

[0016] The high-temperature resistant droplet generation oil is specifically QX200™ Droplet Generation Oil for EvaGreen (#1864005), the aqueous phase stabilizer is specifically a digital PCR-specific aqueous phase stabilizer purchased from Nanjing Stone Gene Technology Co., Ltd., and the fragmentation reagent is specifically UltraClean DNA Library Prep Kit V3 for Illumina (UTD521).

[0017] The single-stranded DNA on the hydrogel-encoded microspheres containing the linker sequence consists of an upstream primer complement fragment, a barcode, a unique multiplex index (UMI), and a linker sequence. The upstream primer complement fragment binds to the upstream primer during PCR amplification. The barcode is used to label cDNA within the same cell septum. The UMI is a random sequence used to label each original cDNA. The linker sequence acts as a primer in PCR to complete single-cell labeling amplification.

[0018] In the above process, for yeast, a mixture containing lysis buffer (mix) was added during PCR amplification. The mixture containing lysis buffer (mix) was 2 mg / g of cell Zymolase lysing enzyme and reacted at 37°C for 30 min to lyse the cell wall.

[0019] For bacterial organisms, no mixture containing lysis buffer is added during PCR amplification.

[0020] The beneficial effects of this invention are: This invention establishes a high-throughput library-to-library PPI screening method and constructs a human-wide PPI network. This method is applicable to high-throughput screening after obtaining tens of thousands of positive PPI combination clones through library-to-library bacterial or yeast two-hybrids. It can identify PPI network combinations of the same cell barcode cDNA pair, enabling identification within different species, between species (model species vs. non-model species, bacteria vs. host), and hybridization technology systems (bacterial two-hybrids, yeast one-hybrids). It breaks through the bottleneck of traditional methods that can only perform "one-to-one" or a few "one-to-many" screenings, and has the advantages of high throughput, high accuracy, low cost, and full coverage of protein interaction identification. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the present invention. Figure 2 Electrophoresis images of 293T cell cDNA libraries before and after DSN; Figure 3 Positive PPI droplets were encapsulated in single cells for PCR amplification. Figure 4 Humans have a 20-pair protein-protein interaction network. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0023] like Figure 1 As shown, embodiments of the present invention are as follows: 1. Access to the open reading box library system Human renal epithelial cell line (293T cells) was collected and lysed directly according to the TRIzol instructions to extract human RNA. After detecting the integrity and concentration of RNA by gel electrophoresis and UV spectrophotometry, the full-length open reading frame was obtained directly using the optimized Smart-seq 3 method. The specific method is as follows: RT reaction was performed using an RNase H-free MMLVRT enzyme (such as Maxima H-minus reverse transcriptase enzyme (Thermo Scientific)). The reaction system contained 25 mM Tris-HCl pH 8.0-8.4, 30 mM NaCl, 2.5 mM MgCl2, 1 mM GTP, 8 mM DTT, 0.25 U RNase inhibitor, 0.3 mM dNTPs, 0.1 uM TSO primer, and 0.1 uM 3'RT primer (3'RT Oligo-dT or 3'RT...). Random primers, RNA, dNTPs, and 3' RT primers were pre-denatured at 72°C for 5 min, then immediately placed on ice with the remaining reagents added. The reaction was performed at 42°C for 90 min, followed by 10 cycles of 50°C for 2 min and 42°C for 2 min. After the RT reaction, cDNA library amplification was performed for 25 cycles using a 2X KAPAHiFi HotStart ReadyMix. After amplification, the cDNA library was purified using 0.6X VAHTS DNAClean Beads (N411).

[0024] 2. To ensure the cDNA library is free of repetitive sequences and covers more transcript information, cDNA homogenization was performed using Duplex-Specific Nuclease (DSN). This was done using the PuYinTe Bio cDNA homogenization kit (FZ1031). First, 200 ng of the cDNA library was mixed with 4x Hybridization buffer and denatured at 98°C for 2 min, then incubated at 68°C for 5 h. Then, 1 μL of DSN and 1 μL of 10×DSN Reaction buffer were added, gently mixed, briefly centrifuged, and incubated at 68°C for 7-20 min to degrade the double-stranded cDNA. Finally, 10 μL of 2×DSN Stop Buffer was added, gently mixed, briefly centrifuged, and incubated at 65°C for 5 min to terminate the reaction. The remaining homogenized single-stranded cDNA was amplified by PCR for library cloning. After amplification, the cDNA library was purified using 0.6x VAHTS DNA Clean Beads (N411). Figure 2 ).

[0025] 3. Comprehensive PPI screening for all individuals Referring to the smRandom-seq article, 96*96*48 cell barcode sequences were synthesized. Based on the vector characteristics, the last linker sequence was modified to AAGCGTGGTATCAACGCAGAGT, SEQ ID No. 2. The first cell barcode was modified with an amino group at its 5' end and fixed onto polyacrylamide hydrogel microspheres. Different cell barcodes were ligated using T7 ligase according to the split pool method. After completion, NaOH was used to form dsDNA single strands.

[0026] Using microfluidic devices, hydrogel-encoded microspheres and single bacteria were directly encapsulated in water-in-oil droplets. Figure 3 To prevent droplet fusion at high temperatures, the aqueous phase was supplemented with 10% aqueous phase stabilizer (purchased from Hangzhou Chuangyan Xinghe), 25% OptiPrep density gradient medium, 2X KAPA HiFi HotStart ReadyMix, 400 E. coli cells / ul selected with double antibodies, 2.5ul PUT18C and 2.5ul PKNT25 vector primers, 5ul USER enzyme (M5505L), 37℃ for 30min, 95℃ for 3min, followed by 30 cycles of 95℃ for 30s, 60℃ for 20s, 72℃ for 2min and 30s, and finally 72℃ for 5min, and stored at 4℃. After PCR amplification, the cDNA library was purified using 0.6x VAHTS DNA Clean Beads (N411). After three cycles of amplification using cell barcode adapter primers and PUT18C and PKNT25 vector primers, an Illumina library was constructed using the VAHTS Universal Pro DNA Library Prep Kit for Illumina. The sequences obtained from sequencing were compared with the human reference genome to identify interacting protein pairs and construct an interaction protein network. Based on two sequencing runs, a total of 11,623 interacting protein pairs were identified, including 2,342 proteins exhibiting multi-protein interactions. Figure 4 ).

[0027] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

[0028] The above description is only a preferred embodiment of the present invention. Therefore, all equivalent changes or modifications made to the structure, features and principles described in the claims of this patent application are included in the scope of this patent application.

[0029] The gene sequence involved in this invention is as follows: SEQ ID No. 1: Name: Modified 3'RT random primer DNA sequence DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ACTCTGCGTTGATACCACTGCNNNNNNNN SEQ ID No. 2: Name: DNA sequence of the linker DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct AAGCAGTGGTATCAACGCAGAGT SEQ ID No. 3: Name: Linker linker connection site sequence in plasmid DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ACTCTGCGTTGATACCACTGCTT SEQ ID No.4: Name: DNA sequence of modified 3'RT Oligo-dT primers DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct ACTCTGCGTTGATACCACTGCTTTTTTTTTTTTTTTTTT SEQ ID No. 5: Name: DNA sequence of modified TSO primers 1 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCGACTCTAGAGGATCCCrGrGrG SEQ ID No. 6: Name: DNA sequence of modified TSO primer 2 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCGACTCTAGAGGATCCCrG SEQ ID No. 7: Name: DNA sequence 3 of the modified TSO primer DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCGACTCTAGAGGATCCCrGrG SEQ ID No. 8: Name: P5 primer DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAGTGATGGTTGAGGATGTGTGGAGATA SEQ ID No. 9; Name: P7 primer DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct CAAGCAGAAGACGGCATACGAGATTAAGGCGAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG.

Claims

1. A method for mapping a complete human protein-protein interaction network based on digital PCR next-generation sequencing, characterized in that: 1) Construction of human protein library mRNA was extracted from human renal epithelial cell line, and then modified primers were used to obtain a human protein library as the open reading frame of the target sample. 2) Homogenization of the human protein library; 3) Modify the plasmid of the BACTH bacterial two-hybrid system to obtain the modified plasmid; 4) The human protein library and the modified T18 and T25 plasmids of the double hybrid system were homologously recombined and introduced into DHM1 Escherichia coli. The bacteria were screened in M63 medium containing Amp and Kan resistance and IPTG inducer to obtain human full-coverage positive PPI clones. 5) After obtaining bacteria with positive PPI clones, high-throughput PPI pair identification was performed using next-generation sequencing based on digital PCR. A pair of open reading frames in a cell is a pair of protein interaction pairs, and a human full-coverage protein interaction network was constructed.

2. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 1, characterized in that: Step 1) Human protein library construction specifically includes: firstly, extracting human mRNA, and using modified 3'RT Oligo-dT primers and TSO primers to obtain a human open reading frame library using Smart-seq 3; then, fusing the human open reading frame library to the N-terminus of a plasmid vector, first using Oligo(dT) magnetic beads to specifically capture eukaryotic mRNA via Poly-A tail, and then using modified 3'RT random primers for reverse transcription to obtain a cDNA library as the human protein library. The sequence of the modified 3'RT random primers is SEQ ID No. 1, namely ACTCTGCGTTGATACCACTGCNNNNNNNN.

3. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 1, characterized in that: Step 2) specifically involves using a double-stranded specific nuclease to homogenize the human protein library.

4. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 1, characterized in that: Step 3) specifically involves modifying the plasmid of the BACTH bacterial dual-hybrid system by linking it with a linker containing a homologous arm to form the modified plasmid.

5. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 4, characterized in that: The linker sequence is SEQ ID No. 2, namely AAGCGTGGTATCAACGCAGAGT. The linker linker in the plasmid is located at the 3' position of the MSC multiple cloning site of the vector, and the linker site sequence is SEQ ID No. 3, namely ACTCTGCGTTGATACCACTGCTT.

6. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 1, characterized in that: Step 4) specifically involves: First, human protein libraries were homologously fused with the C-terminus of pUT18C and pKT25 plasmids modified using the BACTH bacterial double-hybrid system to form pUT18C and pKT25 protein-particle libraries. Alternatively, open reading frame libraries obtained using random primers were homologously fused with the N-terminus of pUT18 and pKNT25 plasmids modified using the BACTH bacterial double-hybrid system to form pUT18 and pKNT25 protein-particle libraries. Subsequently, the plasmid libraries were electrotransduced into DHM1 or BTH101 Escherichia coli, and positive PPI clones were screened in M63 medium containing Amp and Kan resistance and IPTG inducer to obtain bacteria with positive PPI clones.

7. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 1, characterized in that: The modified plasmid contains the linker sequence AAGCGTGGTATCAACGCAGAGT, and bacteria with positive PPI clones appear blue on the selection medium plate.

8. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 1, characterized in that: Step 5) specifically refers to: Modified hydrogel-encoded microspheres containing linker sequences were directly added to the screened bacteria along with heat-resistant droplet-generating oil and an aqueous phase stabilizer for single-cell encapsulation before PCR amplification. After amplification, the amplified products were fragmented using a transposase DNA library construction kit. A cDNA sequencing library containing cell barcode sequences was then constructed using P5 / P7 linker primers. Finally, the obtained cDNA sequencing library was sequenced, and the sequences were compared with the human genome to identify interacting protein pairs and cDNA combinations with the same cell barcode, thus constructing an interacting protein network.

9. The method for mapping a full-coverage human protein-protein interaction network based on digital PCR next-generation sequencing according to claim 8, characterized in that: For yeast, a mixture containing lysis buffer was added during PCR amplification. The mixture containing lysis buffer was 2 mg / g of cell Zymolase lysing enzyme and reacted at 37°C for 30 min to lyse the cell wall.

Citation Information

Patent Citations

  • Method for detecting interaction of proteins

    CN102590528A

  • Construction method of single-cell or trace sample full-length transcriptome library for nanopore sequencing

    CN112853503A

  • Disease protein interaction network integration and cross-disease action module mining method

    CN113223610A

  • System B2H-seq for high-throughput screening of protein interaction and use method

    CN118546969A

  • High-coverage and ultra-accurate immune repertoire sequencing using molecular identifiers

    WO2019010486A1