SV molecular marker related to chicken breast muscle weight character and application thereof

Abstract

The invention relates to the technical field of biology, in particular to an SV molecular marker related to chicken breast muscle weight character and application of the SV molecular marker. The SV molecular marker of the AK5 gene related to the pectoral muscle weight character is found, and the SV molecular marker is a section of 339 bp deletion variation located in a region 18831318-18831656 on a No.8 chromosome of a chicken T2T genome (GCA024206055.2); in addition, a corresponding primer pair and a detection product are designed based on the SV molecular marker, so that prediction and screening of chicken breast muscle weight traits are realized. Results of the specific embodiment of the invention show that the chicken breast muscle weight can be accurately determined by using the SV molecular marker, the primer pair and the detection product provided by the invention. Therefore, the invention provides a new molecular marker for assisted selective breeding.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to an SV molecular marker associated with the weight trait of chicken breast muscle and its application. Background Technology

[0002] In commercial production, chickens, as one of the most important poultry species, have carcass properties such as breast muscle weight, leg weight, semi-eviscerated yield, and fully eviscerated yield considered important indicators affecting their economic value. Genomic variation is an important genetic basis for individual phenotypic differences. Genomic variation can be classified by size into single nucleotide polymorphisms (SNPs), insertion-deletion (Indel) and structural variation (SV). Genomic structural variation (SV) refers to changes in the length or orientation of DNA sequences larger than 50 bp in the genome, including types such as insertion (INS), deletion (DEL), inversion (INV), duplication (DUP), and translocation (TRA).

[0003] The AK5 gene (Adenylate Kinase 5) encodes adenylate kinase 5, an enzyme that maintains intracellular energy balance and nucleotide pool stability by catalyzing the interconversion of purine nucleotides. The adenylate kinase family plays a crucial role in cellular energy metabolism and nucleotide homeostasis. SVs, as an important type of genomic variation, play a key role in the regulation of carcass traits in chickens; however, the relationship between carcass traits such as breast muscle weight and the AK5 gene has not been fully explored. Summary of the Invention

[0004] The purpose of this invention is to provide an SV molecular marker associated with the chicken breast muscle weight trait and its application, thereby addressing the problems existing in the prior art. This invention provides an SV molecular marker for the AK5 gene associated with the chicken breast muscle weight trait, offering a novel SV molecular marker for marker-assisted selection breeding.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides an SV molecular marker associated with the weight trait of chicken breast muscle, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Preferably, the chicken is a Ma Huang chicken.

[0008] The present invention provides a primer pair for amplifying the above-mentioned SV molecular marker, the primer pair comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0009] This invention provides a product for identifying the weight of chicken breast muscles, the product comprising the primer pair described above.

[0010] Preferably, the chicken is a Ma Huang chicken.

[0011] More preferably, the product includes reagents, test kits, or chips.

[0012] This invention provides the application of the above-mentioned SV molecular marker, the above-mentioned primer pair, or the above-mentioned product in identifying the weight of chicken breast muscles.

[0013] More preferably, the product includes reagents, test kits, or chips.

[0014] This invention provides a method for determining the weight of chicken breast muscles, comprising the following steps:

[0015] Using the genomic DNA of the chicken to be tested as a template, PCR amplification was performed on the template using the primer pairs mentioned above. The results of the PCR amplification were used to determine the weight of the pectoral muscle of the chicken to be tested.

[0016] Preferably, if only one 560bp molecular marker electrophoresis band is amplified using the primer pair, the chicken to be tested is identified as a high pectoral muscle weight type chicken; if only one 221bp molecular marker electrophoresis band is amplified using the primer pair, the chicken to be tested is identified as a low pectoral muscle weight type chicken.

[0017] This invention provides the application of the above-mentioned SV molecular marker, the above-mentioned primer pair, or the above-mentioned product in screening chickens with high breast muscle weight.

[0018] More preferably, the product includes reagents, test kits, or chips.

[0019] This invention provides the application of the above-mentioned SV molecular marker, the above-mentioned primer pair, or the above-mentioned product in the breeding of high-breast-muscle-weight chickens.

[0020] More preferably, the product includes reagents, test kits, or chips.

[0021] The present invention discloses the following technical effects:

[0022] This invention discovers an SV molecular marker for the AK5 gene associated with breast muscle weight. This SV marker is a 339 bp deletion variant located on chromosome 8 of the chicken T2T genome (GCA_024206055.2), specifically in the region from 18831318 to 18831656. Furthermore, this invention designs corresponding primer pairs and detection products based on the SV molecular marker, thereby enabling the prediction and screening of breast muscle weight in chickens. Results from specific embodiments of this invention show that the SV molecular marker, primer pairs, and detection products provided by this invention can accurately determine the level of breast muscle weight in chickens. Therefore, this invention provides a new molecular marker for assisted selective breeding and also provides a scientific basis for chicken breeding. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 A schematic diagram illustrating the location of SV molecular markers on chromosomes and primer design;

[0025] Figure 2 The results of agarose gel electrophoresis of the present invention are shown below; where M is a DNA marker, ++ indicates homozygous high pectoral muscle mass type, +- indicates heterozygous type, and -- indicates homozygous low pectoral muscle mass type. Detailed Implementation

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0029] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0030] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0031] Example 1: Development of SV Molecular Markers

[0032] The applicant constructed an F2 generation population by crossbreeding Xinghua chickens with recessive White Locker chickens. Sequence analysis of the resulting F2 generation population revealed an SV molecular marker in the chicken AK5 gene, with its nucleotide sequence shown in SEQ ID NO. 1, which was named AK5-339DEL. This SV molecular marker is located in the region 18831318-18831656 on chromosome 8 of the chicken T2T genome (GCA_024206055.2), and is a 339bp deletion variant. Figure 1 As shown.

[0033] SEQ ID NO.1 is shown below:

[0034] GCAATGTTTCCTAATTCTGAGGTATTTCATAAAGTTCTTGAAAGCTCTATTTGGTAGTTGTTCTATAGTTGTATTAGAAAACAAAATCCTTGGAAGAGCTATTAGAAGCATTCAAAGTGATATTCTGCACATGCAAAGATATATACTGGGGGAAGGGTACTGTTCTCACA CTAGCACTGTCTTGTGCATTGTGTTCCCTGAGTCAGACAATATGTAAGTACTTGTTCAGCTTTCTTAGTTCTTCACCAACACTGTAGTAGCTGTATCTAACCACTGTTGAACCTAAATGCTGAAATAAGACTTGAGAGTGCTAGAGAAAAAAGCCACAGTGGTCCAGAA.

[0035] Example 2: Application of SV molecular markers

[0036] 1. Materials and Methods

[0037] 1.1 Animal Samples

[0038] A total of 367 80-day-old Ma Huang chickens were selected, and 2 mL of subcutaneous venous blood was collected and stored at -80℃ for DNA extraction. Live weight, shank length, shank circumference, carcass weight, subcutaneous fat thickness, intramuscular fat width, semi-eviscerated weight, fully eviscerated weight, abdominal fat weight, breast muscle weight, leg muscle weight, breast muscle pH, leg muscle pH, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi-eviscerated percentage, fully eviscerated percentage, abdominal fat percentage, breast muscle percentage, and leg muscle percentage were recorded.

[0039] 1.2 Main Reagents

[0040] Blood DNA Extraction Kit (Brand: OMEGA; Catalog No.: D3392; Guangzhou Feiyang Biotechnology Co., Ltd.), 2×ES Taq Master Mix (Dye) (Brand: Kangwei Century; Catalog No.: CW0690M; Kangwei Century Biotechnology Co., Ltd.), DNA marker (Brand: Tsingke; Catalog No.: MD101; Jiangsu Novizan Biotechnology Co., Ltd.), High Purity Low Electroosmotic Agarose (Brand: Qingke; Catalog No.: TSJ001; Beijing Qingke Biotechnology Co., Ltd.)

[0041] 1.3 Experimental Methods

[0042] 1.3.1 Primer Design

[0043] Primers were designed using the Primer-BLAST tool of NCBI (National Center for Biotechnology Information Search database) for the 300 bp upstream and downstream regions of the SV molecular marker sequence obtained in Example 1. Primer synthesis services were provided by Guangzhou Qingke Biotechnology Co., Ltd. Primer sequence information is shown in Table 1.

[0044] Table 1. Primer sequences for PCR amplification

[0045]

[0046] 1.3.2 Blood Sample DNA Extraction

[0047] Extract DNA from blood samples according to the instructions of the blood sample DNA extraction kit.

[0048] 1.3.3 PCR amplification of SV molecular markers

[0049] Using genomic DNA from blood samples of the above 367 chickens as templates, the following reaction system was followed: 2 μL template DNA, 15 μL 2×ES Taq Master Mix (Dye), 1.2 μL upstream primer, 1.2 μL downstream primer, and 10.6 μL ddH2O.

[0050] Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, 34 cycles; 72℃ final extension for 5 min; store at 4℃.

[0051] 1.3.4 Gel electrophoresis and genotyping

[0052] The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and genotyping was performed based on the electrophoresis results.

[0053] 1.3.5 Association analysis between SV molecular markers and carcass traits

[0054] Association analysis was performed on the SV molecular markers and the corresponding genotypes of individuals using SPSS 26.0.

[0055] 2. Results

[0056] 2.1 PCR amplification and gel electrophoresis of SV molecular markers

[0057] The above 367 chicken individuals were selected, and PCR amplification was performed using blood sample DNA from each individual as a template. The obtained PCR products were detected by agarose gel electrophoresis, and the electrophoresis results were analyzed and recorded. Some results are shown below. Figure 2 as shown

[0058] Among them, the nucleotide sequence of the 560bp PCR product is as shown in SEQ ID NO.4, specifically:

[0059] GCGAAACAGCCATACCAGCGGTTACCTGATGAAAGTATCGGGGAATTTAAGAAGCAGGATATGTTTATGTCAGTGAAGTGCTGAGCTAGCACAATAGCAATGTTTCCTAATTCTGAGGTATTTCATAAAGTTCTTGAAAGCTCTATTTGGTAGTTGTTCTATAGTTGTATTAGAAAACAAAATCCTTGGAAGAGCTATTAGAAGCATTCAAAGTGATATTCTGCACATGCAAAGATATATACTGGGGGAAGGGTACTGTTCTCACACTAGCACTGTCTTGTGCATTGTGTTCCCTGAGTCAGACAATATGTAAGTACTTGTTCAGCTTTCTTAGTTCTTCACCAACACTGTAGTAGCTGTATCTAACCACTGTTGAACCTAAATGCTGAAATAAGACTTGAGAGTGCTAGAGAAAAAAGCCACAGTGGTCCAGAACATTAGCTACATCACTTTTTGCTGACAATCTGAGCGTCTCCTTCATTTTGACACTGTCCTGAGCATTCACAAATAATAATAAATTTACCTTTACAATGCATTAAAAAATGAGAAGGGGAAATGTG。

[0060] The nucleotide sequence of the 221bp PCR product is as shown in SEQ ID NO.5, specifically:

[0061] GCGAAACAGCCATACCAGCGGTTACCTGATGAAAGTATCGGGGAATTTAAGAAGCAGGATATGTTTATGTCAGTGAAGTGCTGAGCTAGCACAATACATTAGCTACATCACTTTTTGCTGACAATCTGAGCGTCTCCTTCATTTTGACACTGTCCTGAGCATTCACAAATAATAATAAATTTACCTTTACAATGCATTAAAAAATGAGAAGGGGAAATGTG。

[0062] 2.2 Association analysis between SV molecular markers and carcass traits

[0063] Association analysis was performed between the SV molecular marker and carcass traits (breast angle, breast depth, breast width, live weight, tibia length, tibia circumference, body oblique length, keel length, comb height, carcass weight, subcutaneous fat thickness, intramuscular fat width, semi-eviscerated weight, fully eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, foot weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi-eviscerated percentage, fully eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage, etc.). The results are shown in Table 2. The results showed that the SV molecular marker was significantly correlated with breast muscle weight (P<0.05), with significant differences in breast muscle weight between the ++ and -- types (P<0.05). Therefore, when the amplification product band is 560bp, it is a homozygous high pectoral muscle weight chicken; when the amplification product is 221bp, it is a homozygous low pectoral muscle weight chicken; and when the amplification product bands are 221bp and 560bp, it is a heterozygous chicken.

[0064] Table 2 Association between SV molecular markers and carcass traits

[0065]

[0066] Note: In the table, + indicates no missing data, - indicates missing data, and different superscript letters (ab) indicate significant differences (P<0.05), the same applies below.

[0067] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An SV molecular marker associated with the weight trait of chicken breast muscles, characterized in that, The nucleotide sequence of the SV molecular marker is shown in SEQ ID NO.

1.

2. The SV molecular marker according to claim 1, characterized in that, The chicken in question is the Ma Huang chicken.

3. A primer pair for amplifying the SV molecular marker of claim 1, characterized in that, The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

3.

4. A product for determining the weight of chicken breast muscles, characterized in that, The product comprises the primer pair as described in claim 3.

5. The product according to claim 4, characterized in that, The chicken in question is the Ma Huang chicken.

6. The application of the SV molecular marker of claim 1 or 2, the primer pair of claim 3, or the product of claim 4 or 5 in identifying the weight of chicken breast muscles.

7. A method for determining the weight of chicken breast muscles, characterized in that, Includes the following steps: Using the genomic DNA of the chicken to be tested as a template, PCR amplification was performed on the template using the primer pair described in claim 3, and the pectoral muscle weight of the chicken to be tested was determined using the PCR amplification results.

8. The method according to claim 7, characterized in that, If only one 560bp molecular marker electrophoresis band is amplified using the primer pair, the chicken to be tested is identified as a high pectoral muscle weight type chicken; if only one 221bp molecular marker electrophoresis band is amplified using the primer pair, the chicken to be tested is identified as a low pectoral muscle weight type chicken.

9. The use of the SV molecular marker of claim 1 or 2, the primer pair of claim 3, or the product of claim 4 or 5 in screening chickens with high pectoral muscle weight.

10. The application of the SV molecular marker of claim 1 or 2, the primer pair of claim 3, or the product of claim 4 or 5 in the breeding of high-breast-muscle-weight chickens.

Images