Rabies virus G protein gene specificity real-time fluorescent quantitative PCR detection primer probe set, detection kit and detection method

Abstract

The invention belongs to the technical field of vaccine production, and particularly relates to a rabies virus G protein gene specificity real-time fluorescent quantitative PCR detection primer probe set, a detection kit and a detection method. The primer probe group comprises a pair of primers designed by specific sequences of rabies virus G protein and a corresponding probe, and also comprises a qPCR detection method constructed based on the primer probe combination. According to the method, the copy number of the G protein gene in the virus harvesting liquid in the rabies vaccine production process can be quantitatively detected, so that the dynamic state of virus proliferation is accurately monitored, a virus growth curve is clearly reflected, and rapid and accurate detection of the rabies virus is realized. Compared with a traditional ELISA method, the method has the advantages of being low in cost, high in sensitivity, high in specificity, easy and convenient to operate and the like, and the vaccine production efficiency is effectively improved; in addition, the method can provide reliable data support for optimization of key parameters (such as optimal harvesting time of virus liquid) of a vaccine production process.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of vaccine production, and particularly relates to a rabies virus G protein gene specific real-time fluorescent quantitative PCR detection primer probe set, a detection kit and a detection method. BACKGROUND

[0002] In the production process of human rabies vaccine, virus liquid harvesting is one of the key processes. The traditional method is to inoculate rabies virus into Vero cells, and then collect cell supernatant regularly, and detect the G protein content by using an enzyme-linked immunosorbent assay (ELISA) detection kit for rabies virus G protein. By monitoring the change of G protein content in the virus harvest liquid, the dynamics of virus proliferation and the optimal harvesting time point are determined.

[0003] At present, the ELISA detection method is widely used in the field of rabies virus G protein detection, and the related technical solutions and performance characteristics are recorded in many literatures and standard specifications. For example, the "Rabies Vaccine (Vero Cell)" item in the Chinese Pharmacopoeia 2020 Edition clearly stipulates that the ELISA method is used to detect the rabies virus G protein content in the vaccine. Although this method is a legal detection means, it has the problems of high cost of reagent kit and large amount of reagent consumption for single detection, which leads to high long-term vaccine production cost and limits the economic efficiency and sustainability of the process.

[0004] Real-time fluorescent quantitative PCR (Quantitative Real-time PCR) technology is a mature quantitative detection means in the field of molecular biology. According to the literature, the probe qPCR utilizes the fluorescence resonance energy transfer phenomenon to realize template quantification by monitoring the change of fluorescence intensity in the PCR cycle. Compared with ordinary PCR, it has the advantages of high specificity, simplified operation steps, reduced mismatch, and detection period can be shortened to 1-2 hours. Rabies virus G protein is the core target of vaccine immunogenicity. However, there is no specific primer probe designed for rabies virus G protein G-CTN gene (Genbank accession number: FJ959397.1) in the prior art, and the qPCR technology is not applied to the dynamic monitoring of virus proliferation in the production process of rabies vaccine. Some technologies related to rabies virus qPCR detection. For example, patent CN202410905219.X: its detection target focuses on rabies virus N gene, and the core application scene is "rapid detection of live rabies virus" and "detection of residual live virus after inactivation process"; patent CN101565758B: this technology is only for the detection of "rabies virus contamination in blood products", and the application scene is the safety screening of blood products, which are not the virus titer quantification and harvesting time optimization in the vaccine production scene, and the cost and efficiency problems of the traditional ELISA method in vaccine production are not solved. SUMMARY

[0005] The present application aims to overcome the deficiencies of the virus detection technology in the production of the existing rabies virus vaccine, and provides a rabies virus G protein gene-specific real-time fluorescent quantitative PCR detection primer probe set, a detection kit and a detection method with high sensitivity, high specificity and low cost, so as to solve the problems of the traditional detection method in the actual production application.

[0006] In the present application, a primer probe combination and a kit for detecting the rabies virus G protein gene based on real-time fluorescent quantitative polymerase chain reaction (qPCR) are provided, and a qPCR detection method based on the rabies virus G protein gene is also provided. The method realizes rapid monitoring of the virus proliferation dynamics in the vaccine production process by detecting the copy number of the G protein gene in the virus harvest liquid, and provides reliable technical support for determining the optimal harvest time of the virus liquid and optimizing the production process.

[0007] In the production process of human rabies vaccine, the harvesting of the virus liquid is one of the key procedures. The traditional method is to inoculate the rabies virus into Vero cells, and then collect the cell supernatant regularly, and detect the G protein content by using an enzyme-linked immunosorbent assay (ELISA) detection kit for the rabies virus G protein. By monitoring the change of the G protein content in the virus harvest liquid, the dynamics of virus proliferation and the optimal harvest time point are determined. However, the ELISA detection kit for the G protein is expensive and consumes a large amount, resulting in high production cost and limiting the economy and sustainability of the process.

[0008] Through a large amount of literature research and target gene screening analysis, the present application selects the target gene G-CTN (Genbank accession number: FJ959397.1) of the rabies virus G protein genome which is highly conserved and has species specificity. The conservation of the gene can guarantee the detection specificity and avoid cross-reaction with other viruses or cell impurities, and the species specificity ensures that the detection result is only directed to the rabies virus. On this basis, by designing a specific primer pair and a probe set, a qPCR detection method based on the target gene is constructed, which can not only realize specific detection of the relative expression amount of the target gene, but also complete gene copy number analysis through absolute quantification, thereby providing an efficient detection scheme for the production of the rabies virus vaccine.

[0009] The technical solution of the present application to solve the technical problems is as follows:

[0010] In the first aspect of the present application, a rabies virus G protein gene-specific real-time fluorescent quantitative PCR detection primer probe set is provided, which is selected from any one of the following three compositions:

[0011] 1) the primer and probe are forward primer G-CTN-F, reverse primer G-CTN-R and probe G-CTN-P designed according to the G-CTN gene of the rabies virus G protein, and the nucleotide sequences thereof are shown in SEQ ID NO: 1-3, respectively;

[0012] 2) the primer and probe have sequences with no more than 4 nucleotide substitutions, deletions or additions compared with the sequences of SEQ ID NO: 1-3 in the above-mentioned 1);

[0013] 3) the primer and probe have 85%-99.99% sequence homology compared with the sequences of SEQ ID NO: 1-3, and have the same function as the sequences of SEQ ID NO: 1-3.

[0014] The names and sequences of the primer and probe are shown in the following table:

[0015] Targeted gene Primer name Sequence (5'-3') Number in sequence listing G-CTN G-CTN-F CAGACTTAGACCCGTACGATAAATCAC SEQ ID NO. 1 G-CTN-R GTTGGTAGAGCAGTAGGCAGAAG SEQ ID NO. 2 G-CTN-P ACCGTTATTCCTGAGCAT SEQ ID NO. 3

[0016] Further, the probe G-CTN-P is double-labeled with a fluorescent group-quenching group at both ends, and is homologous to the middle part of the respective amplified fragments. Preferably, the fluorescent group is FAM, and the quenching group is NFQ-MGB.

[0017] In the second aspect of the present application, a kit for detecting the G protein gene of the rabies virus is provided, comprising the primer probe set as described in the first aspect.

[0018] Further, the kit further comprises 2xT5 Fast qPCR Mix (probe) and EASY Dilution buffer.

[0019] In the third aspect of the present application, a qPCR detection method for detecting the G protein gene of the rabies virus in the rabies virus culture solution by using the kit as described in the second aspect is provided, comprising the following steps:

[0020] 1) extracting RNA from the sample to be tested, and reverse transcribing to prepare cDNA;

[0021] 2) preparing a quantitative PCR reaction system, including cDNA, 2xT5 Fast qPCR Mix (probe), forward primer, reverse primer, probe, EASY Dilution and ddH2O;

[0022] 3) PCR reaction, and the reaction program comprises 95℃ pre-denaturation for 2 minutes, 1 cycle; 95℃ denaturation for 15 seconds, 60℃ annealing and extension for 30 seconds, 40 cycles;

[0023] 4) Result detection: The fluorescence signal of the FAM channel is monitored in real time using a real-time fluorescence quantitative PCR instrument (such as ABI Quant Studio 3), with the Ct value as the core indicator. This method is not used for the diagnosis and treatment of diseases.

[0024] Further, in step 2), the quantitative PCR reaction system is 20 μL, and the concentration or amount of each component is as follows: 10.0 μL of 2xT5 Fast qPCR Mix (probe), 0.7 μL each of forward primer (10 uM) and reverse primer (10 uM), 0.6 μL of probe (10 uM), 1.0 μL of cDNA, and the remainder is made up to 20 μL with ddH2O.

[0025] In a fourth aspect of the invention, a method for rapid detection of virus culture medium titers during rabies vaccine production is provided. This method can directly contribute to the optimization of the production process and includes the following steps:

[0026] 1) Virus culture: Rabies virus (CTN-1 strain) was inoculated into Vero cells and cultured according to vaccine production standards to obtain virus culture medium samples at different time points;

[0027] 2) Sampling: Take viral culture media at different time points in step 1), and use the kit as described in the second aspect and the qPCR detection method as described in the third aspect to obtain the Ct value of the G protein gene of the viral culture media to be tested.

[0028] 3) Construction of standard curve: Rabies virus standard was used, serially diluted and then qPCR was performed. A standard curve of Ct value-virus titer was plotted with virus titer as the x-axis and Ct value as the y-axis.

[0029] 4) Sample detection: Substitute the Ct value of the G-CTN gene of the virus culture medium to be tested in step 2) into the standard curve in step 3) to calculate the titer of the rabies virus culture medium. Determine the peak of virus proliferation based on the titer change trend, and then determine the optimal harvest time of the virus medium to optimize the production process.

[0030] The beneficial effects of this invention are as follows:

[0031] The application takes the G-CTN gene of the rabies virus G protein (Genbank accession number: FJ959397.1) as a specific detection target, designs a real-time fluorescence quantitative PCR (qPCR) primer probe set in a targeted manner, and constructs a standardized detection method and a matching technical system based on the primer probe set. Through the system, the G protein gene copy number in the virus culture solution in the rabies vaccine production process can be quantitatively detected, the virus proliferation dynamics can be accurately captured, and then the rapid determination of the virus proliferation in the rabies virus vaccine production link can be realized, thereby providing key technical support for the optimization of the vaccine production process, the determination of the optimal virus harvesting time and the quality control of the product.

[0032] The real-time fluorescence quantitative PCR (qPCR) detection method based on the rabies virus G protein gene constructed in the application has core application value in the rabies vaccine production process development and actual production link. Through the method, the enterprise can efficiently and economically monitor the virus proliferation dynamics, determine the optimal harvesting time point of the virus solution and optimize the production process. This not only reduces the production cost, improves the economic benefit, but also improves the quality control level of the vaccine production. The application of the method provides a feasible alternative solution for the biological pharmaceutical industry, solves the problems of high cost and low efficiency of the traditional detection method, and has important significance for promoting the innovation and development of the vaccine production process.

[0033] The method of the application has the advantages of low cost, high sensitivity, strong specificity, simple operation and the like. Compared with the prior art (especially the traditional ELISA method), the detection cost and time consumption are significantly reduced, and the production efficiency is improved. At the same time, the method provides reliable data for the optimization of the vaccine production process parameters (such as the culture time and the cell density), guarantees the quality stability of the vaccine product, provides an efficient alternative solution for the traditional detection method for the biological pharmaceutical industry, and promotes the innovation and development of the vaccine production process.

[0034] The DNA detection sensitivity of the qPCR detection method of the application can reach 0.0009911 pg / μL, which is much higher than the conventional standard requirement; the rabies virus antigen content detection sensitivity can reach 8.875*10 -5 IU / ml, avoiding false positive reactions. The specificity of the qPCR detection method of the application is good, and there is no amplification positive result for fetal bovine serum, MEM culture medium, influenza A virus H1N1 genome cDNA and influenza B virus BV genome cDNA. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 A real-time fluorescence quantitative polymerase chain reaction (qPCR) detection method for detecting the rabies virus G protein gene in rabies virus culture solution.

[0036] Figure 2DNA amplification curve of G-CTN gene standard plasmid of rabies virus G protein G-CTN gene in Example 2.

[0037] Figure 3 G-CTN gene standard curve of G-CTN gene standard plasmid of rabies virus G protein G-CTN gene in Example 2.

[0038] Figure 4 Amplification results of G protein G-CTN gene cDNA of rabies virus liquid of different dilution multiples in Example 3.

[0039] Figure 5 G-CTN gene cDNA standard curve of G protein G-CTN gene of rabies virus liquid of different dilution multiples in Example 3.

[0040] Figure 6 Amplification results of G protein G-CTN gene cDNA of rabies virus liquid of different dilution multiples in Example 4.

[0041] Figure 7 G-CTN gene cDNA standard curve of G protein G-CTN gene of rabies virus liquid of different dilution multiples in Example 4.

[0042] Figure 8 Amplification results of G protein G-CTN gene cDNA of rabies virus liquid of different dilution multiples in Example 4. DETAILED DESCRIPTION

[0043] The exemplary embodiments of the present application will be described in detail below with reference to the accompanying drawings. The following examples are only used to illustrate the present application and should not be regarded as limiting the scope of the present application.

[0044] The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used are commercially available unless otherwise specified. The RNA / DNA extraction kit and reverse transcription kit are purchased from Takara Bio Company. The G-CTN standard plasmid, primers and probes are synthesized by Beijing Qikang Biotechnology Co., Ltd. The 2xT5 Fast qPCR Mix (probe), EASY Dilution and Buffer required for the PCR reaction system are purchased from Takara Bio Company. The fluorescence quantitative PCR instrument is ABI QuantStudio3. The ultraviolet-visible spectrophotometer UV-8000 is purchased from Shimadzu Instruments (Suzhou) Co., Ltd. The rabies virus liquid (Vero cell), influenza A virus liquid H1N1, influenza B virus liquid and rabies virus standard are all from Jiangsu Jindike Biological Technology Co., Ltd.

[0045] It is apparent, however, that one or more embodiments can be practiced without such specific details, and that the specific scope of the embodiments presented should be determined by the following claims, and equivalents thereof, rather than by the contents of the detailed description. In some instances, detailed descriptions of well-known methods, devices, and materials can be omitted so as not to obscure the description of the embodiments of the application.

[0046] The molecular biology experimental methods not specifically described in the following examples are all carried out according to the specific methods listed in the book "Molecular Cloning Experiment Guide" (third edition) by J. Sambrook, or according to the kit and product instructions. The application object implemented by the present application is derived from biological products to be detected for rabies virus G protein, which belongs to biological samples; the direct purpose of the detection is to carry out laboratory detection or identification of whether the rabies virus G protein related gene, so as to be used for quality control of biological products, which does not belong to obtaining disease diagnosis results or health status, and the obtained results are not directly used for disease diagnosis. Therefore, the present application does not belong to the disease diagnosis method, which meets the basic requirements of the patent protection object of the "Patent Law".

[0047] The present application provides a primer and probe composition designed based on the rabies virus G protein G-CTN genome, and therefore constructs a rabies virus G protein genome qPCR detection method. The specific embodiments of the present application are described below, and the specific content is as follows:

[0048] Example 1 Design of primer and probe set

[0049] The inventors selected the target gene G-CTN (Genbank accession number: FJ959397.1) of the rabies virus G protein genome which is highly conserved and has species specificity through a large amount of literature research and target gene screening analysis, and designed a fluorescent quantitative PCR detection primer and corresponding probe for the G-CTN (Genbank accession number: FJ959397.1) gene. The primer and probe composition were designed using the Primer Premier 5.0 online primer design software, and the primer and probe were synthesized by Beijing Chengke Biological Technology Co., Ltd. The specific sequence is shown in Table 1:

[0050] Table 1 Name and sequence of primer and probe

[0051] Targeted gene Primer name Sequence (5'-3') Number in sequence listing G-CTN G-CTN-F CAGACTTAGACCCGTACGATAAATCAC SEQ ID NO. 1 G-CTN-R GTTGGTAGAGCAGTAGGCAGAAG SEQ ID NO. 2 G-CTN-P ACCGTTATTCCTGAGCAT SEQ ID NO. 3

[0052] The probe G-CTN-P is labeled with a fluorescent group-quenching group at both ends, and is homologous to the middle part sequence of the respective amplification fragment. The fluorescent group is FAM, and the quenching group is NFQ-MGB.

[0053] 1.2 qPCR reaction system

[0054] The qPCR reaction system containing the above primer and probe set has the following components:

[0055] 1) Forward primer and reverse primer, final concentration of each 10 uM; probe, final concentration of 10 uM;

[0056] 2) PCR reagents, including Probe qPCR Mix, with UNG, EASY Dilution purchased from Takara Bio Co., Ltd.

[0057] 3) Positive control: G-CTN standard plasmid, rabies virus harvest (Jiangsu Kingde Biotechnology Co., Ltd.).

[0058] 4) Negative control: ddH2O.

[0059] Example 2 Establishment of qPCR detection method based on rabies virus G protein G-CTN gene DNA

[0060] The G-CTN standard plasmid was synthesized by Beijing Qikang Biological Technology Co., Ltd. According to the measured OD value, the concentration of the standard plasmid was calculated to be about 9.911 ng / μL, and the specific information is as follows.

[0061] Standard plasmid Number of bases Molecular weight Concentration (ng / uL) Copy number (copies / uL) G-CTN 2803 1849980 9.911 3.23E+09

[0062] According to the determined standard plasmid concentration, dilute with ddH2O to the corresponding concentration in turn, which are 99.11 pg / μL, 9.911 pg / μL, 0.9911 pg / μL, 0.09911 pg / μL, 0.009911 pg / μL, 0.0009911 pg / μL, respectively, which are used as 6 known concentration DNA reaction samples, and NTC is the negative control of the sample. The primer and probe are used to prepare the PCR reaction system:

[0063] 2.2, Reaction system / G-CTN detection

[0064] Forward detection primer G-CTN-F (10 uM, 0.7 uL) and reverse detection primer G-CTN-F (10 uM, 0.7 uL), detection probe is G-CTN-P (10 uM, 0.6 uL), 2xT5 Fast qPCR Mix (probe) (10 uL), DNA template 1 uL, add ddH2O to 20 uL, that is, the total reaction system is 20 uL.

[0065] 2.3, Reaction program

[0066] Set the amplification program in the fluorescence quantitative PCR instrument: the reaction program includes 95℃ pre-denaturation for 2 minutes, 1 cycle; 95℃ denaturation for 15 seconds, 60℃ annealing and extension for 30 seconds, 40 cycles; collect the fluorescence of FAM reporter group after derivation.

[0067] 2.4 Test results

[0068] Using primers and probes designed based on the G-CTN gene of the rabies virus G protein, DNA samples at six known concentrations (99.11 pg / μL, 9.911 pg / μL, 0.9911 pg / μL, 0.09911 pg / μL, 0.009911 pg / μL, and 0.0009911 pg / μL) were amplified and detected. The amplification curves for G-CTN detection (…) Figure 2 ) and standard curve ( Figure 3 It can be seen that the linear detection parameters are good, and the correlation coefficient (R) is good. 2 The linearity was 0.999, the amplification efficiency (E value) was 90.3%, and the linearity results met the requirements for quantitative real-time PCR (qPCR) detection.

[0069] Among seven DNA samples with known concentrations, the lowest concentration of 0.0009911 pg / μL resulted in positive amplification of the corresponding primer and probe composition for the G-CTN gene. This allows us to deduce the detection method for rabies virus G protein described in this invention, with a sensitivity of at least 0.0009911 pg / μL.

[0070] Example 3: Establishment of a qPCR detection method based on rabies virus G protein G-CTN gene cDNA

[0071] 3.1 Preparation of cDNA template

[0072] Rabies virus standard (virus titer 8.875 IU / ml) was provided by Jiangsu Jindike Biotechnology Co., Ltd. The rabies virus standard was serially diluted with ddH2O to the original solution, 10 times, 100 times, 1000 times and 10000 times respectively.

[0073] Total rabies virus RNA was extracted according to the instructions of the TaKaRa MiniBEST Viral RNA / / DNA Extraction Kit Ver. 5.0, and the purity and concentration of the RNA were determined. Then, 1 μL of the extracted RNA was used for reverse transcription with the TaKaRa PrimeScript reverse transcription kit. TM The RT reagent kit with gDNA Eraser (Perfect Real Time) was used to reverse transcribe cDNA. NTC served as a negative control for the sample. Primers and probes were used to prepare the qPCR reaction system.

[0074] 3.2 Reaction System / G-CTN Detection

[0075] Forward detection primer G-CTN-F (10 μM, 0.7 μL) and reverse detection primer G-CTN-F (10 μM, 0.7 μL), detection probe G-CTN-P (10 μM, 0.6 μL), 2xT5 Fast qPCR Mix (probe) (10 μL), 1 μL of cDNA template, and ddH2O to 20 μL, and the total reaction system is 20 μL.

[0076] 3.3, Reaction procedure

[0077] The amplification program is set in the fluorescence quantitative PCR instrument: the reaction procedure includes 95°C pre-denaturation for 2 minutes, 1 cycle; 95°C denaturation for 15 seconds, 60°C annealing and extension for 30 seconds, 40 cycles; and the fluorescence of the FAM reporter group is collected after derivation.

[0078] 3.4 Test results

[0079] The five cDNA samples are amplified and detected by using the primer and probe group amplified according to the G protein G-CTN gene of the rabies virus. As shown in the amplification curve of G-CTN detection ( Figure 4 ), positive amplification can be obtained in the five cDNA samples with known concentrations by using the corresponding primer and probe combination of the G-CTN gene. As shown in the amplification curve of G-CTN detection ( Figure 4 ) and the standard curve ( Figure 5 ), the linear detection parameters are good, the correlation coefficient (R2) is 0.9989, the amplification efficiency is 95%, which is within the ideal efficiency range (90%-110%) of qPCR, and it is proved that the experimental system is well optimized, and the results meet the detection requirements of fluorescence quantitative PCR (qPCR). That is, the detection method of the G-CTN target gene related to the G protein of the rabies virus can be deduced, and the sensitivity can reach at least 8.875*10 -5 IU / ml.

[0080] 3.5, Specificity

[0081] The influenza A virus H1N1 and influenza B virus BV genomic cDNA extracted and prepared are diluted to a concentration of not less than 50 pg / μL by using EASY Dilution, 1 μL of the influenza A virus H1N1 and influenza B virus BV genomic cDNA is taken as a template and added to the reaction system, and the total reaction system is 20 μL.

[0082] As shown in Table 2, the experiment verifies the detection platform constructed by the primer and probe composition for the rabies virus G protein G-CTN gene, 1 μL of fetal bovine serum, MEM medium, influenza A virus H1N1 genome cDNA, and influenza B virus BV genome cDNA are added to each reaction, respectively, and no amplification positive results are obtained. It shows that the specificity of the qPCR detection method based on the rabies virus G protein gene cDNA is good.

[0083] Table 2 Specificity verification experiment results of rabies virus G protein cDNA detection

[0084]

[0085]

[0086] Note: -: not detected

[0087] Example 4 Application of the qPCR detection method based on the rabies virus G protein G-CTN gene cDNA

[0088] 4.1 Preparation of rabies virus culture solution:

[0089] The rabies virus (CTN-1 strain) was inoculated into Vero cells for culture, and the virus harvest liquid in the perfusion culture process was taken to the refrigerator at 2-8℃ for standby. The virus harvest liquid was determined by rabies vaccine potency (antigen) determination kit (enzyme-linked immunoassay) (Ningbo Tianlun Biological Pharmaceutical Co., Ltd.) to determine its virus titer.

[0090] 4.2 Preparation of cDNA template

[0091] The rabies virus standard (virus titer 8.875 IU / ml) was provided by Jiangsu Jindike Biological Technology Co., Ltd. The rabies virus standard was gradiently diluted with ddH2O in turn, and was diluted to the original times, 4 times, 16 times, 64 times, 256 times, 1024 times, 4096 times and 16384 times, respectively.

[0092] According to the operation instruction of TaKaRa MiniBEST Viral RNA / / DNA Extraction Kit Ver.5.0, the total RNA of the rabies virus was extracted. Then 1 μL of the extracted RNA was reversely transcribed into cDNA by the reverse transcription kit TaKaRa PrimeScript TM RTreagent Kit with gDNA Eraser (Perfect Real Time), NTC is the negative control of the sample, and the primer and probe are used to prepare the qPCR reaction system.

[0093] 4.3 Reaction system / G-CTN detection

[0094] Forward detection primer G-CTN-F (10 μM, 0.7 μL) and reverse detection primer G-CTN-F (10 μM, 0.7 μL), detection probe G-CTN-P (10 μM, 0.6 μL), 2xT5 Fast qPCR Mix (probe) (10 μL), 1 μL of cDNA template, add ddH2O to 20 μL, the total reaction system is 20 μL.

[0095] 4.4, reaction procedure

[0096] The amplification program was set in the fluorescence quantitative PCR instrument: the reaction procedure included 95°C pre-denaturation for 2 minutes, 1 cycle; 95°C denaturation for 15 seconds, 60°C annealing and extension for 30 seconds, 40 cycles; after derivation, the fluorescence of FAM reporter group was collected.

[0097] 4.5 standard curve construction

[0098] It can be seen from the amplification curve of G-CTN detection ( Figure 6 ) that among the 7 known concentration standard samples, positive amplification can be obtained by the combination of G-CTN gene corresponding primers and probes, the amplification curve of G-CTN detection ( Figure 6 ) and the standard curve ( Figure 7 ) can show that the linear detection parameters are good, the correlation coefficient (R2) is 0.9938, the amplification efficiency is 97%, which is within the ideal efficiency range (90%-110%) of qPCR, and the results meet the requirements of qPCR detection.

[0099] 4.6 determination of virus culture solution

[0100] The Ct value of the virus culture solution to be tested was substituted into the standard curve of Example 4 (4.5) to calculate the titer of the rabies virus culture solution.

[0101] The qPCR detection results of 3 virus culture solution samples are shown in Figure 8 , which are highly consistent with the ELISA results, and can be actually used for determining the optimal harvest time in vaccine production;

[0102]

[0103] In the research of the present application, through literature and NCBI database, the gene sequence with characteristics of high repetitive sequence, species specificity correlation and the like based on the G protein of rabies virus is selected as the target amplification fragment, and the primer and probe sequences are designed. The primers and probes (unsuitable primer sequences are not described in detail here) are screened through a large number of experimental verifications, which can guarantee a certain sensitivity and specificity. In addition, in order to improve the success rate of establishing the qPCR detection method with good specificity, high sensitivity and stability, the selection of target gene (good specificity and high sensitivity), the size of amplification product (amplification efficiency), the annealing temperature and GC content control of primer and probe, the Tm difference control between primers and between primers and probe, and the avoidance of primer dimer and primer-probe dimer are comprehensively considered in the early stage.

[0104] In the research and development process, a series of technical problems such as reaction system and reaction procedure are further optimized, therefore, the beneficial effects of the present application are obtained through a large amount of creative labor in the process of a large number of experimental designs and verifications. Finally, the rabies virus liquid sample is verified, and it is proved that the DNA detection sensitivity of the qPCR detection method of the present application can reach 0.0009911 pg / μL, which is much higher than the conventional standard requirement; the rabies virus antigen content detection sensitivity can reach 8.875*10 -5 IU / ml, which avoids false positive reaction.

[0105] The specific embodiments of the present application have been described in detail, so that those skilled in the art will easily understand. However, all the descriptions have been disclosed, and different modifications or substitutions can be made to those details, and these changes are within the protection scope of the present application. The whole scope of the present application is given by the appended claims and any equivalents thereof.

Claims

1. A primer and probe set for real-time quantitative PCR detection of rabies virus G protein gene specificity, characterized in that, The primer-probe set is selected from any one of the following three combinations: 1) The primers and probes described are forward primer G-CTN-F, reverse primer G-CTN-R, and probe G-CTN-P designed based on the G-CTN gene of rabies virus G protein, and their nucleotide sequences are shown in SEQ ID NO: 1-3 in sequence; 2) The primers and probes described herein have sequences with no more than 4 nucleotide substitutions, deletions, or additions compared to the sequences SEQ ID NO: 1-3 in group 1) above; 3) The primers and probes described above have 85%-99.99% sequence homology with the sequences SEQ ID NO: 1-3 in group 1) above, and have the same function as the sequences SEQ ID NO: 1-3. The names and sequences of the primers and probes are shown in the table below: 。 2. The primer-probe set according to claim 1, characterized in that, The probe G-CTN-P is dual-labeled with fluorescent and quenching groups at both ends, and is homologous to the middle part of the sequence of its respective amplified fragment.

3. The primer-probe set according to claim 1, characterized in that, The fluorescent group is FAM, and the quenching group is NFQ-MGB.

4. A kit for detecting the G protein gene of rabies virus, characterized in that, It includes the primer and probe set as described in claim 1.

5. The reagent kit according to claim 4, characterized in that, The kit also includes 2xT5Fast qPCRMix (probe) and EASYDilution buffer.

6. A qPCR detection method for detecting the rabies virus G protein gene in rabies virus culture medium using the kit described in claim 4 or 5, characterized in that, Includes the following steps: 1) Extract RNA from the sample to be tested and reverse transcribe it to prepare cDNA; 2) Prepare the quantitative PCR reaction system, including cDNA, 2xT5 Fast qPCR Mix (probe), forward primer, reverse primer, probe, EASYDilution and ddH2O; 3) PCR reaction, the reaction program includes 95℃ pre-denaturation for 2 minutes, 1 cycle; 95℃ denaturation for 15 seconds, 60℃ annealing extension for 30 seconds, 40 cycles; 4) Result detection: The fluorescence signal of the FAM channel is monitored in real time using a real-time fluorescence quantitative PCR instrument, with the Ct value as the core indicator. This method is not used for the diagnosis and treatment of diseases.

7. The qPCR detection method according to claim 6, characterized in that, In step 2), the quantitative PCR reaction system is 20 μL, and the concentrations or amounts of each component are as follows: 10.0 μL of 2xT5 Fast qPCR Mix (probe), 0.7 μL each of 10 μM forward primer and 10 μM reverse primer, 0.6 μL of 10 μM probe, 1.0 μL of cDNA, and the remainder is made up to 20 μL with ddH2O.

8. A rapid detection method for virus culture medium titer during rabies vaccine production, characterized in that, Includes the following steps: 1) Virus culture: Rabies virus CTN-1 strain was inoculated into Vero cells and cultured according to vaccine production standards to obtain virus culture medium samples at different time points; 2) Sampling: Take viral culture medium at different time points in step 1), and use the kit described in claim 4 or 5 and the detection method described in claim 6 or 7 to obtain the Ct value of the G protein gene of the viral culture medium to be tested; 3) Construction of standard curve: Rabies virus standard was used, serially diluted and then qPCR was performed. A standard curve of Ct value-virus titer was plotted with virus titer as the x-axis and Ct value as the y-axis. 4) Sample detection: Substitute the Ct value of the G-CTN gene in the virus culture medium to be tested in step 2) into the standard curve in step 3) to calculate the titer of the rabies virus culture medium.

Images