Primer pair and kit for detecting Marek's disease virus MEQ gene as well as detection method and application thereof

Abstract

The invention discloses a primer pair and a kit for detecting a Marek's disease virus MEQ gene as well as a detection method and application thereof, and belongs to the technical field of biological detection. The nucleotide sequences of the forward primer and the reverse primer of the primer pair are shown as SEQ ID NO. 1 and SEQ ID NO. 2 in sequence. According to the primer pair for Marek's disease virus MEQ gene detection and the kit and the detection method based on the primer pair, based on the primer pair, the Marek's disease virus can be specifically amplified, rapid and accurate detection of the Marek's disease virus is achieved, and the primer pair has the advantages of being easy and convenient to operate, low in cost, high in sensitivity and the like; the problems that an existing detection method is high in detection cost, long in time, high in requirement for detection personnel, needs professional training, is only suitable for auxiliary diagnosis of a laboratory, cannot be popularized and applied and the like are solved, and the method has important significance on early detection of viruses.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a primer pair, kit, detection method, and application for detecting the MEQ gene of Marek's disease virus. Background Technology

[0002] Marek's disease (MD) in chickens is a highly contagious and pathogenic disease caused by Marek's disease virus (MDV). MDV infection typically leads to emaciation, neurological damage, and is characterized by lymphoid tissue proliferation and tumor formation in chickens. Serologically, it can be divided into three serotypes: serotype I (MDV-1 / GaHV-2), serotype II (MDV2 / GaHV-3), and serotype III (HVT). Only serotype I is pathogenic and tumorigenic to the host. The MEQ gene is the most important oncogene of MDV and is specific to MDV-1; it is expressed during lysis and the latency period after infection, affecting T cell transformation.

[0003] In recent years, with the rapid development of poultry farming towards intensification and large-scale operations, the research and application of virus detection have continued to advance. However, there are still many unresolved issues regarding virus detection methods. Currently, detection methods for Marek's disease virus (MDV) include conventional PCR, real-time quantitative PCR, and ELISA. However, all three methods require bulky or expensive equipment, have long testing times, and demand highly skilled personnel requiring specialized training. In practice, they are only suitable for auxiliary laboratory diagnosis and cannot be widely applied. Summary of the Invention

[0004] To address the aforementioned technical problems, the present invention aims to provide a primer pair, reagent kit, detection method, and application for detecting the MEQ gene of Marek's disease virus, thereby solving the problems of existing Marek's disease virus detection methods requiring bulky or expensive instruments and equipment, long detection times, high requirements for testing personnel, need for professional training, suitability only for laboratory auxiliary diagnosis, and inability to be widely applied.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the present invention provides a primer pair for detecting the MEQ gene of Marek's disease virus, wherein the nucleotide sequences of the forward primer and the reverse primer of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. SEQ ID NO.1: TGTGACGCCGCTCGGAGAAGACGCAGGAAGC; SEQ ID NO. 2: AGTGCAAATGGGAGGTTCAGGAACGGGATC.

[0006] The beneficial effects of this invention are as follows: This invention provides a primer pair for detecting the MEQ gene of Marek's disease virus. This primer pair can specifically amplify Marek's disease virus and has no cross-reaction with the nucleic acids of infectious bursal virus, Newcastle disease virus and infectious bronchitis virus in chickens. It has high specificity and can achieve rapid and accurate detection of Marek's disease virus.

[0007] In a second aspect, the invention provides the use of the primer pair described above for detecting the MEQ gene of Marek's disease virus in the preparation of reagents or kits for detecting Marek's disease virus.

[0008] A third aspect of the present invention provides a kit for detecting Marek's disease virus, comprising the primer pair described above for detecting the MEQ gene of Marek's disease virus.

[0009] This invention provides a kit for detecting Marek's disease virus. The kit contains primer pairs for specific amplification of Marek's disease virus, MIRA amplification reaction system preparation, and CRISPR / Cas12a reaction system preparation, which enables rapid, convenient, efficient and specific detection of Marek's disease virus, and is suitable for mobile field testing.

[0010] Furthermore, the kit also includes MIRA amplification reaction powder, CRISPR / Cas12a reaction system, buffer, magnesium acetate, negative control and positive control.

[0011] Furthermore, negative controls include ddH2O.

[0012] Furthermore, the positive control includes the Marek's disease virus MEQ gene, the nucleotide sequence of which is shown in SEQ ID NO.3; SEQ ID NO.3: TGTGACGCCGCTCGGAGAAGACGCAGGAAGCAGACGTACTATGTAGACAAACTCCATGAAGCATGTGAAGAGCTGCAGAGGGCCAATGAACACCTACGTAAGGAAATTCGAGATCTAAGGACTG AGTGCACGTCCCTGCGTGTACAGTTGGCTCGTCATGAGCCAGTTTGCCCTATGGCGGTACCCCTAACGGTGACCCTTGGACTGCTTACCACCCCGCACGATCCCGTTCCTGAACCTCCCATTTGCACT.

[0013] Furthermore, the CRISPR / Cas12a reaction system includes LbCas12a, crRNA, 10×CasSmart Buffer, fluorescent probe, and ddH2O.

[0014] The beneficial effects of adopting the above-mentioned further technical solutions are as follows: the source of the general reagents in the reagent kit of the present invention does not have special requirements, and commercially available products familiar to those skilled in the art can be used. The reagent requirements are low and the sources are wide.

[0015] Furthermore, the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.4; SEQ ID NO.4: 5'-FAM-TTATT-BHQ I-3'.

[0016] Furthermore, the nucleotide sequence of crRNA is shown in SEQ ID NO.5; SEQ ID NO. 5: UAAUUUCUACUAAGUGUAGAUCUUACGUAGGUGUUCAUUG.

[0017] In a fourth aspect, the invention provides the use of primer pairs for detecting the MEQ gene of Marek's disease virus or kits for detecting Marek's disease virus in non-disease diagnostic purposes.

[0018] A fifth aspect of the present invention provides a method for detecting Marek's disease virus for non-disease diagnostic purposes, using the above-described kit, specifically comprising the following steps: S1. Extract DNA from the sample to be tested; S2. Using the DNA obtained in S1 as a template, perform MIRA amplification using the reagents in the kit; S3. Using the amplification product obtained in S2 as a template, perform a real-time fluorescent CRISPR / Cas12a reaction using the reagents in the kit and collect the fluorescence signal. S4. Based on the fluorescence signal obtained in S3, if the peak time is ≤20 min or the Ct value is ≤38, the sample to be tested is positive for Marek's disease virus; if the peak time is >20 min or the Ct value is >38, the sample to be tested is negative for Marek's disease virus.

[0019] The beneficial effects of this invention are as follows: This invention provides a rapid, low-cost, easy-to-operate, highly sensitive, and low-false-positive method for detecting Marek's disease virus, which solves the problems of existing Marek's disease virus detection methods, such as requiring bulky or expensive instruments and equipment, long detection time, high requirements for testing personnel, need for professional training, being only suitable for laboratory auxiliary diagnosis, and being unable to be widely applied.

[0020] Furthermore, in the reaction system for the MIRA amplification reaction, the mass-to-volume ratio of MIRA amplification reaction powder, buffer, magnesium acetate, forward primer, reverse primer, DNA template, and ddH2O is 15 mg: 29.4 μL: 2.5 μL: 2 μL: 5 μL: 9.1 μL.

[0021] Furthermore, the concentrations of both the forward and reverse primers were 5-20 μmol / L.

[0022] Furthermore, in the CRISPR / Cas12a reaction system, the volume ratio of LbCas12a, crRNA, 10×CasSmartBuffer, fluorescent probe, amplification template, and ddH2O is 2 μL:0.5 μL:5 μL:0.5 μL:1 μL:41 μL.

[0023] Furthermore, the concentration of LbCas12a was 0.05-0.2 μmol / L.

[0024] Furthermore, the concentration of crRNA was 0.5-2 ng / μL.

[0025] Furthermore, the concentration of the fluorescent probe is 0.5-2 μmol / L.

[0026] Furthermore, the reaction program for the CRISPR / Cas12a reaction is: 42℃ for 60 s; 42℃ for 20 s, for 60 cycles.

[0027] The present invention has the following beneficial effects: 1. This invention provides a primer pair that can specifically amplify the MEQ gene of Marek's disease virus. This primer pair has no cross-reactivity with the nucleic acids of infectious bursal virus, Newcastle disease virus and infectious bronchitis virus of chickens, and has high specificity.

[0028] 2. This invention provides a Marek's disease virus MEQ gene MIRA amplification reaction system, which can rapidly complete the amplification of low-concentration Marek's disease virus nucleic acid, and has strong anti-interference ability and stability.

[0029] 3. This invention provides a method for real-time CRISPR / Cas12a fluorescence detection of Marek's disease virus based on the above primer pairs. This method can complete rapid detection within 30 minutes and can detect low-copy Marek's disease virus nucleic acid. It has the advantages of simple operation, low cost, high sensitivity and low false positive rate. Attached Figure Description

[0030] Figure 1 This is a graph showing the screening and detection results of crRNA in Example 1; Figure 2 This is an agarose gel electrophoresis result of the PCR amplification product of the chicken Marek's disease virus MEQ gene primer pair in Example 2. Figure 3 The amplification results of the positive and negative controls in Example 3 are shown in the figure. Figure 4 The graph shows the sensitivity detection results of the method for detecting Marek's disease virus in chickens in Experiment Example 2; Figure 5 This is a graph showing the specific detection results of the chicken Marek's disease virus method in Experiment Example 3. Detailed Implementation

[0031] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0032] Example 1: Design and screening of crRNA I. Design of crRNA The MDV-MEQ gene sequences (GenBank accession numbers: KJ464763.1, KJ464764.1, MK388086.1, MK388087.1, OQ576796.1, OQ576812.1, MW219796.1, MW219797.1, AY243332.1, MG913293.1, MT265073.1, MF773447.1, PP387458) in the NCBI database were used. 1. Using PP397103.1, PP397104.1, MK046676.1, AY362727.1, AY362726.1, JX467679.1, JX467680.1, MT648227.1, OR592073.1, OR592074.1, and OL409036.1 as references, and based on conserved regions from gene alignment analysis and homology analysis, the following crRNA and probe (P) sequences were designed based on the PAM site: crRNA1: UAAUUUCUACUAAGUGUAGAUCCCUAUGGCGGUACCCCUA (SEQ ID NO. 6); crRNA2: UAAUUUCUACUAAGUGUAGAUCUUACGUAGGUGUUCAUUG (SEQ ID NO.5); Probe sequence: P: 5'-FAM-TTATT-BHQ I-3' (SEQ ID NO. 4).

[0033] II. Screening of crRNA Using the Marek's disease virus MEQ gene (SEQ ID NO.3) as a template and ddH2O as a negative control, real-time fluorescent CRISPR / Cas12a reactions were performed using the two groups of crRNAs mentioned above. The reaction program for real-time fluorescent CRISPR / Cas12a was: 42℃ for 60 s; 42℃ for 30 s, for 60 cycles. The results are as follows: Figure 1 As shown.

[0034] Depend on Figure 1 It can be seen that, under the same primer and probe concentration, the primer group with the smaller Ct value and the largest amount of amplified product is crRNA2, which was selected as the crRNA for detecting the MEQ gene of Marek's disease virus in this invention.

[0035] Example 2: Primer design and screening I. Primer Design Based on the results obtained in Example 1, the upstream and downstream primer sequences are designed as follows: F1: CAAACTCCATGAAGCATGTGAAGAGCTGCAG (SEQ ID NO.7); F2: TGTGACGCCGCTCGGAGAAGACGCAGGAAGC (SEQ ID NO. 1); R1: AGTGCAAATGGGAGGTTTCAGGAACGGGATC (SEQ ID NO. 2); R2: TGTAAGCAGTCCAAGGGTCACCGTTAGGG (SEQ ID NO. 8).

[0036] II. Primer Screening F1, F2, R1, and R2 were divided into four groups: F1R1, F1R2, F2R1, and F2R2. Then, using the Marek's disease virus MEQ gene (SEQ ID NO.3) as a template and ddH2O as a negative control, MIRA amplification was performed using the above four groups of primers. Finally, the amplification products were analyzed by 1% agarose gel electrophoresis. The experimental results are shown below. Figure 2 As shown, lanes M, P, and N, from left to right, represent the marker, the MDV-MEQ gene plasmid, and the ddH2O negative control, respectively.

[0037] Depend on Figure 2It can be seen that, under the same primer concentration, the primer pair with the highest amplification product is F2R1, which is the primer pair for detecting the MEQ gene of Marek's disease virus in this invention.

[0038] Example 3: Kit for detecting Marek's disease virus A kit for detecting Marek's disease virus, comprising forward and reverse primers as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0039] SEQ ID NO.1: TGTGACGCCGCTCGGAGAAGACGCAGGAAGC; SEQ ID NO. 2: AGTGCAAATGGGAGGTTCAGGAACGGGATC.

[0040] It also includes MIRA amplification reaction dry powder, PEG and other system buffers, magnesium acetate, positive control (Marek's disease virus MEQ gene, nucleotide sequence as shown in SEQ ID NO.3), negative control (ddH2O) and CRISPR / Cas12a reaction system.

[0041] SEQ ID NO.3: TGTGACGCCGCTCGGAGAAGACGCAGGAAGCAGACGTACTATGTAGACAAACTCCATGAAGCATGTGAAGAGCTGCAGAGGGCCAATGAACACCTACGTAAGGAAATTCGAGATCTAAGGACTG AGTGCACGTCCCTGCGTGTACAGTTGGCTCGTCATGAGCCAGTTTGCCCTATGGCGGTACCCCTAACGGTGACCCTTGGACTGCTTACCACCCCGCACGATCCCGTTCCTGAACCTCCCATTTGCACT.

[0042] The CRISPR / Cas12a reaction system includes LbCas12a, crRNA, 10×CasSmart Buffer, fluorescent probe, and ddH2O.

[0043] LbCas12a and 10×CasSmart Buffer were purchased from Beijing Xunshi Biotechnology Co., Ltd. The nucleotide sequence of crRNA is: UAUUUCUACUAAGUGUAGAUCUUACGUAGGUGUUCAUUG (SEQ ID NO. 5); The nucleotide sequence of the fluorescent probe is: 5'-FAM-TTATT-BHQ Ⅰ-3' (SEQ ID NO.4).

[0044] Example 4: A method for detecting Marek's disease virus for non-disease diagnostic purposes A method for detecting Marek's disease virus for non-disease diagnostic purposes, using the kit obtained in Example 3, specifically includes the following steps: S1, DNA template extraction Following the instructions of the AxyPrep Body Fluid Virus DNA / RNA Mini-Extraction Kit (purchased from Guangzhou Suyan Biotechnology Co., Ltd.), genomic DNA was extracted from the sample to be tested and used as a DNA template.

[0045] S2, MIRA amplification reaction Each sample to be tested corresponds to one MIRA amplification reaction dry powder tube. The reaction system in each MIRA amplification reaction dry powder tube is 50 μL, including: 15 mg MIRA amplification reaction dry powder, 29.4 μL of PEG buffer, 2.5 μL of magnesium acetate, 2 μL each of forward and reverse primers (concentration of 10 μmol / L), 9.1 μL of ddH2O and 5 μL of DNA template.

[0046] After mixing, the reaction solution was quickly centrifuged to the bottom of the tube, and then the reaction tube was immediately placed in a constant temperature device and incubated at 37°C for 20 min. After the reaction was completed, the protein was denatured using extraction buffer. The specific procedure was as follows: 50 μL of Tris saturated phenol / chloroform / isoamyl alcohol DNA extraction buffer was added to the reaction product, mixed, and centrifuged at 12000 rpm for 5 min. The supernatant was then collected.

[0047] S3, Real-time fluorescence CRISPR / Cas12a reaction First, take 5 μL of the supernatant obtained from LS2 and put it into the CRISPR / Cas12a reaction system, which includes 2 μL of LbCas12a, 0.5 μL of crRNA, 5 μL of 10×CasSmart Buffer, 0.5 μL of fluorescent probe and 41 μL of ddH2O.

[0048] Then, using Marek's disease virus MEQ gene nucleic acid (SEQ ID NO.3) as a positive control and ddH2O as a negative control, the reaction tube of the prepared real-time fluorescent CRISPR / Cas12a reaction system was inverted several times to mix thoroughly, and centrifuged at 5000 rpm for 10 s to ensure that all the reaction solution was centrifuged to the bottom of the tube.

[0049] Finally, the reaction tube was placed in a fluorescence quantitative PCR instrument and subjected to 60 cycles at 42°C for 60 s and 42°C for 20 s, and the fluorescence signal was collected.

[0050] S4. Signal judgment The determination of the sample to be tested is based on the peak time or Ct value of the fluorescence signal obtained from S3, and the judgment criteria are as follows: Positive control: The appearance of an amplification curve, or the peak time ≤20 min or the Ct value ≤38, indicates a valid result; Negative control: No amplification curve appears, or the peak time is >20 min or the Ct value is >38, which is a valid result; For samples to be tested: if the elution time is ≤20 min or the Ct value is ≤38, the sample can be judged to be positive for Marek's disease virus; if the elution time is >20 min or the Ct value is >38, the sample can be judged to be negative for Marek's disease virus.

[0051] The total experimental time was 21 min. When the peak appeared within 20 min, the Ct value was ≤38. When the peak appeared after 20 min, the Ct value was >38. The specific judgment index was determined based on the x-axis of the real-time fluorescence spectrum of CRISPR / Cas12a.

[0052] The amplification results of the positive and negative controls in this embodiment are as follows: Figure 3 As shown, from top to bottom are the positive control, baseline, and negative control.

[0053] Depend on Figure 3 As can be seen, both the positive and negative controls in this embodiment yielded valid results. The negative control design effectively verifies whether the reagents used are contaminated, avoiding false positives, while the positive control design effectively verifies the effectiveness of the reagents used, avoiding false negatives.

[0054] Experimental Example 1: Clinical Sample Testing Thirty-six clinical samples provided by a poultry farm in South China were used as test samples. qPCR and the method for detecting Marek's disease virus in Example 4 of this invention were used for detection, and the results were compared.

[0055] The qPCR detection method specifically includes the following steps: Genomic DNA was extracted from the sample according to the instructions of the Animal Tissue Total DNA / RNA Extraction Kit (DP431) (Guangzhou Sijia Biotechnology Co., Ltd.), and then qPCR detection was performed.

[0056] The qPCR reaction program was as follows: 95℃ for 30 s; denaturation at 95℃ for 5 s, annealing at 55℃ for 30 s, extension at 60℃ for 34 s, for 40 cycles.

[0057] The qPCR reaction system was as follows: MDV-F (10 µmol / L) 1 µL, MDV-R (10 µmol / L) 1 µL, ddH2O 10.5 µL, Premix Ex Taq 10 µL, MDV-MGB probe 0.5 µL, and template 2 μL.

[0058] The detection results of qPCR and the detection method in Example 4 are shown in Table 1.

[0059] Table 1 Sample test results

[0060] As shown in Table 1, the real-time fluorescence CRISPR / Cas12a detection results and qPCR detection results used in Example 4 of this invention are highly consistent, indicating that the method of this invention has good specificity and stability. Moreover, the method of this invention can complete the detection within 30 minutes, which has the advantages of simple operation and low cost, and is more suitable for on-site mobile detection, which has advantages that the qPCR detection method does not have.

[0061] Experimental Example 2: Sensitivity Detection A positive standard plasmid for the MEQ gene of Marek's disease virus was constructed by Sangon Biotech (GenBank accession number MW219796). The constructed positive standard plasmid was serially diluted, with each diluted 10^6 times. 8 copies / μL, 10 6 copies / μL, 10 4 copies / μL, 10 2 copies / μL and 10 0 Five positive standard plasmids at concentrations of 5 copies / μL were used as templates, with ddH2O as a negative control. Five μL of each plasmid was used as the reaction template, and nucleic acid amplification was performed according to the steps described in Example 4 to test the sensitivity of the method for detecting Marek's disease virus of this invention. The detection results are as follows: Figure 4 As shown.

[0062] Depend on Figure 4 It can be seen that the detection results of the positive standard plasmids at five concentration gradients all have Ct values ​​≤ 38, indicating that they are positive for Marek's disease virus. The results show that the detection method of this invention can detect concentrations as low as 10... 0 Templates with copies / μL provide high detection sensitivity.

[0063] Experimental Example 3: Specificity Detection Using Marek's disease virus MEQ gene nucleic acid (SEQ ID NO.3) as a positive control and ddH2O as a negative control, nucleic acids for infectious bursal disease virus, Newcastle disease virus, and infectious bronchitis virus were detected, respectively. Nucleic acid amplification was performed according to the steps described in Example 4 to test the specificity of the method for detecting Marek's disease virus of this invention. The detection results are as follows: Figure 5 As shown.

[0064] Depend on Figure 5 It was found that only the experimental group corresponding to the Marek's disease virus positive control template showed a normal fluorescence detection curve, while no amplification curve was observed in the experimental groups and negative control groups for other viruses. The results indicate that the primer pairs and probes of this invention can achieve specific detection of Marek's disease virus and show no cross-reactivity with the nucleic acids of infectious bursal virus, Newcastle disease virus, and infectious bronchitis virus in chickens.

[0065] In summary, the primer pairs and kits provided by this invention can achieve rapid, convenient, efficient and specific detection of Marek's disease virus in samples, and can assist in the diagnosis of whether Marek's disease virus infection is present. They are suitable for clinical differential detection, animal disease detection and purification.

[0066] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer pair for detecting the MEQ gene of Marek's disease virus, characterized in that, The nucleotide sequences of the forward and reverse primers of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

2. The use of the primer pair for detecting the MEQ gene of Marek's disease virus as described in claim 1 in the preparation of reagents or kits for detecting Marek's disease virus.

3. A kit for detecting Marek's disease virus, characterized in that, Includes the primer pair for detecting the MEQ gene of Marek's disease virus as described in claim 1.

4. The kit for detecting Marek's disease virus according to claim 3, characterized in that, The kit also includes MIRA amplification reaction powder, CRISPR / Cas12a reaction system, buffer, magnesium acetate, negative control and positive control.

5. The kit for detecting Marek's disease virus according to claim 4, characterized in that, The negative control includes ddH2O; The positive control includes the Marek's disease virus MEQ gene, the nucleotide sequence of which is shown in SEQ ID NO.

3.

6. The kit for detecting Marek's disease virus according to claim 4, characterized in that, The CRISPR / Cas12a reaction system includes LbCas12a, crRNA, 10×CasSmart Buffer, fluorescent probe, and ddH2O; The nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.4; The nucleotide sequence of the crRNA is shown in SEQ ID NO.

5.

7. The use of the primer pair for detecting the MEQ gene of Marek's disease virus as described in claim 1 or the kit for detecting Marek's disease virus as described in any one of claims 3-6 in the detection of Marek's disease virus for non-disease diagnostic purposes.

8. A method for detecting Marek's disease virus for non-disease diagnostic purposes, characterized in that, The kit according to any one of claims 3-6 is specifically used in the following steps: S1. Extract DNA from the sample to be tested; S2. Using the DNA obtained in S1 as a template, perform MIRA amplification using the reagents in the kit; S3. Using the amplification product obtained in S2 as a template, perform a real-time fluorescent CRISPR / Cas12a reaction using the reagents in the kit and collect the fluorescence signal. S4. Based on the fluorescence signal obtained in S3, if the peak time is ≤20 min or the Ct value is ≤38, the sample to be tested is positive for Marek's disease virus; if the peak time is >20 min or the Ct value is >38, the sample to be tested is negative for Marek's disease virus.

9. The method for detecting Marek's disease virus for non-disease diagnostic purposes according to claim 8, characterized in that, The reaction system for the MIRA amplification reaction consists of the following components: MIRA amplification reaction powder, buffer, magnesium acetate, forward primer, reverse primer, DNA template, and ddH2O, in a mass-to-volume ratio of 15 mg: 29.4 μL: 2.5 μL: 2 μL: 2 μL: 5 μL: 9.1 μL. The concentrations of both the forward and reverse primers are 5-20 μmol / L.

10. The method for detecting Marek's disease virus for non-disease diagnostic purposes according to claim 8, characterized in that, The reaction system for the CRISPR / Cas12a reaction consists of LbCas12a, crRNA, 10×CasSmart Buffer, fluorescent probe, amplification template, and ddH2O in a volume ratio of 2 μL:0.5 μL:5 μL:0.5 μL:1 μL:41 μL. The concentration of LbCas12a is 0.05-0.2 μmol / L; The concentration of the crRNA was 0.5-2 ng / μL; The concentration of the fluorescent probe is 0.5-2 μmol / L; The reaction program for the CRISPR / Cas12a reaction is: 42℃ for 60 s; 42℃ for 20 s, for 60 cycles.

Images