Application of GRB2 gene expression inhibitor in preparation of preparation for enhancing tumor cell drug sensitivity

Abstract

The invention discloses a novel application of a GRB2 gene, namely a preparation for enhancing tumor cell drug sensitivity is screened in order to inhibit the expression of the GRB2 gene. According to the application disclosed by the invention, the expression of the GRB2 gene in tumor cells is inhibited by virtue of an RNA interference technology, so that the phosphorylation level of key protein in a PI3K / Akt / mTOR signal channel can be remarkably reduced, the IC50 value of the tumor cells to chemotherapeutic drugs is reduced, and the apoptosis rate of the tumor cells is increased. Meanwhile, the relevance between GRB2 regulation and a PI3K / Akt signal channel is verified, when an Akt activator SC79 is used for reversing the inhibition effect of the signal channel, the drug sensitization effect mediated by GRB2 regulation is blocked, and it is proved that GRB2 affects the molecular mechanism of tumor cell drug sensitivity by regulating the PI3K / Akt / mTOR channel. The invention provides a new solution thought for the tumor chemotherapy drug resistance problem, and has important clinical transformation value.

Description

Technical Field

[0001] This invention belongs to the field of tumor chemotherapy resistance reversal and biomedical technology, specifically involving a method that enhances the drug sensitivity of tumor cells by inhibiting GRB2 gene expression, targeting the GRB2 protein. Background Technology

[0002] Bladder cancer is a common malignant tumor of the urinary system. Chemotherapy is the main treatment for advanced or metastatic bladder cancer, with cisplatin (CDDP) and gemcitabine (GEM) being first-line chemotherapy drugs. However, tumor cell resistance to chemotherapy drugs is the core problem leading to chemotherapy failure and poor patient prognosis. Some bladder cancer patients gradually develop cisplatin resistance after cisplatin treatment, and gemcitabine also faces limitations due to insufficient tumor cell sensitivity, severely restricting treatment efficacy.

[0003] The PI3K / Akt / mTOR signaling pathway is a key intracellular signaling pathway involved in regulating cell proliferation, survival, apoptosis, and metabolism. Its abnormal activation is closely related to tumorigenesis and chemotherapy resistance. Studies have shown that overactivation of this pathway can reduce the sensitivity of tumor cells to chemotherapy drugs through mechanisms such as promoting cell survival and inhibiting apoptosis. Therefore, targeting and regulating this pathway has become an important research direction for reversing chemotherapy resistance in tumors.

[0004] GRB2 (growth factor receptor-binding protein 2) is an important signaling linker protein that can participate in the regulation of multiple signaling pathways, including the PI3K / Akt / mTOR pathway, by binding to various receptor tyrosine kinases and downstream signaling molecules. Currently, the role and mechanism of GRB2 in tumor chemotherapy resistance are not fully understood. Whether regulating GRB2 gene expression can improve the sensitivity of tumor cells to chemotherapeutic drugs is a key issue that urgently needs to be explored in this field. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies in which tumor cells are resistant to or have insufficient sensitivity to chemotherapy drugs such as cisplatin and gemcitabine, this invention provides a new use for the GRB2 gene, namely, to screen for agents that enhance the drug sensitivity of tumor cells by inhibiting the expression of the GRB2 gene.

[0006] The sequence number of the GRB2 gene in NCBI is NM_002086.5.

[0007] The drug sensitivity enhancement agent of this invention is a GRB2 gene expression inhibitor, which enhances the sensitivity of tumor cells to chemotherapeutic drugs by inhibiting the expression of the GRB2 gene.

[0008] The tumor cells include bladder cancer cells, such as T24 cells and cisplatin-resistant T24CDDP cells.

[0009] The GRB2 gene expression inhibitor is an interfering RNA (siRNA) or shRNA, and the interfering RNA sequence is as follows: GRB2-siRNA1-F: 5'- CCATCGCCAAATATGACTT -3'; GRB2-siRNA1-R: 5'-AAGTCATATTTGGCGATGG-3'; GRB2-siRNA2-F: 5'- CCCAAGAACTACATAGAAA -3'; GRB2-siRNA2-R: 5'-TTTCTAGTAGTTCTTGGG -3'; GRB2-siRNA3-F: 5'-CCAGAAACCAGCAGATATT-3'; GRB2-siRNA2-R: 5'- AATATCTGCTGGTTTCTGG -3'; The shRNA sequence is as follows: h-GRB2-sh1:ACCGGTTCCCAAGAACTACATAGAAACTCGAGTTTCTATGTAGTTCTTGGGAATTTTTTGAATTC; h-GRB2-sh2:ACCGGCTCCAGAAACCAGCAGATATTCTCGAGAATATCTGCTGGTTTCTGGAGTTTTTTGAATTC.

[0010] The GRB2 gene expression inhibitor of this invention can reduce the IC50 of gemcitabine in bladder cancer cells. 50 The reduction significantly increased the sensitivity of cisplatin-resistant cells to cisplatin.

[0011] Compared with the prior art, the present invention has the following advantages: To address the shortcomings of existing gemcitabine chemotherapy resistance, which is difficult to reverse effectively, and the poor specificity and significant toxic side effects of existing resistance reversal drugs, the core objective of this invention is to provide a method for restoring tumor cell sensitivity to gemcitabine by precisely targeting the GRB2 protein and blocking its mediated survival-promoting signaling pathway. This invention also provides the application of this method in the preparation of anti-tumor drugs to improve the clinical efficacy of gemcitabine. Furthermore, the GRB2 gene expression inhibitor of this invention can significantly enhance the sensitivity of cisplatin-resistant T24CDDP cells to cisplatin. Attached Figure Description

[0012] Figure 1The results show the effects of GRB2 gene knockdown on GRB2 gene expression and protein expression in the PI3K / Akt / mTOR pathway in T24CDDP cells. The top figure is a Western blot map, and the bottom figure is a statistical graph of expression levels. Figure 2 The results of flow cytometry analysis show the effect of GRB2 gene knockdown on the proliferation of T24CDDP cells. The left figure shows the flow cytometry results, and the right figure shows the statistical graph. Figure 3 The results show the effects of shRNA on the size and weight of T24CDDP xenografts. The left figure is a schematic diagram of tumor size, the middle figure is the statistical results of tumor volume, and the right figure is the statistical results of tumor weight. Figure 4 These are the results of H&E staining of mouse tumor tissue; Figure 5 Gemcitabine (GEM) has an IC50 value against bladder cancer cell line T24 and drug-resistant cell line T24CDDP. 50 Test results; Figure 6 The results were obtained by flow cytometry detection of apoptosis induced in T24CDDP cells by gemcitabine combined with GRB2 siRNA. Figure 7 A statistical graph for detecting apoptosis in T24CDDP cells induced by gemcitabine combined with GRB2 siRNA using flow cytometry; Figure 8 The results of Western blot analysis of the effect of gemcitabine combined with GRB2 siRNA on protein expression in bladder cancer cells are shown. The top image is a WB plot, and the bottom image is a statistical plot. Figure 9 The effect of cisplatin-resistant T24CDDP cells transfected with GRB2 siRNA on gemcitabine IC50 50 The impact of the results. Detailed Implementation

[0013] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments, but these embodiments should not be used to interpret the limitation of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available. After reading this description, any equivalent modifications, alterations, and modifications made by those skilled in the art are within the scope defined by the claims of the present invention.

[0014] Reagents: RPMI 1640 medium (Gibco, USA), fetal bovine serum (Guangzhou Saiku Biotechnology Co., Ltd.), trypsin (Gibco, USA), Opti-MEM medium (Gibco, USA), SC79 (MCE, Shanghai, China), Lipofectamine 2000 (Invitrogen, USA), h-GRB2 siRNA nucleic acid (Guangzhou Jidan Biotechnology Co., Ltd.).

[0015] Cell line: T24 bladder cancer cells, purchased from Guangzhou Saiku Biotechnology Co., Ltd.

[0016] Example 1: Knocking down the GRB2 gene to inhibit the activity of the PI3K / Akt / mTOR pathway 1. Preparation of cisplatin (CDDP) resistant strain of human bladder cancer cell line T24 Human bladder cancer T24 cells were seeded into T25 culture flasks containing high-glucose DMEM medium with 10% fetal bovine serum and cultured in a cell culture incubator at 37°C and 5% CO2. Cisplatin-resistant cells were induced by gradually increasing the drug dose. An initial CDDP concentration of 0.5 μM / L was used, and cells were cultured until they could grow stably and were passaged three times. The CDDP concentration was then gradually increased until the cells could grow stably in a culture medium with a CDDP concentration of 10 μM / L and were successfully passaged 20 times. This resulted in a cisplatin-resistant human bladder cancer cell model, named cisplatin-resistant human bladder cancer cells (T24CDDP cells).

[0017] 2. Seed T24CDDP cells in logarithmic growth phase evenly into 6-well plates and incubate at 37°C and 5% CO2 for 24 hours. After complete cell adhesion, transfect the cells. Prepare the siRNA-Lipid complex: Tube A: 125µL Opti-MEM + 5µL Lipofectamine 2000 (mix gently and incubate at room temperature for 5 min); Tube B: 125µL Opti-MEM + 50nM siRNA (final concentration, e.g., 5µL of 10µM siRNA). Mix tubes A and B (total volume 250µL), mix gently, incubate at room temperature for 15-20 min, and then add 750µL of [unclear - possibly a specific compound or solution]. Gently mix with Opti-MEM; remove the old cell culture medium, add the siRNA-Lipid complex dropwise to the wells, gently shake to mix, replace with complete culture medium after 6 hours, continue culturing for 36 hours, then extract total cell protein for Western blotting to detect knockdown efficiency and levels of GRB2, p-PI3K, p-Akt, p-mTOR, and p-GSK3. βProtein expression levels were measured, with siRNA-seq1 having a sense strand of 5'-CCATCGCCAAATATGACTT-3' and an antisense strand of 5'-AAGTCATATTTGGCGATGG-3', siRNA-seq2 having a sense strand of 5'-CCCAAGAACTACATAGAAA-3' and an antisense strand of 5'-TTTCTATGTAGTTCTTGGG-3', and siRNA-seq3 having a sense strand of 5'-CCAGAAACCAGCAGATATT-3' and an antisense strand of 5'-AATATCTGCTGGTTTCTGG-3'. A control group (without siRNA) was also included. Western blot results are shown below. Figure 1 As shown in the figure, compared with the control group, the expression levels of GRB2 gene were significantly decreased in T24CDDP cells transfected with GRB2 siRNA, as were the expression levels of p-Akt, p-PI3K, p-mTOR, and p-GSK3. β The phosphorylation level was significantly downregulated, confirming that knocking down GRB2 can effectively inhibit the activity of the PI3K / Akt / mTOR pathway.

[0018] Example 2: Apoptosis Analysis T24CDDP cells in logarithmic growth phase were evenly seeded into 6-well plates and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After complete cell adhesion, the cells were treated with GRB2 siRNA-seq 1, GRB2 siRNA-seq 2, and GRB2 siRNA-seq 3 for 24 hours, respectively. Then, the cells were gently digested with 0.25% trypsin (without EDTA) to avoid over-digestion and false positives. Serum-containing medium was added to neutralize the trypsin, and the cells were centrifuged at 1000 rpm for 5 minutes. The cells were washed twice with PBS, resuspended in PBS, and 100 μL of cell suspension (approximately 1 × 10⁻⁶ cells) was collected. 5 Add cells to a flow cytometry tube, add 5 μL Annexin V-FITC, mix gently, incubate at room temperature in the dark for 15 min, add 5 μL PI (final concentration 1-2 μg / mL), incubate in the dark for 5 min, immediately add 400 μL Binding Buffer, avoid prolonged storage (test within 1 hour), and set up a blank control group without siRNA. Flow cytometry results are shown in Figure 2 As can be seen from the figure, transfection of GRB2siRNA into T24CDDP cells can inhibit the proliferation of bladder cancer cells and induce apoptosis.

[0019] Example 3: Evaluation of in vivo antitumor effect on T24CDDP xenografts 1. Experiments on the effect of drugs on mouse body weight and inhibition of tumor size. Male BALB / c nu / nu mice (13-17g, 4-5 weeks old) were purchased from the Animal Research and Resource Center of Yunnan University (Kunming, Yunnan).

[0020] Mice were raised at 25°C under a 12 / 12-hour light-dark cycle and acclimatized to a standard rodent diet for one week. They were then randomly divided into two groups: a blank control group and a GRB2 shRNA group. T24CDDP cells were resuspended in PBS containing 50% Corning matrix gel (Corning, New York, USA) and then subcutaneously injected into the right inguinal region of each mouse (3 × 10⁻⁶ cells). 6 Cells / item). The long axis (L; mm) and short axis (W; mm) of the xenograft tumor were measured periodically and calculated using the formula (V = 0.5 × L × W). 2 Calculate tumor volume (V; mm) 3 When the transplanted tumor reaches a volume of 50-100 mm 3 Mice were treated with intraperitoneal injection of a drug-loaded PBS solution containing 50% Corning Glycol, a blank control (once every 2 days), and GRB2shRNA (10 mg / mouse once every 2 days). On day 14, the mice were weighed. The mice were then euthanized (under carbon dioxide anesthesia), dissected, and the tumors were removed, their volume measured, and weighed. The shRNA sequence is as follows: h-GRB2-sh1:ACCGGTTCCCAAGAACTACATAGAAACTCGAGTTTCTATGTAGTTCTTGGGAATTTTTTGAATTC; h-GRB2-sh2:ACCGGCTCCAGAAACCAGCAGATATTCTCGAGAATATCTGCTGGTTTCTGGAGTTTTTTGAATTC.

[0021] See results Figure 3 As can be seen from the figure, in the T24CDDP xenograft model, GRB2 shRNA treatment showed a significant tumor growth inhibition effect, with a significant reduction in tumor volume and weight.

[0022] 2. H&E staining experiment on mouse tumor tissue Samples were fixed with 4% paraformaldehyde for 24 hours at 4°C, then dehydrated for 1 hour each with 70%, 80%, 90%, 95%, and 100% ethanol. Xylene clearing was performed twice, 30 minutes each time. Finally, the samples were embedded in paraffin at 60°C. After embedding, 4 μm thick sections were cut and baked at 60°C for 2 hours. Before staining, dewaxing was performed with xylene and ethanol (100%, 95%, and 80% concentrations), followed by staining with hematoxylin and eosin, and then dehydration and mounting.

[0023] The results are shown in Figure 4. Compared with the blank control group, the GRB2 shRNA group showed vacuolization and nuclear condensation damage in some cells, and lesions appeared in about 30% of the area.

[0024] Example 4: IC50 of gemcitabine (GEM) against bladder cancer cell line T24 and drug-resistant cell line T24CDDP 50 Detection Bladder cancer cell lines T24 and T24CDDP were evenly seeded into 96-well plates (4000 cells / well, 100 μL per well) and placed in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After the cells were fully adhered, they were treated with gemcitabine (GEM) at different concentrations (0.625 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, 20 μM) for 48 hours. Then, 30 μL of MTT solution (5 mg / mL) was added to the 96-well plates, and the plates were incubated at 37°C and 5% CO2 for 5 hours. The liquid in the plates was then discarded, and 100 μL of DMSO solution (99.99% purity) was added. The plates were shaken for 10 minutes (20 rpm), and the absorbance was measured at 570 nm. Cell viability was calculated, dose-response curves were plotted, and IC50 values ​​were calculated. See results Figure 5 As can be seen from the figure, compared with T24 cells, the IC50 value of cisplatin-resistant T24CDDP cells is 2.642 μM, indicating that they are resistant to GEM.

[0025] Example 5: Gemcitabine (GEM) combined with GRB2 siRNA treatment induces apoptosis in T24CDDP cells. 1. T24CDDP cells in logarithmic growth phase were evenly seeded into 6-well plates and placed in a cell culture incubator. The cells were cultured at 37°C and 5% CO2 for 24 hours. After complete cell adhesion, the cells were treated with GEM (10 μM), Akt activator SC79 (20 μM), GRB2-siRNA2 (sense strand 5'-CCCAAGAACTACATAGAAA-3', antisense strand 5'-TTTCTATGTAGTTCTTGGG-3'), GEM + GRB2 siRNA2, and GEM + GRB2 siRNA2 + SC79 for 24 hours. The cells were then gently digested with 0.25% trypsin (without EDTA) to avoid over-digestion leading to false positives. Serum-containing medium was added to neutralize the trypsin. The cells were centrifuged at 1000 rpm for 5 minutes, washed twice with PBS, and resuspended in PBS. 100 μL of the cell suspension (approximately 1 × 10⁻⁶ cells) was collected. 5 Add cells to a flow cytometry tube, add 5 μL Annexin V-FITC, mix gently, incubate at room temperature in the dark for 15 min, add 5 μL PI (final concentration 1-2 μg / mL), incubate in the dark for 5 min, immediately add 400 μL Binding Buffer, avoid prolonged storage (test within 1 hour), and set up a blank control group without adding drugs. Flow cytometry results are shown in Figure 6 , 7 As can be seen from the figure, the apoptosis rate of T24CDDP cells was low when 10 μM gemcitabine was used alone, but the apoptosis rate increased after combining it with GRB2 siRNA2. When SC79 was added to T24CDDP cells treated with GRB2 siRNA2 and gemcitabine, the sensitivity of the cells to gemcitabine decreased significantly, and the apoptosis rate dropped from 94.08% to 4.83% (close to the control group level).

[0026] 2. T24 and UM-UC-3 bladder cancer cells in logarithmic growth phase were evenly seeded into 6-well plates and placed in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After complete cell adhesion, the cells were treated with 10 μM GEM, GRB2 siRNA2, and GEM + GRB2 siRNA2 for 24 hours. Total protein was then extracted from the cells for Western blotting experiments to detect the expression levels of C-PARP, C-cas-7, and GAPDH proteins. A blank control (without added drugs) was also included. The results of the Western blot analysis are shown below. Figure 8 As can be seen from the figure, the expression of C-PARP and c-cas-7 in the GEM+ GRB2 siRNA2 treatment group was significantly higher than that in the drug-only group.

[0027] Example 6: Cell death induced by transfection of GRB2 siRNA combined with GEM Bladder cancer cell line T24CDDP cells were evenly seeded into 96-well plates (4000 cells / well, 100 μL per well) and incubated in a cell culture incubator at 37°C and 5% CO2 for 24 hours. After complete cell adhesion, the cells were treated with different concentrations (0.3125 μM, 0.625 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM) of gemcitabine (GEM) and GEM (0.3125 μM, 0.625 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM) + GRB2 siRNA2 (50 pmol / mL) for 48 hours. Then, 30 μL of MTT solution (5 mg / mL) was added to the 96-well plates, and the plates were incubated at 37°C and 5% CO2 for 5 hours. The liquid in the plates was then discarded, and 100 μL of [the solution] was added to the plates. DMSO solution (purity 99.99%) was shaken on a shaker for 10 min (20 rpm), and the absorbance was measured at 570 nm. Cell viability was calculated, a dose-response curve was plotted, and the IC50 value was calculated. See results Figure 9 The figure shows that in cisplatin-resistant T24CDDP cells, the IC50 value of gemcitabine alone was significantly lower. 50 The value was 2.530 μM. After transfection with GRB2 siRNA2, the IC50 value was 2.530 μM. 50 The value dropped to 0.8039 μM, indicating that the GRB2 gene expression inhibitor can increase the sensitivity of bladder cancer cells to gemcitabine.

Claims

1. Application of screening agents that enhance the drug sensitivity of tumor cells with the aim of inhibiting GRB2 gene expression.

2. The application according to claim 1, characterized in that: The drug sensitivity enhancer for tumor cells is a GRB2 gene expression inhibitor. By inhibiting the expression of the GRB2 gene, it enhances the sensitivity of tumor cells to chemotherapy drugs.

3. The application according to claim 2, characterized in that: Tumor cells include bladder cancer cells.

4. The application according to claim 3, characterized in that: GRB2 gene expression inhibitors are interfering RNA or shRNA. Interfering RNAs are as follows: GRB2-siRNA1-F: 5'-CCATCGCCAAATATGACTT-3'; GRB2-siRNA1-R: 5'-AAGTCATATTTGGCGATGG-3'; GRB2-siRNA2-F: 5'-CCCAAGAACTACATAGAAA-3'; GRB2-siRNA2-R: 5'-TTTCTATGTAGTCTTGGG-3'; GRB2-siRNA3-F: 5'-CCAGAAACCAGCAGATATT-3'; GRB2-siRNA3-R: 5'-AATATCTGCTGGTTTCTGG-3'; The shRNA is as follows: h-GRB2-sh1:ACCGGTTCCCAAGAACTACATAGAAACTCGAGTTTCTATGTAGTTCTTGGGAATTTTTTGAATTC; h-GRB2-sh2:ACCGGCTCCAGAAACCAGCAGATATTCTCGAGAATATCTGCTGGTTTCTGGAGTTTTTTGAATTC.

5. The method according to claim 3, characterized in that: GRB2 gene expression inhibitors can reduce the IC50 response of gemcitabine to bladder cancer cells. 50 The reduction significantly increased the sensitivity of cisplatin-resistant cells to cisplatin.

Images