Compositions and methods for inhibiting complement component 3 (C3) expression

Abstract

The present invention provides compositions and methods useful for reducing C3 gene expression and treating C3 related diseases and disorders. The present invention provides C3dsRNA agents, C3 antisense polynucleotide agents, compositions comprising C3dsRNA agents, and compositions comprising C3 antisense polynucleotide agents useful for reducing C3 expression in cells and subjects.

Description

TECHNICAL FIELD

[0001] The present invention relates, in part, to compositions and methods useful for inhibiting complement component 3 (C3) gene expression. BACKGROUND

[0002] The complement system, or complement pathway, was first discovered in the 1890s when it was found to help, or “complement,” heat-labile antibodies present in normal serum to kill bacteria. The complement system, or complement pathway, is part of the innate immune system that defends the host against invading pathogens. It is composed of more than 30 proteins that circulate in the blood in their precursor forms and plays an important role in both innate and adaptive immunity. Most of the proteins that make up the complement system, including complement component protein C3 (also referred to herein simply as C3), are synthesized by hepatocytes in the liver and secreted into the blood.

[0003] The proteins of the complement system act in a series of enzymatic cascades through various protein interactions and cleavage events. Three main pathways of complement activation have been identified, referred to as the classical, alternative, and lectin pathways. From a functional perspective, complement activation itself occurs at a low level (C3 is autocleaved to produce C3a and C3b), and is amplified by an enzymatic cascade that converts inactive forms of enzymes (zymogens) to active forms in the presence of a microbe. One type of C3 convertase is a complex of C3b and complement factor B (CFB, factor B). Once formed, C3 convertases can convert large amounts of C3 to its cleavage products C3a and C3b in a short time. The specific C3 convertase is a complex of C3b and factor B, which was originally described in the context of the alternative pathway, but can also form in the context of the other two pathways. Inappropriate or excessive complement activation is a potential cause or contributor to many serious diseases and conditions, and much effort has been invested over the past several decades to explore various complement inhibitors as therapeutic agents.

[0004] A variety of diseases are associated with aberrant acquired or genetic activation of the complement pathway and aberrant or excessive expression of C3. These are, for example, C3 glomerulopathy (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgA N;), age-related macular degeneration (AMD), rheumatoid arthritis (RA), anti-neutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease by dysbiosis, malaria anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative diseases.

[0005] Accordingly, the C3 RNAi agents disclosed herein are useful for treating diseases, disorders, and conditions associated with subjects having a disease associated with complement component C3. SUMMARY

[0006] In general, the present summary discloses novel complement component 3 (C3) gene-specific RNAi agents, compositions comprising C3 RNAi agents, and methods of using the C3 RNAi agents and compositions comprising C3 RNAi agents described herein to inhibit C3 gene expression in vitro and / or in vivo. The C3 RNAi agents described herein can selectively and effectively reduce, inhibit, or silence expression of a C3 gene in a subject, such as a human or animal subject.

[0007] According to one aspect of the present application, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to a C3 RNA transcript comprising at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1-3, and optionally comprising a targeting ligand, wherein the sense strand and the antisense strand can be partially, substantially, or completely complementary to each other.

[0008] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the nucleotides at positions 2 to 18 in the antisense strand comprising a region of complementarity to a C3 RNA transcript, wherein the region of complementarity comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1-3, and optionally comprising a targeting ligand.

[0009] In some embodiments, the C3 RNA transcript is SEQ ID NO: 1.

[0010] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence listed in any one of Tables 1-3.

[0011] In certain embodiments, the dsRNA agent comprises a sense strand sequence listed in any of Tables 1-3, wherein the sense strand sequence is fully complementary to an antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence listed in any of Tables 1-3. In some embodiments, the dsRNA agent comprises a duplex sequence listed in any of Tables 1-3.

[0012] In certain embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity to a C3 RNA transcript comprising at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from an antisense sequence of any one of SEQ ID NOs: 25-28, 31-35, 39-41, 45-47, and optionally comprises a targeting ligand.

[0013] In certain embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence selected from the group consisting of the following sequences: SEQ ID NOs: 2-5, 8-12, 16-18, 22-24; and optionally comprises a targeting ligand.

[0014] In certain embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from the group consisting of:

[0015] (a) SEQ ID NOs: 2 and 25, respectively;

[0016] (b) SEQ ID NOs: 3 and 26, respectively;

[0017] (c) SEQ ID NOs: 4 and 27, respectively;

[0018] (d) SEQ ID NOs: 8 and 31, respectively;

[0019] (e) SEQ ID NOs: 9 and 32, respectively;

[0020] (f) SEQ ID NOs: 10 and 33, respectively;

[0021] (g) SEQ ID NOs: 11 and 34, respectively;

[0022] (h) SEQ ID NOs: 12 and 35, respectively;

[0023] (i) SEQ ID NOs: 16 and 39, respectively;

[0024] (j) SEQ ID NOs: 17 and 40, respectively;

[0025] (k) SEQ ID NOs: 18 and 41, respectively;

[0026] (l) SEQ ID NOs: 22 and 45, respectively;

[0027] (m) SEQ ID NOs: 23 and 46, respectively; and

[0028] (n) SEQ ID NOs: 24 and 47, respectively.

[0029] In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 2, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 25. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 3, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 26. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 4, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 27. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 8, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 31. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 9, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 32. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 10, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 33. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 11, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 34. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 12, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 35. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 16, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 39. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 17, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 40. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 18, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 41. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 22, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 45. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 23, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 46. In some embodiments, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 24, wherein the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 47.

[0030] In some embodiments, the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence of Formula (I): 5'-Z1UAUUCAUGAGCUUCGUAGZ2-3' (I), wherein Z1 is selected from one of C, G, A, U or is absent, and Z2 is a nucleotide sequence of length 0-15 nucleotides. In certain embodiments, Z1 is U. In certain embodiments, Z2 is selected from A, AC, AU, AA, AG, or is absent. In some embodiments, the sense strand of the dsRNA comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of Formula (II): 5'-Z3CUACGAAGCUCAUGAAUAZ4-3' (II), wherein Z3 is a nucleotide sequence of length 0-15 nucleotides, and Z4 is selected from one of C, G, A, U or is absent. In certain embodiments, Z4 is A. In certain embodiments, Z3 is selected from U, GU, CU, UU, AU, or is absent. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of Formula (I), and the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of Formula (II), wherein the nucleotide sequences of Formula (I) and (II) are as described above. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In certain embodiments, the sense strand is complementary or substantially complementary to the antisense strand, the length of the region of complementarity being between 16 and 23 nucleotides. In some embodiments, the length of the region of complementarity is 19-21 nucleotides. In some embodiments, Z1 is a nucleotide complementary to Z4. In some embodiments, Z2 is a nucleotide sequence complementary to Z3.

[0031] In certain embodiments, the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from formula (III), the nucleotide sequence of formula (III) being: 5'-Z5UGUUCAUUCUGAUUCCUUZ6-3' (III), wherein Z5 is selected from one of C, G, A, U or is absent, and Z6 is a nucleotide sequence of 0-15 nucleotides in length. In certain embodiments, Z5 is U. In certain embodiments, Z6 is selected from C, CG, CC, CU, CA, or is absent. In some embodiments, the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from formula (IV), the nucleotide sequence of formula (IV) being: 5'-Z7AAGGAAUCAGAAUGAACAZ8-3' (IV), wherein Z7 is a nucleotide sequence of 0-15 nucleotides in length, and Z8 is selected from one of C, G, A, U or is absent. In certain embodiments, Z8 is A. In certain embodiments, Z7 is selected from G, CG, AG, GG, UG, or is absent. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from formula (III), and the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from formula (IV), wherein the nucleotide sequences of formula (III) and (IV) are as described above. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In certain embodiments, the sense strand is complementary or substantially complementary to the antisense strand, the length of the region of complementarity being between 16 and 23 nucleotides. In some embodiments, the length of the region of complementarity is 19-21 nucleotides. In some embodiments, Z5 is a nucleotide that is complementary to Z8. In some embodiments, Z6 is a nucleotide sequence that is complementary to Z7.

[0032] In certain embodiments, the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from formula (V), the nucleotide sequence of formula (V) being represented as: 5'-Z9GUAGUAGAAUUUCUCUGUZ 10 -3' (V), wherein Z9 is selected from one of C, G, A, U or is absent, and Z 10is a nucleotide sequence of 0-15 nucleotides in length. In certain embodiments, Z9is U. In certain embodiments, Z2is selected from A, AC, AU, AG, AA, or is absent. In some embodiments, the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of Formula (VI): 5'-Z 11 ACAGAGAAAUUCUACUACZ 12 -3'(VI), wherein Z 11 is a nucleotide sequence of 0-15 nucleotides in length, Z 12 is selected from one of C, G, A, U, or is absent. In certain embodiments, Z 12 is A. In certain embodiments, Z 11 is selected from U, GU, AU, CU, UU, or is absent. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from Formula (V), and the sense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differs by 0, 1, 2, or 3 nucleotides from Formula (VI), wherein the nucleotide sequences of Formula (V) and (VI) are as described above. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In certain embodiments, the sense strand is complementary or substantially complementary to the antisense strand, the length of the region of complementarity being between 16 and 23 nucleotides. In some embodiments, the length of the region of complementarity is 19-21 nucleotides. In some embodiments, Z9is a nucleotide that is complementary to Z 12 . In some embodiments, Z 10 is a nucleotide sequence that is complementary to Z 11 .

[0033] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, the at least one modified nucleotide includes: a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2'3'-seco nucleotide mimic, a locked nucleotide, an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribothymidine, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-Ome nucleotide, an inverted 2'-deoxy nucleotide, an isomannide nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, and a 3'-OMe nucleotide, a nucleotide including a 5'-phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidite, or a nucleotide including a non-natural base.

[0034] In some embodiments, the dsRNA agent includes a E-vinyl phosphonate nucleotide at the 5' end of the guide strand.

[0035] In some embodiments, the dsRNA agent includes a phos-15 nucleoside at the 5' end of the guide strand.

[0036] In certain embodiments, the dsRNA agent includes at least one phosphorothioate internucleoside linkage. In certain embodiments, the sense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.

[0037] In some embodiments, all or substantially all of the nucleotides of the sense and antisense strands are modified nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-0-methyl nucleotides, 2'-fluoro nucleotides, and UNA modified nucleotides, wherein fewer than 6 of the modified nucleotides are 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoro nucleotides, preferably the antisense strand comprises 5 2'-fluoro nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-0-methyl nucleotides and 2'-fluoro nucleotides, wherein fewer than 4 of the modified nucleotides are 2'-fluoro nucleotides. In certain embodiments, the sense strand comprises 3 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-0-methyl nucleotides and 2'-fluoro nucleotides, wherein at least 14 of the modified nucleotides are 2'-0-methyl nucleotides, and the nucleotides at positions 2, 5, 7, 11, 12, 14, 16, and / or 18 from the first matching position at the 5' end of the antisense strand are independently 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises at least one UNA modified nucleotide and 5 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2'-fluoro nucleotides at positions 2, 5, 12, 14, and 16 from the first matching position at the 5' end, with the remainder being 2'-0-methyl nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2'-fluoro nucleotides at positions 2, 5, 12, 14, and 18 from the first matching position at the 5' end, with the remainder being 2'-0-methyl nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2'-fluoro nucleotides at positions 2, 5, 11, 14, and 16 from the first matching position at the 5' end, with the remainder being 2'-0-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2'-fluoro nucleotides at positions 2, 7, 12, 14, and 16 from the first matching position at the 5' end, with the remainder being 2'-0-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2'-fluoro nucleotides at positions 2, 7, 11, 14, and 16 from the first matching position at the 5' end, with the remainder being 2'-0-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2'-fluoro nucleotides at positions 2, 5, 12, 14, and 16 from the first matching position at the 5' end, with the remainder being 2'-0-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2'-fluoro nucleotides at positions 2, 5, 12, 14, and 18 from the first matching position at the 5' end, with the remainder being 2'-0-methyl nucleotides.In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-0-methyl nucleotides and 2'-fluoro nucleotides, preferably wherein at least 18 of the modified nucleotides are 2'-0-methyl nucleotides, and the nucleotides at positions 9, 11, and / or 13, counting from the first matching position at the 3' end of the sense strand, are 2'-fluoro nucleotides. In some embodiments, the sense strand comprises at least 18 modified nucleotides that are 2'-0-methyl nucleotides, and the nucleotides at positions 8, 11, and / or 13, counting from the first matching position at the 3' end of the sense strand, are 2'-fluoro nucleotides. In some embodiments, the modified sense strand sequence is a modified sense strand sequence set forth in one of Tables 2-3. In some embodiments, the modified antisense strand sequence is a modified antisense strand sequence set forth in one of Tables 2-3.

[0038] In some embodiments, the dsRNA agent includes at least one modified nucleotide, and further includes one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetylgalactosamine (GalNAc).

[0039] In some embodiments, the targeting group includes the following structure:

[0040]

[0041] Each n" is independently selected from 1 or 2.

[0042] In some embodiments, the targeting group has the following structure:

[0043]

[0044]

[0045]

[0046]

[0047] In certain embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group conjugated to the 3' end of the sense strand.

[0048] In some embodiments, the antisense strand includes one inverted abasic residue at the 3' end.

[0049]

[001] In certain embodiments, the sense strand comprises one or two inverted deoxyabasic residues and / or one or two imann residues at the 3' or / and 5' end. In certain embodiments, each end of the sense strand comprises one inverted deoxyabasic residue. In certain embodiments, each end of the sense strand comprises one imann residue. In some embodiments, the one or more inverted deoxyabasic residues or one or more imann residues are bound to either or both ends of the sense strand via a phosphorothioate linkage. In some embodiments, the targeting group is further bound to either end of the sense strand via a phosphorothioate linkage. In some embodiments, the targeting group is further bound to the 5' end of the sense strand via a phosphorothioate linkage. In certain embodiments, the 5' end of the sense strand includes one inverted deoxyabasic residue or imann residue, wherein the inverted deoxyabasic residue or imann residue is linked to the adjacent nucleotide at the 5' end of the sense strand nucleotide sequence via a phosphorothioate linkage. In certain embodiments, the sense strand further includes a targeting group linked to the inverted deoxyabasic residue or imann residue at the 5' end of the sense strand, wherein the targeting group is linked to the adjacent inverted deoxyabasic residue or imann residue via a phosphorothioate linkage, and optionally the targeting group is N-acetylgalactosamine (GalNAc).

[0050] In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide. In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0051] In certain embodiments, the dsRNA comprises a duplex selected from the group consisting of AV04969, AV04970, AV04971, AV04972, AV04973, AV04974, AV04975, AV04976, AV04977, AV04978, AV04979, AV04980, wherein the duplex optionally includes a targeting ligand. In certain embodiments, the dsRNA comprises a duplex selected from the group consisting of AD01444, AD01444-1, AD01444-2, AD01444-3, AD00193, AD00193-1, AD00193-2, AD00193-4, AD01424, AD01428, AD01447, AD01447-1, AD01447-2, AD01447-3, AD01447-4.

[0052] According to another aspect of the present application, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region that is complementary to a portion of a C3 RNA transcript, wherein each strand is between about 15 and about 30 nucleotides in length, wherein the sense strand comprises a sequence that can be represented by formula (A):

[0053] 5'-(N' L ) n′ N' L N' L N' L N' L N' F N' L N' F N' L N' N1 N' N2 N' L N' L N' L N' L N' L (N' L ) m′ -3' (A)

[0054] wherein: each N' F represents a 2'-fluoro modified nucleotide; each N' N1 and N' N2 independently represents a modified or unmodified nucleotide; each N' L independently represents a modified or unmodified nucleotide but does not represent a 2'-fluoro modified nucleotide, and m' and n' are each independently an integer from 0 to 7.

[0055] In some embodiments, N' N1 and N' N2 comprise only one 2'-fluoro modified nucleotide.

[0056] In some embodiments, N' N1 independently represents a 2'-fluoro modified nucleotide.

[0057] In some embodiments, N' N2 independently represents a 2'-fluoro modified nucleotide.

[0058] In some embodiments, m' is 2 and n' is 4, or m' is 2 and n' is 2. In some embodiments, m' is 1 and n' is 4, or m' is 1 and n' is 2. In some embodiments, m' is 0 and n' is 4, or m' is 0 and n' is 2.

[0059] In some embodiments, the dsRNA agent comprises a targeting group conjugated to the 5’ end of the sense strand, preferably the targeting group is any one selected from the preceding GLO-1 to GLO-16 and GLS-1* to GLS-16*, more preferably the targeting group is the preceding GLS-15*. In certain embodiments, the dsRNA agent comprises a targeting group conjugated to the 3’ end of the sense strand. In certain embodiments, the antisense strand comprises one inverted deoxyabasic residue at the 3’ end. In certain embodiments, the sense strand comprises one or two inverted deoxyabasic residues and / or one or two imann residues at the 3’ or / and 5’ end. In certain embodiments, the sense strand comprises one inverted deoxyabasic residue at each of the 3’ and 5’ ends independently. In certain embodiments, the sense strand comprises one imann residue at each of the 3’ and 5’ ends independently. In certain embodiments, the sense strand comprises two inverted deoxyabasic residues at the 3’ and 5’ ends, and the residue at the 3’ or 5’ end is further conjugated to a targeting group, which is preferably the preceding GLS-15*. In certain embodiments, the sense strand comprises two imann residues at the 3’ and 5’ ends, and the residue at the 3’ or 5’ end is further conjugated to a targeting group, which is preferably the preceding GLS-15*. In certain embodiments, the sense strand comprises two imann residues at the 3’ and 5’ ends, and the residue at the 3’ or 5’ end is further conjugated to a targeting group, which is preferably the preceding GLS-15*. In certain embodiments, the 5’ end of the sense strand comprises one inverted deoxyabasic residue or imann residue, wherein the inverted deoxyabasic residue or imann residue is linked to the adjacent nucleotide at the 5’ end of the sense strand nucleotide sequence by a phosphorothioate linkage. In certain embodiments, the sense strand further comprises a targeting group linked to the inverted deoxyabasic residue or imann residue at the 5’ end of the sense strand, wherein the targeting group is linked to the adjacent inverted deoxyabasic residue or imann residue by a phosphorothioate linkage, and optionally the targeting group is N-acetylgalactosamine (GalNAc).

[0060] According to another aspect of the present application, there is provided a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a C3 RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand comprises a sequence that can be represented by Formula (B):

[0061] 3’-(N L ) n N M1 N L N M2 N L N FN L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5'(B)

[0062] wherein: each N F represents a 2'-fluoro modified nucleotide; each N M1 , N M2 , N M3 , N M4 , N M5 , and N M6 independently represents a modified or unmodified nucleotide; each N L independently represents a modified or unmodified nucleotide but is not a 2'-fluoro modified nucleotide, and n is an integer from 0 to 7.

[0063] In some embodiments, N M1 , N M2 , N M3 , N M4 , N M5 , and N M6 have only three 2'-fluoro modified nucleotides.

[0064] In some embodiments, N M2 , N M3 , and N M5 each independently represents a 2'-fluoro modified nucleotide.

[0065] In some embodiments, N M2 , N M4 , and N M5 each independently represents a 2'-fluoro modified nucleotide.

[0066] In some embodiments, N M1 , N M3 , and N M6 each independently represents a 2'-fluoro modified nucleotide.

[0067] In some embodiments, N M2 , N M3 , and N M6 each independently represents a 2'-fluoro modified nucleotide.

[0068] In some embodiments, N M2 , NM4 and N M6 each independently represents a 2’-fluoro modified nucleotide.

[0069] In some embodiments, N M1 , N M3 and N M6 each independently represents a 2’-fluoro modified nucleotide, and N M5 represents a UNA modified nucleotide.

[0070] In some embodiments, N M2 , N M3 and N M6 each independently represents a 2’-fluoro modified nucleotide, and N M5 represents a UNA modified nucleotide.

[0071] In some embodiments, N M2 , N M4 and N M6 each independently represents a 2’-fluoro modified nucleotide, and N M5 represents a UNA modified nucleotide.

[0072] In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0073] According to another aspect of the present application, there is provided a double- stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region that is complementary to a C3 RNA transcript, wherein the complementary region comprises at least 15 contiguous nucleotides, wherein the dsRNA duplex comprises a sequence represented by Formula (C):

[0074] Sense strand: 5’-(N’ L ) n′ N’ L N’ L N’ L N’ L N’ F N’ L N’ F N’ L N’ N1 N’ N2 N’ L N’ L N’ L N’ L N’ L (N’ L ) m′ -3’

[0075] antisense strand: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5'

[0076] (C)

[0077] wherein: each strand is about 18 to about 30 nucleotides in length; each N F and N' F independently represents a 2'-fluoro modified nucleotide; N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N' N1 and N' N2 each independently represents a modified or unmodified nucleotide; each N L and N' L independently represents a modified or unmodified nucleotide but does not represent a 2'-fluoro modified nucleotide, and m', n' and n are each independently an integer from 0 to 7.

[0078] In some embodiments, N M1 , N M2 , N M3 , N M4 , N M5 and N M6 have only three 2'-fluoro modified nucleotides, N' N1 and N' N2 include only one 2'-fluoro modified nucleotide.

[0079] In some embodiments, m′ is 2 and n′ is 4, m′ is 2 and n′ is 6, or m′ is 2 and n′ is 2. In some embodiments, m′ is 1 and n′ is 4, or m′ is 1 and n′ is 2. In some embodiments, m′ is 0 and n′ is 4, or m′ is 0 and n′ is 2. In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0080] In some implementations, N′ N1 Independently represents nucleotides modified with 2'-fluorine.

[0081] In some implementation schemes, N' N2 Independently represents nucleotides modified with 2'-fluorine.

[0082] In some implementation schemes, N M2 N M3 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0083] In some implementation schemes, N M2 N M4 and N M5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0084] In some implementation schemes, N M1 N M3 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0085] In some implementation schemes, N M2 N M3 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0086] In some implementation schemes, N M2 N M4 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.

[0087] In some implementation schemes, N M1 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 This indicates a nucleotide modified with UNA.

[0088] In some implementation schemes, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and N M5 This indicates a nucleotide modified with UNA.

[0089] In some embodiments, N M2 , N M4 , and N M6 each independently represents a 2’-fluoro modified nucleotide, and N M5 represents a UNA modified nucleotide.

[0090] In some embodiments, the dsRNA agent comprises a targeting group conjugated to the 5' end of the sense strand, preferably the targeting group is any one selected from the preceding GLO-1 to GLO-16 and GLS-1* to GLS-16*, more preferably the targeting group is the preceding GLS-15*. In certain embodiments, the dsRNA agent comprises a targeting group conjugated to the 5' end of the sense strand. In certain embodiments, the antisense strand comprises a inverted abasic residue at the 3' end. In certain embodiments, the sense strand comprises one or two inverted abasic residues and / or one or two imann residues at the 3' and / or 5' end. In certain embodiments, the 3' and 5' ends of the sense strand each independently comprise an inverted abasic residue. In certain embodiments, the 3' and 5' ends of the sense strand each independently comprise an imann residue. In certain embodiments, the sense strand comprises two inverted abasic residues at the 3' and 5' ends, and the residue at the 3' or 5' end is further conjugated to a targeting group, preferably the preceding GLS-15*. In certain embodiments, the sense strand comprises two imann residues at the 3' and 5' ends, and the residue at the 3' or 5' end is further conjugated to a targeting group, preferably the preceding GLS-15*. In certain embodiments, the dsRNA agent has two blunt ends. In certain embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides. In some embodiments, the one or more inverted abasic residues or the one or more imann residues are conjugated to either or both ends of the sense strand via a phosphorothioate linkage. In some embodiments, the targeting group is further conjugated to either end of the sense strand via a phosphorothioate linkage. In some embodiments, the targeting group is further conjugated to the 5' end of the sense strand via a phosphorothioate linkage. In certain embodiments, the 5' end of the sense strand comprises an inverted abasic residue or an imann residue, wherein the inverted abasic residue or the imann residue is linked to the adjacent nucleotide at the 5' end of the sense strand nucleotide sequence via a phosphorothioate linkage. In certain embodiments, the sense strand further comprises a targeting group linked to the inverted abasic residue or the imann residue at the 5' end of the sense strand, wherein the targeting group is linked to the adjacent inverted abasic residue or the imann residue via a phosphorothioate linkage, and optionally the targeting group is N-acetylgalactosamine (GalNAc). In some embodiments of the above dsRNA agents, the region that is complementary to a portion of a C3 mRNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the complement of any of the target regions in the above-described C3 mRNA transcripts.In certain embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments of the above dsRNA agents, the C3 mRNA transcript is SEQ ID NO: 1.

[0091] In some embodiments, any one of the sense strands in Table 1 can be further modified according to the pattern shown in the above Formula (A) or (C).

[0092] In some embodiments, any one of the antisense strands in Table 1 can be further modified according to the pattern shown in the above Formula (B) or (C).

[0093] In some embodiments, any one of the duplexes in Table 1 can be further modified according to the pattern shown in the above Formula (C).

[0094] In some embodiments, the dsRNA agent comprises any one of the antisense strand sequences listed in Table 1.

[0095] According to one aspect of the application, there is provided a composition comprising any of the embodiments of the above dsRNA agent aspects of the application. In certain embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration or for intravenous (IV) administration.

[0096] According to another aspect of the application, there is provided a cell comprising any of the embodiments of the above dsRNA agent aspects of the application. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0097] According to another aspect of the application, there is provided a method of inhibiting expression of a C3 gene in a cell, the method comprising: (i) preparing a cell comprising an effective amount of any of the embodiments of the dsRNA agent aspect of the application or any of the embodiments of the composition aspect of the application described above. In certain embodiments, the method further comprises: (ii) maintaining the prepared cell for a sufficient time to obtain degradation of mRNA transcript of the C3 gene, thereby inhibiting expression of the C3 gene in the cell. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject intravenously. In certain embodiments, the method further comprises assessing inhibition of the C3 gene after administration of the dsRNA agent to the subject, wherein the method of assessing comprises: (i) determining one or more physiological characteristics of a C3-related disease or disorder in the subject, and (ii) comparing the determined physiological characteristics to baseline pre-treatment physiological characteristics of the C3-related disease or disorder and / or to control physiological characteristics of the C3-related disease or disorder, wherein the comparison indicates one or more of the presence or absence of inhibition of C3 gene expression in the subject. In some embodiments, the physiological characteristics are one or more of: C3 mRNA levels and C3 protein levels. In certain embodiments, the determined physiological characteristics are C3 levels in blood. In certain embodiments, paroxysmal nocturnal hemoglobinuria (PNH), a relatively rare disease, comprises an acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and a prothrombotic tendency (a tendency to form blood clots). Decreased C3 levels and / or C3 in blood indicate decreased C3 gene expression in the subject.

[0098] According to another aspect of the application, there is provided a method of inhibiting expression of a C3 gene in a subject, the method comprising administering to the subject an effective amount of any of the embodiments of the dsRNA agent aspect of the application described above or any of the embodiments of the composition aspect of the application described above. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the method further comprises: assessing inhibition of the C3 gene after administration of the dsRNA agent, wherein the method of assessing comprises: (i) determining one or more physiological characteristics of a C3-related disease or disorder in the subject, and (ii) comparing the determined physiological characteristics to baseline pre-treatment physiological characteristics of the C3-related disease or disorder and / or to control physiological characteristics of the C3-related disease or disorder, wherein the comparison indicates one or more of the presence or absence of inhibition of C3 gene expression in the subject. In some embodiments, expression of the C3 gene can be assessed based on the level or change in level of any variable associated with C3 gene expression, such as C3 mRNA levels, C3 protein levels.

[0099] According to another aspect of the application, there is provided a method of treating a disease or disorder associated with the presence of C3 protein, the method comprising: administering to a subject an effective amount of any of the above-described embodiments of a dsRNA agent of the application or any of the above-described embodiments of a composition of the application to inhibit C3 gene expression. In some embodiments, the C3-associated disease, disorder, or condition is selected from the group consisting of C3 glomerulopathy (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgAN;), age-related macular degeneration (AMD), rheumatoid arthritis (RA), anti-neutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease associated with dysbiosis, malaria anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative disease.

[0100] In some embodiments, the method further comprises administering to the subject an additional therapeutic regimen. In some embodiments, the additional therapeutic regimen comprises treating a C3-associated disease or disorder. In certain embodiments, the additional therapeutic regimen comprises administering to the subject one or more C3 antisense polynucleotides of the application, administering to the subject a non-C3 dsRNA therapeutic agent, and behavior modification of the subject. The additional therapeutic agent is selected from a C5 inhibitor, such as an anti-complement component C5 antibody or antigen-binding fragment thereof (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918)) or a C5 peptide inhibitor (e.g., zilucoplan); a C3 peptide inhibitor, such as compstatin.

[0101] In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the method further comprises determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent on the subject.

[0102] In some embodiments, the method of determining the efficacy of the treatment on the subject comprises: (i) determining one or more physiological characteristics of the C3-associated disease or disorder in the subject, and (ii) comparing the determined physiological characteristics to baseline pre-treatment physiological characteristics of the C3-associated disease or disorder, wherein the comparison indicates one or more of the presence, absence, and level of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject.

[0103] In some embodiments, expression of a C3 gene can be assessed based on the level or change in level of any variable associated with C3 gene expression, such as the subject’s C3 mRNA level, C3 protein level.

[0104] According to another aspect of the application, there is provided a method of reducing the level of C3 protein in a subject compared to the pre-treatment baseline level of C3 protein in the subject, the method comprising administering to the subject an effective amount of any of the above-described embodiments of a dsRNA agent of the application or any of the above-described embodiments of a composition of the application to reduce the level of C3 gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by intravenous injection.

[0105] According to another aspect of the application, there is provided a method of altering a physiological feature of a C3 -related disease or condition in a subject, the method comprising administering to the subject an effective amount of any of the above-described embodiments of a dsRNA agent of the application or any of the above-described embodiments of a composition of the application to alter the physiological feature of the C3 -related disease or condition in the subject compared to the baseline pre-treatment physiological feature of the C3 -related disease or condition in the subject. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or by intravenous injection. In certain embodiments, the physiological feature and symptom is one or more of the subject’s C3 mRNA level, C3 protein level. In certain embodiments, paroxysmal nocturnal hemoglobinuria (PNH), a relatively rare disease, comprises acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and the physiological features of thrombophilia (a predisposition to thrombosis).

[0106] According to another aspect of the application, there is provided the foregoing dsRNA agent for use in a method of treating a disease or condition associated with the presence of C3 protein. In some embodiments, the disease or condition is one or more of C3 glomerulopathy (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, postinfectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgA N;), age-related macular degeneration (AMD), rheumatoid arthritis (RA), anti-neutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), periodontal disease by dysbiosis, malaria anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and a neurodegenerative disease.

[0107] Brief description of the sequences

[0108] SEQ ID NO: 1 is Homo sapiens C3 mRNA [NCBI Reference Sequence: NM_000064.4].

[0109] SEQ ID NOs: 2-24, 110, 112, as shown in Table 1, are sense strand sequences.

[0110] SEQ ID NOs: 25-47, 111, 113, as shown in Table 1, are antisense strand sequences.

[0111] SEQ ID NOs: 48-71, as shown in Table 2, are chemically modified sequences.

[0112] SEQ ID NOs: 72-101, 102-107, as shown in Table 3. Delivery molecules are indicated as “GLX-__” at either the 3’ end or 5’ end of each sense strand.

[0113] Brief description of the drawings

[0114] Figure 1 Figure of C3 siRNA (AD01444, AD01428, AD01447) serum protein knockdown effect in monkeys following a single subcutaneous injection of 5 mg / kg siRNA compound.

[0115] Figure 2 Figure of C3 siRNA (AD00193-3, AD01444, AD01444-3, AD01447-2) serum protein knockdown effect in monkeys following a single subcutaneous injection of 5 mg / kg dose of siRNA compound.

[0116] Figure 3 Figure of C3 siRNA (AD00193-3, AD01447-2, AD01447-4, AD01447-5, AD01447-6) C3 mRNA knockdown effect in monkey liver biopsies following a single subcutaneous injection of 6 mg / kg siRNA compound. DETAILED DESCRIPTION

[0118] The present invention includes, in part, RNAi agents, such as, but not limited to, double-stranded (ds) RNAi agents, that are capable of inhibiting complement component 3 (C3) gene expression. The present invention also includes compositions comprising C3 RNAi agents and methods of using the same. The C3 RNAi agents disclosed herein can be attached to a delivery compound for delivery to a cell, including a hepatocyte. The pharmaceutical compositions of the present invention can include at least one dsRNA C3 agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a GalNAc-containing delivery compound. The C3 RNAi agents delivered to a cell are capable of inhibiting C3 gene expression, thereby reducing the activity of the C3 protein product of the gene in the cell. The dsRNAi agents of the present invention are useful for treating C3-related diseases and disorders.

[0119] In some embodiments of the present invention, reducing C3 expression in a cell or a subject treats a disease or disorder associated with C3 expression in the cell or subject, respectively. Non-limiting examples of diseases and disorders that can be treated by reducing C3 activity. In certain embodiments, paroxysmal nocturnal hemoglobinuria (PNH), a relatively rare disease, includes an acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and the physiological features of thrombophilia (a predisposition to thrombosis). “Treatment” can also mean extending the life expectancy compared to what would be expected without treatment.

[0120] As used herein, “G,” “C,” “A,” and “U” generally represent nucleotides containing guanine, cytosine, adenine, and uracil, respectively, as the base. However, it is understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide (as further detailed below) or an alternative replacement moiety. Those skilled in the art understand that guanine, cytosine, adenine, and uracil can be replaced with other moieties without significantly altering the base pairing properties of an oligonucleotide comprising nucleotides with such replacement moieties. For example, but not by way of limitation, a nucleotide comprising inosine as the base can base pair with a nucleotide containing adenine, cytosine, or uracil. Thus, in the nucleotide sequences of the present invention, a nucleotide containing uracil, guanine, or adenine can be replaced with a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the present invention.

[0121] The term "complement component 3," as used herein, is used interchangeably with the term "C3," refers to a naturally occurring gene encoding a complement 3 protein from any vertebrate or mammalian source, including but not limited to human, bovine, chicken, rodent, mouse, rat, pig, ovine, primate, monkey, and guinea pig, unless otherwise indicated. The term also refers to fragments and variants of native C3 that retain at least one in vivo or in vitro activity of native C3. The reference sequence of the amino acid and complete coding sequence of the human C3 gene can be found, for example, in GenBank Ref Seq Accession No. NM_000064.4 (SEQ ID NO: 1). Other examples of C3 mRNA sequences can be readily obtained using publicly available databases (e.g., GenBank, UniProt, Ensembl, and OMIM).

[0122] The following describes how to make and use compositions comprising C3 single-stranded (ssRNA) and dsRNA to inhibit C3 gene expression, as well as compositions and methods for treating diseases and disorders caused by or modulated by C3 gene expression. The term "RNAi" is also known in the art and can be referred to as "siRNA."

[0123] As used herein, the term "RNAi" refers to an agent comprising RNA and mediated by the RNA-induced silencing complex (RISC) pathway that mediates the targeted cleavage of RNA transcripts. As known in the art, the RNAi target region refers to a contiguous portion of the nucleotide sequence of an RNA molecule formed during the process of gene transcription, including messenger RNA (mRNA), which is a processed product of the primary transcription product RNA. The target portion of the sequence will be at least long enough to serve as a substrate for directed cleavage by RNAi at or near that portion. The target sequence can be 8-30 nucleotides long, inclusive, 10-30 nucleotides long, inclusive, 12-25 nucleotides long, inclusive, 15-23 nucleotides long, inclusive, 16-23 nucleotides long, inclusive, or 18-23 nucleotides long, inclusive, and includes all shorter lengths within each specified range. In some embodiments of the application, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In certain embodiments, the target sequence is between 9 and 26 nucleotides long, inclusive, including all subranges and integers therebetween. For example, although not intended to be limiting, in certain embodiments of the application, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, which sequence is fully or at least substantially complementary to at least a portion of an RNA transcript of the C3 gene. Some aspects of the application include a pharmaceutical composition comprising one or more C3 dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the application, the C3 RNAi as described herein inhibits the expression of a C3 protein.

[0124] As used herein, "dsRNA agent" refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting the translation of a target mRNA transcript. While not wishing to be bound by a particular theory, the dsRNA agents of the present application can act through the RNA interference mechanism (i.e., induce production of RNA interference by interacting with the RNA interference pathway machinery of a mammalian cell (RNA-induced silencing complex or RISC)) or through any alternative mechanism or pathway. Methods of achieving gene silencing in plants, invertebrates, and vertebrate cells are well known in the art (see, e.g., Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), the disclosures of each of which are incorporated herein by reference in their entirety. The gene silencing means known in the art can be used in conjunction with the disclosure provided herein to achieve inhibition of expression of C3.

[0125] The dsRNA agents disclosed herein consist of one sense strand and one antisense strand, including but not limited to short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. It is known in the art that dsRNA duplexes of different lengths can be effective for inhibiting the expression of a target gene. For example, it is known that dsRNAs having duplexes of 19, 20, 21, 22, and 23 base pairs are effective for inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in the art that shorter or longer RNA duplexes can also be effective for inducing RNA interference. In some embodiments, the sense and antisense strands can be the same or different in length. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 25 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In some embodiments, each strand is no more than 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agent can be 15 to 49 nucleotides in length, respectively. In some embodiments, the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, independently. In some embodiments, the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length, independently. In some embodiments, the sense and antisense strands are 21 nucleotides in length. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, with a region of complementarity that is 15 to 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, the region of complementarity is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The C3 dsRNAs in certain embodiments of the application can include at least one strand that is at least 21 nt in length, or can have a shorter duplex based on one of the sequences listed in any of Tables 1-3 reduced by 1, 2, 3, or 4 nucleotides at one or both ends, respectively, but can also be effective compared to the dsRNAs listed in Tables 1-3.In some embodiments of the application, a C3 dsRNA agent can have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one or more of the sequences in Tables 1-3, and its ability to inhibit C3 gene expression is not more than 5%, 10%, 15%, 20%, 25%, or 30% different from the level of inhibition produced by a dsRNA comprising the full sequence. The sense sequences, antisense sequences, and duplexes disclosed in Tables 1-3 can be referred to herein as "parental" sequences, meaning that the sequences disclosed in Tables 1-3 can be modified, shortened, lengthened, include substitutions, etc. as described herein, with the resulting sequences retaining all or at least a portion of the efficacy of their parental sequences in the methods and compositions of the application. The sense and antisense strands included in the dsRNAs of the application are independently selected. As used herein, the term "independently selected" means that each of two or more similar elements can be selected independently of the selection of the other element(s). For example, while not intending to be limited, in making a dsRNA of the application, the "elements" of the two strands can be selected to be included in the duplex. One selected element, the sense sequence, can be SEQ ID NO: 56 (as shown in Table 2), while the other selected element, the antisense sequence, can be SEQ ID NO: 68, or can be SEQ ID NO: 68 modified, shortened, lengthened, and / or including 1, 2, or 3 substitutions as compared to its parental sequence, SEQ ID NO: 68. It will be appreciated that the duplexes of the application need not include both of the sense and antisense sequences shown in pairs in Tables 1-3. Each sense and antisense strand sequence in the Tables is followed by its SEQ ID NO.

[0126] Certain embodiments of the compositions and methods of the application include single-stranded RNA in the compositions and / or administered to the subject. For example, the antisense strand listed in any of Tables 1-3 can be a composition or administered to a subject to reduce C3 polypeptide activity and / or C3 gene expression in the subject. Table 1 shows certain C3 dsRNA agent antisense strand and sense strand core extension base sequences. Single-stranded antisense molecules that can be included in certain compositions of the application and / or administered in certain methods of the application are referred to herein as “single-stranded antisense agents” or “antisense polynucleotide agents.” Single-stranded sense molecules that can be included in certain compositions of the application and / or administered in certain methods of the application are referred to herein as “single-stranded sense agents” or “sense polynucleotide agents.” The term “base sequence” is used herein to refer to the polynucleotide sequence without chemical modifications or delivery compounds of the compound. For example, the sense strand GUCUACGAAGCUCAUGAAUAA (SEQ ID NO: 10) shown in Table 1 is the base sequence of SEQ ID NO: 56 in Table 2 and SEQ ID NO: 83 or 84, 86, and / or 87 in Table 3, where SEQ ID NO: 56 and SEQ ID NO: 83 or 84, 86, and / or 87 show their chemical modifications and delivery compounds. The sequences disclosed herein can be assigned identifiers. For example, a single-stranded sense sequence can be identified with “sense strand SS#”; a single-stranded antisense sequence can be identified with “antisense strand AS#,” and a duplex including a sense strand and an antisense strand can be identified with “duplex AD# / AV#.”

[0127] Table 1 includes sense strands and antisense strands and provides the identification number of the duplex formed by the sense strand and the antisense strand on the same row in Table 1. In certain embodiments of the application, the antisense sequence includes a nucleobase u or a nucleobase a at position 1 of the antisense sequence. In certain embodiments of the application, the antisense sequence includes a nucleobase u at position 1 of the antisense sequence. As used herein, the term “mating position” in a sense strand and an antisense strand is the position in each strand that is “paired” when the two strands are duplexed. For example, in a 21 nucleobase sense strand and a 21 nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 21 of the antisense strand are at a “mating position.” In yet another non-limiting example, in a 23 nucleobase sense strand and a 23 nucleobase antisense strand, nucleobase 2 of the sense strand and nucleobase 22 of the antisense strand are at a mating position. In yet another non-limiting example, in an 18 nucleobase sense strand and an 18 nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 18 of the antisense strand are at a mating position, and the nucleobase 4 of the sense strand and the nucleobase 15 of the antisense strand are at a mating position. Those skilled in the art will appreciate how to identify the mating positions in sense strands and antisense strands that are or will be duplexed and paired strands.

[0128] The first column in Table 1 identifies double-stranded AV#s comprising double-stranded of sense and antisense sequences in the same table row. For example, Table 1 discloses a double-stranded identified as double-stranded AV01447.um comprising sense strand SEQ ID NO: 10 and antisense strand SEQ ID NO: 33. Thus, each row in Table 1 identifies a double-stranded of the present application, each double-stranded comprising the sense and antisense sequences shown in the same row, the assigned identifier for each double-stranded is shown in the first column of the row.

[0129] In some embodiments of the methods of the present application, an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is administered to the subject. In some embodiments of the present application, the RNAi agent administered to the subject comprises a duplex comprising at least one of the base sequences listed in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the methods of the present application, an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is attached to a delivery molecule, non-limiting examples of which are delivery compounds comprising a GalNAc compound or a GLS-15* compound.

[0130] Table 1: Unmodified C3 RNAi agent antisense and sense strand sequences. All sequences are shown in the 5' to 3' direction. Double-stranded AV# is the identifier assigned to the double-stranded of the two strands in the same row in the table.

[0131]

[0132]

[0133]

[0134] Table 3 shows certain chemically modified C3 RNAi agent antisense and sense strand sequences of the application. In some embodiments of the methods of the application, the RNAi agents shown in Table 3 are administered to a cell and / or a subject. In some embodiments of the methods of the application, an RNAi agent having a polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the application, the RNAi agent administered to a subject includes the duplex identified in the first column of a row in Table 3, and includes the sequence modifications and / or delivery compounds listed in the sense and antisense strand sequences in the third and sixth columns, respectively, in the same row of Table 3. These sequences were used in certain in vivo test studies described elsewhere herein. In some embodiments of the methods of the application, the sequences shown in Table 3 can be attached (also referred to herein as "bound to") a compound for delivery, a non-limiting example of which is a GalNAc-containing compound, wherein the delivery compound is identified as "GLX-n" on the sense strand in the third column of Table 3. As used herein, "GLX-n" is used to mean either a "GLS-n*" or a "GLO-n" delivery compound ("X" can be "S" or "O"), while GLX-0 can be any "GLS-n*" and "GLO-n" delivery compound that can be attached to the 3' end of an oligonucleotide during synthesis. As used herein and shown in Table 3, "GLX-n" is used to mean that the attached GalNAc-containing compound is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, wherein the structure of each compound is provided elsewhere herein. Those of skill in the art will be able to make and use the dsRNA compounds of the application wherein the attached delivery compound is any one of GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16.In some embodiments, the delivery compound L96 is represented as a GalNAc- containing compound for attachment as disclosed in the prior art, such as, but not limited to, the full contents of GalNAc-containing compounds for attachment as disclosed in Jayaprakash, et al., (2014) J. Am. Chem. Soc, 136, 16958-16961 and / or WO2021222549 are incorporated herein. The first column of Table 3 provides the duplex AD# assigned to the sense and antisense sequence duplex of that row of the table. For example, the duplex AD# AD01447 is the duplex of the sense strand SEQ ID NO: 78 and the antisense strand SEQ ID NO: 90. Each row of Table 3 provides a sense strand and an antisense strand, and discloses the duplex of the indicated sense and antisense strands. The “sense strand SS#” in the second column of Table 3 is the assigned identifier of the sense sequence (including modifications) shown in the third column of the same row. The “antisense strand AS#” in the fifth column of Table 3 is the assigned identifier of the antisense sequence (including modifications) shown in the sixth column. The identifiers of certain linked GalNAc-containing “GLO-n” or “GLS-n*” compounds are represented as GLS-5*, GLS-15*, or GLX-0, and it is understood that another “GLO-n” or “GLS-n*” compound can be substituted for the compound represented as GLO-0, the resulting compound included in the embodiments of the methods and / or compositions of the present application.

[0135]

[0136]

[0137]

[0138]

[0139]

[0140] In certain embodiments of the present application, the dsRNA (also referred to herein as a “duplex”) is a dsRNA disclosed in one of Tables 1-3. Each row of Tables 1-3 discloses a duplex comprising the sense strand sequence and the antisense strand sequence in that row of the table. In addition to the duplexes disclosed in Tables 1-3, it is understood that in some embodiments, the duplexes of the present application can include the sense and antisense sequences shown in Tables 1-3 that differ from the nucleotides shown in the sequences shown in Tables 1-3 by zero, one, two, or three. Thus, as non-limiting examples, in some embodiments, the antisense strand in the duplexes of the present application can be a nucleotide sequence that differs from the nucleotides in SEQ ID NO: 86, 87, 88, or 90 by zero, one, two, or three nucleotides, respectively.

[0141] It is understood that the sense strand sequence and the antisense strand sequence in a double strand of the application can be independently selected. Thus, a dsRNA of the application can include a sense strand and an antisense strand of a duplex disclosed in a row of Tables 1-3. Alternatively, in a dsRNA of the application, one or both of the selected sense strand and antisense strand in the dsRNA can include a sequence shown in Tables 1-3, but one or both of the sense strand and antisense strand includes 1, 2, 3, or more nucleobase substitutions from the parent sequence. In some embodiments, the selected sequence can be longer or shorter than its parent sequence. Thus, a dsRNA agent encompassed by the application can, but need not, include the exact sequence of the sense strand and the antisense strand disclosed as a duplex in Tables 1-3.

[0142] In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprise a region of complementarity to a C3 RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprises a targeting ligand. In some cases, the region of complementarity to a C3 RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides differing by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of a dsRNA agent of the application, the antisense strand of the dsRNA is at least substantially complementary to any of the target regions of SEQ ID NO: 1, and is provided in any of Tables 1-3. In some embodiments, the antisense strand of a dsRNA agent of the application is fully complementary to any of the target regions of SEQ ID NO: 1, and is provided in any of Tables 1-3. In some embodiments, a dsRNA agent of the application includes a sense strand sequence listed in any of Tables 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, a dsRNA agent of the application includes a sense strand sequence listed in any of Tables 1-3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In certain cases, a dsRNA agent of the application comprises an antisense strand sequence shown in any of Tables 1-3. Some embodiments of a dsRNA agent of the application comprise the sense and antisense sequences disclosed as a duplex in any of Tables 1-3. As described herein, it is understood that the sense and antisense strands in a duplex of the application can be independently selected.

[0143] mismatch

[0144] It is known to those skilled in the art that mismatches are tolerated for the efficacy of dsRNA, particularly where the mismatches are in the terminal regions of the dsRNA. Certain mismatches are better tolerated, for example mismatches with the wobble base pairs G:U and A:C are better tolerated for efficacy (Du et al., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5): 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the application, a C3 dsRNA agent can comprise one or more mismatches to the C3 target sequence. In some embodiments, the C3 dsRNA agents of the application do not include mismatches. In certain embodiments, the C3 dsRNA agents of the application comprise no more than 1 mismatch. In some embodiments, the C3 dsRNA agents of the application comprise no more than 2 mismatches. In certain embodiments, the C3 dsRNA agents of the application comprise no more than 3 mismatches. In some embodiments of the application, the antisense strand of a C3 dsRNA agent comprises mismatches to the C3 target sequence that are not in the center of the region of complementarity. In some embodiments, the antisense strand of a C3 dsRNA agent comprises 1, 2, 3, 4, or more mismatches that are within the last 5, 4, 3, 2, or 1 nucleotides of one or both of the 5' or 3' ends of the region of complementarity. The methods described herein and / or methods known in the art can be used to determine whether a C3 dsRNA agent comprising mismatches to the C3 target sequence is effective to inhibit expression of the C3 gene.

[0145] Complementarity

[0146] As used herein, unless otherwise indicated, the term "complementary" when used to describe a first nucleotide sequence (e.g., a C3 dsRNA agent sense strand or a C3 mRNA targeted by) relative to a second nucleotide sequence (e.g., a C3 dsRNA agent antisense strand or a single-stranded antisense polynucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize [form base pair hydrogen bonds under physiological conditions in a mammal (or similar conditions in vitro)] to an oligonucleotide or polynucleotide comprising the second nucleotide sequence and to form a double-stranded or duplex structure under certain conditions. Other conditions, such as physiologically relevant conditions that can be encountered in vivo, can also apply. The skilled artisan will be able to determine the set of conditions most suitable for testing the complementarity of two sequences depending on the ultimate application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, including natural or modified nucleotides or nucleotide mimetics, at least to the extent that the hybridization requirements described above are met. Sequence identity or complementarity is independent of modification.

[0147] For example, complementary sequences within a C3 dsRNA as described herein comprise base pairing of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the full length of one or both nucleotide sequences. Such sequences can be referred to herein as being "fully complementary" to one another. It will be appreciated that in embodiments where two oligonucleotides are designed to form one or more single-stranded overhangs when hybridized, such overhangs are not considered mismatches for purposes of determining complementarity based on complementarity. For example, a C3 dsRNA agent comprises one oligonucleotide of 19 nucleotides in length and another oligonucleotide of 20 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 19 nucleotides that is fully complementary to the shorter oligonucleotide, such a case can be referred to as "fully complementary" for purposes described herein. Thus, as used herein, "fully complementary" means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence can comprise all or a portion of the first or second nucleotide sequence.

[0148] As used herein, the term "substantially complementary" refers to at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (but not all) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide in a hybridizing pair of nucleobase sequences. The term "substantially complementary" can be used if the two sequences, when hybridized, contain one or more mismatched base pairs, for example, at least 1, 2, 3, 4, or 5 mismatched base pairs, to refer to the first sequence forming a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) relative to the second sequence, while retaining the ability to hybridize under conditions most relevant to its ultimate application, for example, inhibition of C3 gene expression by the RISC pathway.

[0149] The term "partially complementary" can be used herein to refer to a hybridizing pair of nucleobase sequences, where at least 75% (but not all) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, "partially complementary" refers to at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.

[0150] The terms "complementary," "fully complementary," "substantially complementary," and "partially complementary" as used herein refer to base matches between the sense strand and the antisense strand of a C3 dsRNA agent, between the antisense strand of a C3 dsRNA agent and a target C3 mRNA sequence, or between a single-stranded antisense oligonucleotide and a target C3 mRNA sequence. It is understood that the term "antisense strand of a C3 dsRNA agent" can refer to the same sequence of a "C3 antisense polynucleotide agent."

[0151] As used herein, the term "substantially identical" or "substantial identity" when used in reference to a nucleic acid sequence refers to a nucleic acid sequence comprising a sequence having at least about 85% or more sequence identity to a reference sequence, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence. The percent sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percent sequence identity is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent sequence identity. The presently disclosed invention encompasses nucleotide sequences that are substantially identical to the nucleotide sequences disclosed herein. For example, in Tables 1-3. In some embodiments, the sequences disclosed herein are identical to the sequences disclosed herein (e.g., Tables 1-3), or are at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.

[0152] The term "strand comprising a sequence" as used herein refers to an oligonucleotide comprising a chain of nucleotides described by the sequence referred to using standard nucleotide nomenclature. The term "double-stranded RNA" or "dsRNA" as used herein refers to an RNAi comprising an RNA molecule or molecular complex having a region of hybridized double-strandedness comprising two antiparallel and substantially or completely complementary nucleic acid strands having "sense" and "antisense" orientation with respect to a target C3 RNA. The double-stranded region can be of any length that allows for specific degradation of the desired target C3 RNA by the RISC pathway, but is typically in the range of 9 to 30 base pairs in length, for example 15-30 base pairs in length. The length of the duplex can be within this range, for example 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any subranges therebetween, including but not limited to, 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs, considering the duplex between 9 and 30 base pairs. The length of the C3 dsRNA agent produced in a cell by processing with Dicer and like enzymes is typically in the range of 19-22 base pairs. One strand of the double-stranded region of a C3 dsDNA agent comprises a sequence substantially complementary to a region of a target C3 RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one region of self-complementarity, or can be formed from two or more separate RNA molecules. Where the double-stranded region is formed from a single molecule, the molecule can have a duplex structure formed from one strand at the 3'-end and the other strand at the corresponding 5'-end of a single-stranded nucleotide chain (referred to herein as a "hairpin loop"). In some embodiments of the present application, the hairpin structure comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unpaired nucleotides.When the two substantially complementary strands of a C3 dsRNA agent consist of separate RNA molecules, the molecules need not be, but can be, covalently attached. When the two strands are covalently attached by means other than a hairpin loop, the attachment structure is referred to as a "linker." The term "siRNA" is also used herein to refer to the dsRNA agents described herein.

[0153] In some embodiments of the application, a C3 dsRNA agent can include sense and antisense sequences that do not have unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. An end that lacks unpaired nucleotides is referred to as "blunt," and a dsRNA that has both ends that lack nucleotide overhangs is referred to as "blunt-ended." In some embodiments of the application, the first end of a dsRNA agent is blunt-ended, in some embodiments the second end of a dsRNA agent is blunt-ended, and in certain embodiments of the application, both ends of a C3 dsRNA agent are blunt-ended.

[0154] In some embodiments of the dsRNA agents of the application, the dsRNA lacks one or both blunt ends. In this case, the end of a strand of a dsRNA agent has at least one unpaired nucleotide. For example, a nucleotide overhang is present when the 3' end of one strand of a dsRNA extends beyond the 5' end of the other strand, or vice versa. A dsRNA can include an overhang of at least 1, 2, 3, 4, 5, 6, or more nucleotides. The nucleotide overhang can comprise or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. It will be understood that in some embodiments, the nucleotide overhang is on the sense strand of a dsRNA agent, on the antisense strand of a dsRNA agent, or at both ends of a dsRNA agent, and that the nucleotides of the overhang can be present at the 5' end, the 3' end, or both ends of the antisense or sense strand of a dsRNA. In certain embodiments of the application, one or more of the nucleotides in the overhang are replaced with a nucleoside thio-phosphate.

[0155] The term "antisense strand" or "guide strand" as used herein refers to a strand of a C3 dsRNA agent that includes a region that is substantially complementary to a C3 target sequence. The term "sense strand" or "passenger strand" as used herein refers to a strand of a C3 dsRNA agent that includes a region that is substantially complementary to a region of the antisense strand of a C3 dsRNA agent.

[0156] Modifications

[0157] The RNA of the C3 RNAi agents in certain embodiments of the application is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in certain embodiments of the application can be synthesized and / or modified by methods well known in the art, for example, see "Current protocols in Nucleic Acid Chemistry," Beaucage, S. L. et al. (Eds.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated by reference herein. Modifications that can be present in certain embodiments of the C3 dsRNA agents of the application include, for example: (a) terminal modifications, for example, 5' terminal modifications (phosphorylation, conjugation, inverted linkage, etc.), 3' terminal modifications (conjugation, DNA nucleotides, inverted linkage, etc.); (b) base modifications, for example, substitutions with stable bases, destabilizing bases, or bases that pair with an expanded partner repertoire, deletion of bases (abasic nucleotides), or conjugated bases; (c) sugar modifications (for example, at the 2' position or 4' position) or substitutions of sugars, and (d) backbone modifications, including modifications or substitutions of phosphodiester linkages. Specific examples of RNA compounds that can be used in certain embodiments of the C3 dsRNA agents, C3 antisense polynucleotides, and C3 sense polynucleotides of the application include, but are not limited to, RNAs comprising modified backbones or no natural internucleoside linkages. As a non-limiting example, an RNA with a modified backbone can have no phosphorus atoms in the backbone. An RNA with no phosphorus atoms in the internucleoside backbone can be referred to as an oligonucleoside. In certain embodiments of the application, the modified RNA has phosphorus atoms in its internucleoside backbone.

[0158] It is understood that the term "RNA molecule" or "RNA" or "ribonucleic acid molecule" encompasses not only RNA molecules expressed or found in nature, but also RNA analogs and derivatives comprising one or more ribonucleotides / ribonucleoside analogs or derivatives described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules can be modified in the nucleobase structure or the ribose-phosphate backbone structure, for example as described below, and molecules comprising ribonucleoside analogs or derivatives must retain the ability to form duplexes. As non-limiting examples, RNA molecules can also include at least one modified ribonucleoside, including but not limited to 2'-0-methyl modified nucleosides, nucleosides comprising 5' thiophosphate groups, terminal nucleosides linked to a cholesterol derivative or a dodecanoic acid dipalmitoyl amide group, locked nucleosides, abasic nucleosides, 2'-deoxy-2'-fluoro modified nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, phosphoramidate, or nucleosides comprising non-natural bases, or any combination thereof. In some embodiments of the application, the RNA molecule comprises the following number of modified ribonucleosides: at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or up to the full length of the ribonucleosides of a C3 dsRNA agent molecule. The modification need not be the same for each of the plurality of modified ribonucleosides in such an RNA molecule.

[0159] In some embodiments, the dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the application can comprise one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester linkages. As used herein, the term "independently selected" to refer to selected elements, e.g., modified nucleotides, non-phosphodiester linkages, etc., means that two or more selected elements can be the same as one another but need not be.

[0160] As used herein, "nucleotide base," "nucleotide," or "nucleobase" is a heterocyclic purine or pyrimidine compound that is a standard component of all nucleic acids and includes the bases that form nucleotides: adenine, guanine, cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to: universal bases, hydrophobic bases, wobble bases, size-expanded bases, and fluorinated bases. The term "ribonucleotide" or "nucleotide" can be used herein to refer to unmodified nucleotides, modified nucleotides, or surrogate moieties. One of skill in the art will recognize that guanine, cytosine, adenine, and uracil can be substituted with other moieties without significantly altering the base-pairing properties of an oligonucleotide comprising nucleotides bearing such surrogate moieties.

[0161] In one embodiment, the modified RNA considered for use in the methods and compositions described herein is a peptide nucleic acid (PNA) that has the ability to form the desired double-stranded structure and allows or mediates the specific degradation of the target RNA via a RISC pathway. In some embodiments of the invention, the C3 RNA disruptor comprises a single-stranded RNA that interacts with the target C3 RNA sequence to guide the cleavage of the target C3 RNA.

[0162] The modified RNA backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates (including 3'-alkylphosphonates and chiral phosphonates), phosphonites, aminophosphates (including 3'-aminoaminophosphates and aminoalkylaminophosphates), thiophosphates, thioalkylphosphonates, thioalkyl phosphate triesters, and borate phosphates (thiophosphates having normal 3'-5' linkages, as well as 2'-5' linkage analogs of these, and those with inverted polarity, wherein adjacent nucleoside unit pairs are linked in a 3'-5' to 5'-3' or 2'-5' to 5'-2' configuration). Various salts, mixed salts, and free acid forms are also included. Methods for preparing phosphorus-containing bonds are conventional in the art, and such methods can be used to prepare certain modified C3 dsRNA agents, certain modified C3 antisense polynucleotides, and / or certain modified C3 sense polynucleotides of the present invention.

[0163] The phosphorus-free modified RNA backbone has a backbone formed by short-chain alkyl or cycloalkyl nucleosides linked together, mixed heteroatoms and alkyl or cycloalkyl nucleosides linked together, or one or more short-chain heteroatoms or heterocyclic nucleosides linked together. This includes those with morpholine bonds (partially formed from the sugar moiety of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; methylacetyl and thiomethylacetyl backbones; methylene methylacetyl and thiomethylacetyl backbones; olefin-containing backbones; aminosulfonate backbones; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and other moieties mixed with N, O, S, and CH2 components. Methods for preparing phosphorus-free modified RNA backbones are conventional practice in the art, and such methods can be used to prepare certain modified C3 dsRNA reagents, certain modified C3 antisense polynucleotides, and / or certain modified C3 sense polynucleotides of the present invention.

[0164] In certain embodiments of the application, RNA mimetics are included in the C3 dsRNAs, C3 antisense polynucleotides, and / or C3 sense polynucleotides, such as, but not limited to, replacement of the sugar and intemucleosidic linkages (i.e., the backbone) of the nucleotide units with novel groups. In such embodiments, the base units are maintained for hybridization with the appropriate C3 nucleic acid target. One such oligomeric compound, an RNA mimetic, which has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by an amide containing backbone, in particular an amino-ethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to the nitrogen heteroatoms of the amide portions of the backbone. Methods of making RNA mimetics are routine practice in the art, and such methods can be used to make certain modified C3 dsRNA reagents of the application.

[0165] Some embodiments of the application include RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones, in particular -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [known as a methylene(methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-]. Methods of making RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones are routine practice in the art, and such methods can be used to make certain modified C3 dsRNA reagents, certain C3 antisense polynucleotides, and / or certain C3 sense polynucleotides of the application.

[0166] Modified RNAs can also contain one or more substituted sugar moieties. The C3 dsRNAs, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the application can comprise, in the 2' position of the sugar moiety, one of the following: OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl, alkenyl or alkynyl. Particularly favored substitutions are O-, S- or N-alkyl, preferably O-alkyl, and most preferably O-CH3, O-CH2-CH3, O-CH2-2-CH3, or O-CH2-3-CH3. 10 Alkyl or C2 to C 10 Alkenyl and alkynyl. Exemplary suitable modifications include: O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) nCH3)]2, wherein n and m are 1 to about 10. In other embodiments, the dsRNA includes one of the following at the 2' position: C1to C 10 lower alkyl, substituted lower alkyl, alkylaryl, arylalkyl, O-alkylaryl or O-arylalkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino; substituted silyl, an RNA cleaving agent, a reporter molecule, an intercalator; a group for improving the pharmacokinetic properties of C3 dsRNA agents; or a group for improving the pharmacodynamic properties of C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides, and other substituents having similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-0-CH2CH2OCH3, also 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a 0(CH2)20N(CH2)2 group, also known as 2'-DMAOE, as described in the Examples below; and 2'-dimethylaminooxyethoxy (also known in the art as 2'-0-dimethylaminooxyethoxy or 2'-DMAEOE), i.e., 2'-0-CH2-0-CH2-N(CH2)2. Methods of making such modified RNAs are routine practice in the art, and such methods can be used to make certain modified C3 dsRNA agents of the application.

[0167] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'- OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of a C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide of the application, particularly the 3' terminal nucleotide or the 5' terminal nucleotide of the sugar of the 3' or 5' terminal nucleotide of the C3 dsRNA, C3 antisense polynucleotide, or C3 sense polynucleotide, as well as the 3' position of the sugar of the 3' terminal nucleotide or the 5' position of the sugar of the 5' terminal nucleotide of a 2'-5' linked C3 dsRNA, C3 antisense polynucleotide, or C3 sense polynucleotide. The C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide can also have sugar mimetics such as a cyclobutyl moiety in place of the furanose ring of a pentose sugar. Methods of making modified RNAs (e.g., the methods described) are routine practice in the art, and such methods can be used to make certain modified C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the application.

[0168] In some embodiments, the C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides can include nucleobase (often referred to simply as "base" in the art) modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (particularly 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional nucleobases which can be incorporated in certain embodiments of the C3 dsRNA agents of the application are known in the art, see, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.L, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B., Ed., CRC Press, 1993. Methods of preparing dsRNAs, C3 antisense strand polynucleotides, and / or C3 sense strand polynucleotides comprising nucleobase modifications and / or substitutions, such as those described herein, are routine practice in the art, and such methods can be used to prepare certain modified C3 dsRNA agents, C3 sense polynucleotides, and / or C3 antisense polynucleotides of the application.

[0169] In certain embodiments, the C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides comprise RNA modified to include one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides having a modified ribose moiety that includes an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose into the 3 '-endo conformation. The addition of locked nucleic acids to the C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the application can increase stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1): 439-447; Mook, O R. et al., (2007) Mol Can Ther 6(3): 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12): 3185-3193). Methods of making dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides comprising locked nucleic acids are routine practice in the art, and such methods can be used to make certain modified C3 dsRNA agents of the application.

[0170] In certain embodiments, the C3 dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides comprise at least one modified nucleotide, wherein the at least one modified nucleotide comprises: a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2'3'-seco nucleotide mimic, a locked nucleotide, a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, and a 3'-OMe nucleotide, a nucleotide comprising a 5'-phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidate, or a nucleotide comprising a non-natural base. In some embodiments, the C3 dsRNA compounds comprise an E- vinylphosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0171] In certain embodiments, the 3' and 5' ends of the C3 dsRNA compound, the sense polynucleotide, and / or the 3' end of the antisense polynucleotide comprise at least one modified nucleotide, wherein the at least one modified nucleotide comprises: an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide. It is known to those skilled in the art that inclusion of abasic or inverted abasic nucleotides at the ends of an oligonucleotide can enhance stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31(11): 2705-2716. doi: 10.1093 / nar / gkg393). In some embodiments, the C3 dsRNA compound comprises one or more inverted abasic residues (invab) at the 3' end or the 5' end, or both the 3' end and the 5' end. Exemplary inverted abasic residues (invab) include, but are not limited to, the following:

[0172]

[0173] In certain embodiments, the 3' and 5' ends of the C3 dsRNA compound, the sense polynucleotide, and / or the 3' end of the antisense polynucleotide comprise at least one modified nucleotide, wherein the at least one modified nucleotide comprises: an isomannide nucleotide or a stereoisomer of the isomannide nucleotide. Particular examples of isomannide nucleotides or stereoisomers of the isomannide nucleotide include, but are not limited to, the following:

[0174]

[0175]

[0176] wherein the phrase

[0177] each "Olig" independently represents a polynucleotide moiety. Exemplary isomannide residues (imann) include, but are not limited to, the following:

[0178] not limited to the following:

[0179] or

[0180] In certain embodiments, the isomannide nucleotide can be further conjugated to one or more targeting groups or delivery molecules, such as a GalNAc moiety.

[0181] In certain embodiments, the C3 dsRNA compound comprises at least one modified nucleotide, wherein the at least one modified nucleotide comprises an unlocked nucleic acid nucleotide (UNA) or / and a glycol nucleic acid nucleotide (GNA). As known to those skilled in the art, UNA and GNA are thermally labile chemical modifications that can significantly improve off-target properties of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018; 9(1): 723. doi: 10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6: 862-70).

[0182] Another modification that can be included in the RNA of certain C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of embodiments of the application includes chemically linking one or more ligands, moieties, or conjugates to the RNA to enhance one or more properties of the C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide, respectively. Non-limiting examples of properties that can be enhanced are: C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide activity, cellular distribution, C3 dsRNA agent delivery, C3 dsRNA agent pharmacokinetic properties, and C3 dsRNA agent cellular uptake. In some embodiments of the application, the C3 dsRNA agent comprises one or more targeting groups or linking groups, which in certain C3 dsRNA agent embodiments of the application are conjugated to the sense strand. Non-limiting examples of targeting groups are compounds comprising N-acetylgalactosamine (GalNAc). The terms "targeting group," "targeting agent," "linking agent," "targeting compound," "delivery molecule," "delivery compound," and "targeting ligand" are used interchangeably herein. In certain embodiments of the application, the C3 dsRNA agent comprises a targeting compound conjugated to the 5' end of the sense strand. In certain embodiments of the application, the C3 dsRNA agent comprises a targeting compound conjugated to the 3' end of the sense strand. In some embodiments of the application, the C3 dsRNA agent comprises a targeting group comprising GalNAc. In certain embodiments of the application, the C3 dsRNA agent does not comprise a targeting compound conjugated to one or both of the 3' end and 5' end of the sense strand. In certain embodiments of the application, the C3 dsRNA agent does not comprise a GalNAc-containing targeting compound conjugated to one or both of the 5'-end and 3'-end of the sense strand.

[0183] Other targeting agents and linkers are well known in the art, for example, targeting agents and linkers that can be used in certain embodiments of the application include, but are not limited to, lipid moieties, such as cholesteryl moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060), sulfides, such as berl-S-trenphtol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3: 2765-2770), sulfochol (Oberhauser et al., Nucl. Acids Res., 1992, 20: 533-538), fatty chains, such as dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54), phospholipids, such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphocholine (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14: 969-973) or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654), palmitoyl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237) or octadecylamine or hexylamino-carbonyl oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937).

[0184] Certain embodiments of compositions comprising C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides can comprise a ligand that alters the distribution, targeting, etc. of the C3 dsRNA agent. In some embodiments of compositions comprising a C3 dsRNA agent of the application, the ligand increases the affinity for a selected target (e.g., a molecule, a cell or cell type, a compartment, e.g., a cellular or organ compartment, a tissue, an organ, or a region of the body) compared to the species in the absence of such a ligand. Ligands useful in compositions and / or methods of the application can be naturally occurring substances, e.g., proteins (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or globulin), carbohydrates (e.g., dextran, amylopectin, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. Ligands can also be recombinant or synthetic molecules, e.g., synthetic polymers, e.g., synthetic polyamino acids or polyamines. Examples of polyamino acids are polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazene. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimeric polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helical peptides.

[0185] Ligands comprised in compositions and / or methods of the application can comprise a targeting group, non-limiting examples of which are cell or tissue targeting agents, e.g., lectins, glycoproteins, lipids, or proteins, e.g., antibodies that bind to specific cell types such as kidney cells or liver cells. Targeting groups can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acid, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimetic.

[0186] Other examples of ligands include dyes, intercalators (e.g., acridines), cross-linkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine); artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl, palmitic acid, myristic acid, 03-(oleoyl)glycholic acid, 03-(oleoyl)cholestic acid, dimethoxytrityl, or phenoxazine, and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphates, amines, thiols, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabels, enzymes, haptens (e.g., biotin), transport / absorption facilitators (e.g., aspirin, vitamin E, folate), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu 3+ complexes), dinitrophenyl, HRP, or AP.

[0187] The ligand included in the compositions and / or methods of the application can be a protein, such as a glycoprotein or a peptide, such as a molecule having a specific affinity for a co-ligand, or an antibody, such as an antibody that binds to a specific cell type (e.g., a cancer cell, an endothelial cell, a cardiac cell, or a bone cell). The ligand useful in embodiments of the compositions and / or methods of the application can be a hormone or a hormone receptor. The ligand useful in embodiments of the compositions and / or methods of the application can be a lipid, a lectin, a carbohydrate, a vitamin, a co-factor, a multivalent lactose, a multivalent galactose, N-acetylgalactosamine, N-acetylglucosamine multivalent mannose, or multivalent fucose. The ligand useful in embodiments of the compositions and / or methods of the application can be a substance capable of increasing the entry of a C3 dsRNA agent into a cell, such as by disrupting the cytoskeleton of the cell, such as by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell. Non-limiting examples of agents of this type are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0188] In certain embodiments, the ligand to which the C3 dsRNA agent is linked acts as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the application include, but are not limited to, lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binding agents, PEG, vitamins, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerols, diacyl glycerols, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind serum proteins, and the like. It is also known that oligonucleotides comprising a large number of phosphorothioate linkages can bind serum proteins, and thus short oligonucleotides comprising a plurality of phosphorothioate linkages in the backbone (e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases) can also be used as ligands in the compositions and / or methods of the application.

[0189] C3 dsRNA agent compositions

[0190] In some embodiments of the application, a C3 dsRNA agent is present in a composition. The compositions of the application can include one or more C3 dsRNA agents, and optionally one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, and the like. Non-limiting examples of targeting agents that can be useful according to some embodiments of the methods of the application are targeting agents that direct the C3 dsRNA agents of the application to the cells to be treated and / or to the target within the cells to be treated. The choice of targeting agent will depend on factors including the nature of the C3 -related disease or disorder, and the cell type being targeted. In non-limiting examples, in some embodiments of the application, it can be desirable to direct the C3 dsRNA agent to liver cells and / or to the target within liver cells. It will be appreciated that in some embodiments of the methods of the application, the therapeutic agent includes a C3 dsRNA agent, with only a delivery agent, e.g., a delivery agent comprising N-acetylgalactosamine (GalNAc), without any additional elements. For example, in some aspects of the application, a C3 dsRNA agent can be linked to a delivery compound comprising GalNAc, and included in a composition comprising a pharmaceutically acceptable carrier, and administered to a cell or subject without any detectable label or targeting agent, etc., linked to the C3 dsRNA agent.

[0191] Where the C3 dsRNA agents of the present application are administered with and / or attached to one or more delivery agents, targeting agents, labeling agents, and the like, the skilled artisan is aware of and can select and use appropriate agents for use in the methods of the present application. Labeling agents can be used in certain methods of the present application to determine the location of the C3 dsRNA agents in cells and tissues, and can be used to determine the cellular, tissue, or organ location of a therapeutic composition comprising a C3 dsRNA agent that has been administered in a method of the present application. Means of attaching and using labeling agents such as enzyme labels, dyes, radioactive labels, and the like are well known in the art. It will be appreciated that in some embodiments of the compositions and methods of the present application, a labeling agent is attached to one or both of the sense and antisense polynucleotides comprised in a C3 dsRNA agent. Delivery of C3 dsRNA agents and C3 antisense polynucleotide agents

[0192] Certain embodiments of the methods of the present application include delivering a C3 dsRNA agent to a cell. As used herein, the term "delivering" refers to facilitating or affecting cellular uptake or absorption. Absorption or uptake of a C3 dsRNA agent can occur by independent diffusion or active cellular processes, or by use of a delivery agent, targeting agent, and the like that can be associated with the C3 dsRNA agents of the present application. Delivery modalities suitable for use in the methods of the present application include, but are not limited to, in vivo delivery, in which a C3 dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the present application, a C3 dsRNA agent is attached to a delivery agent.

[0193] Non-limiting examples of methods that can be used to deliver a C3 dsRNA agent to a cell, tissue, and / or subject include: C3 dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents to treat various diseases and conditions, such as but not limited to: liver disease, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, and the like. Details of various delivery methods can be found in the following publications: Nikam, R.R. & K.R. Gore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018; Springer A.D. & S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1; 28(3): 109-118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, J.K. et al., (2014) J. Am. Chem. Soc. 136: 16958-16961, the contents of which are incorporated herein by reference.

[0194] Some embodiments of the present invention include the delivery of the C3 dsRNA agent of the present invention to cells, tissues, and / or subjects using lipid nanoparticles (LNPs). LNPs are commonly used for in vivo delivery of C3 dsRNA agents, including therapeutic C3 dsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the C3 RNA agent is increased when delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNP comprises a cationic LNP loaded with one or more of the C3 RNAi molecules of the present invention. When an LNP containing C3 RNAi molecules is administered to a subject, the LNP and its attached C3 RNAi molecules are taken up by cells via endocytosis, and their presence leads to the release of RNAi-triggered molecules, thereby mediating RNAi.

[0195] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the C3 dsRNA agent of the present invention to cells, tissues, and / or subjects is a drug containing GalNAc, which is linked to the C3 dsRNA agent of the present invention and delivers the C3 dsRNA agent to cells, tissues, and / or subjects. Examples of additional delivery agents containing GalNAc that can be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT application: WO2020191183A1 (into the entirety of which is incorporated herein). Non-limiting examples of GalNAc targeting ligands that can be used in the compositions and methods of the present invention to deliver the C3 dsRNA agent to cells are targeting ligand clusters. Examples of targeting ligand clusters presented herein are referred to as: GalNAc ligands having a phosphodiester linkage (GLO) and GalNAc ligands having a thiophosphate linkage (GLS). The term "GLX-n" can be used here to indicate that the linked GalNAc-containing compound is one of the following compounds: GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO- 1. Any one of GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, wherein the structure of each compound is shown below, wherein the attachment position of the GalNAc targeting ligand to the RNAi agent of the present invention is on the far right of each ligand (as shown below). (Shown). It should be understood that any RNAi and dsRNA molecule of the present invention can be linked to GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, the structures of GLO-1 to GLO-16 and GLS-1* to GLS-16* are shown below.

[0196]

[0197]

[0198]

[0199]

[0200] In some embodiments, the above-mentioned isomannitol nucleotides may be further conjugated to one or more GalNAc targeting ligands. Specific examples of isomannitol nucleotides conjugated to GalNAc targeting ligands include, but are not limited to:

[0201] The phrase “olig” refers to each polynucleotide portion independently.

[0202] In some embodiments of the invention, in vivo delivery can also be performed using β-glucan delivery systems, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entirety. C3 RNAi agents can also be introduced into cells in vitro using methods known in the art, such as electroporation and lipid transfection. In some embodiments of the methods of the invention, C3 dsRNA is delivered without a target agent. These RNAs can be delivered as “naked” RNA molecules. As a non-limiting example, the C3 dsRNA of the invention can be administered to a subject in the form of a pharmaceutical composition comprising an RNAi agent but not a target agent (e.g., a GalNAc targeting compound) to treat the subject’s C3-related disease or condition (e.g., cardiovascular disease).

[0203] In addition to certain delivery methods described herein, it should be understood that RNAi delivery methods (such as, but not limited to, those described herein and those used in the art) may be used in conjunction with embodiments of the C3 RNAi agents and treatment methods described herein.

[0204] The C3 dsRNA agents of the present invention can be administered to subjects in a quantity and manner that effectively reduces the level and activity of C3 peptides in cells and / or subjects. In some embodiments of the method of the present invention, one or more C3 dsRNA agents are administered to cells and / or subjects to treat diseases or conditions associated with C3 expression and activity. In some embodiments, the method of the present invention includes administering one or more C3 dsRNA agents to subjects requiring such treatment to reduce diseases or conditions associated with C3 expression in the subjects. The C3 dsRNA agents or C3 antisense polynucleotide agents of the present invention can be administered to reduce C3 expression and / or activity in one or more cells in vitro, ex vivo, and in vivo.

[0205] In some embodiments of the invention, the level of C3 peptides in cells is reduced, thereby decreasing their activity, by delivering (e.g., introducing) a C3 dsRNA agent or a C3 antisense polynucleotide agent into cells. Targeting agents and methods can be used to facilitate the delivery of C3 dsRNA agents or C3 antisense polynucleotide agents to specific cell types, cell subtypes, organs, spatial regions, and / or intracellular subcellular regions within a subject. In some methods of the invention, the C3 dsRNA agent may be administered alone or in combination with one or more additional C3 dsRNA agents. In some embodiments, two, three, four, or more independently selected C3 dsRNA agents are administered to the subject.

[0206] In some embodiments of the invention, the C3 dsRNA agent is administered to a subject in conjunction with one or more additional treatment regimens for treating C3-related diseases or conditions. Non-limiting examples of additional treatment regimens include: administration of one or more of the C3 antisense polynucleotides of the invention, administration of a non-C3 dsRNA therapeutic agent, and behavioral modification. The additional treatment regimens may be administered before, simultaneously with, and after the administration of the C3 dsRNA agent of the invention at one or more times. It should be understood that “simultaneously” as used herein means within 5 minutes, 10 minutes, 30 minutes, 45 minutes, and 60 minutes of time zero, where “time zero” is the time at which the C3 dsRNA agent of the invention is administered to the subject. Non-limiting examples of non-C3 dsRNA therapeutics include: C5 inhibitors, such as anti-complement component C5 antibodies or their antigen-binding fragments (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918)) or C5 peptide inhibitors (e.g., zilucoplan). Eculizumab is a humanized monoclonal IgG2 / 4, kappa light chain antibody that binds specifically to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the production of the terminal complement complex C5b-9. Ravulizumab-cwvz is a humanized monoclonal IgG2 / 4 antibody that binds specifically to complement component C5 with high affinity and inhibits the cleavage of C5 into C5a and C5b, thereby inhibiting the production of the terminal complement complex C5b-9. Pozelimab (also known as H4H12166P, described in US20170355757) is a fully human IgG4 monoclonal antibody designed to block complement factor C5. Zilucoplan is a synthetic macrocyclic peptide that binds to complement component 5 (C5) with sub-nanomolar affinity and allosterically inhibits its cleavage into C5a and C5b upon activation of the classical, alternative, or lectin pathway. Preferably, the additional therapeutic agent is a C3 peptide inhibitor or an analogue thereof. In one embodiment, the C3 peptide inhibitor is compressatine. Compressatine is a cyclic decacyclic peptide with potent and selective C3 inhibitory activity. These and other therapeutic agents and behavioral modifiers are known in the art for treating C3-related diseases or conditions in subjects and can be administered to subjects in combination with the administration of one or more C3 dsRNA agents of the present invention to treat C3-related diseases or conditions. The C3 dsRNA agent of the present invention, when administered to cells or subjects to treat C3-related diseases or conditions, can act synergistically with one or more other therapeutic agents or activities and enhance the effectiveness of one or more therapeutic agents or activities and / or enhance the effectiveness of the C3 dsRNA agent in treating C3-related diseases or conditions.

[0207] The treatment methods of the present invention include the administration of C3 dsRNA agents, which can be used before the onset of and / or while the C3-related disease or condition is present, including the early, middle, and late stages of the disease or condition, and all times before and after these stages. The methods of the present invention can also be used to treat subjects who have previously been treated with one or more other therapeutic agents and / or treatment activities for the C3-related disease or condition, where such therapeutic agents and / or treatment activities have been unsuccessful, have a low success rate, and / or are no longer successful in treating the subject's C3-related disease or condition.

[0208] vector-encoded dsRNA

[0209] In some embodiments of the invention, a vector can be used to deliver the C3 dsRNA reagent into cells. The C3 dsRNA reagent transcription unit may be contained in a DNA or RNA vector. The preparation and use of vectors encoding such transgenes for delivering sequences into cells and / or subjects are well known in the art. Vectors that result in transient expression of C3 dsRNA may be used in the methods of the invention, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 hours or more, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more. The length of transient expression may be determined using conventional methods based on factors such as, but not limited to, the selected specific vector construct and target cells and / or tissues. Such transgenes may be introduced as linear constructs, circular plasmids, or viral vectors, which may be integrating or non-integrating vectors. Transgenes may also be constructed to be inherited as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0210] The single-stranded or multi-stranded C3 dsRNA agent can be transcribed from a promoter on an expression vector. When expressing two separate strands to produce, for example, dsRNA, two separate expression vectors can be co-introduced into the cell using methods such as transfection or infection. In some embodiments, each separate strand of the C3 dsRNA agent of the present invention can be transcribed from a promoter contained on the same expression vector. In some embodiments of the present invention, the C3 dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, such that the C3 dsRNA agent has a stem-loop structure.

[0211] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. The expression vectors useful in the embodiments of the present invention are compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from many commercial sources. Delivery of the C3 dsRNA expression vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells removed from the subject and then reintroduced into the subject, or by any other means that allows for the introduction of the desired target cells.

[0212] Viral vector systems that may be included in embodiments of this method include, but are not limited to: (a) adenovirus vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) piconemavirus vectors; (i) poxvirus vectors, such as orthopoxvirus vectors or fowlpoxvirus vectors, such as canarypoxvirus vectors or chickenpoxvirus vectors; and (j) helper-dependent or enterovirus-free adenoviruses. Constructs for recombinant expression of C3 dsRNA agents may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. The use of viral vector systems, promoters, and enhancers, etc., is conventional in the art and can be used in conjunction with the methods and compositions described herein.

[0213] Some embodiments of the present invention include the delivery of C3 dsRNA agents into cells using a viral vector. Various adenovirus-based delivery systems are conventionally used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that can be used in the methods of the present invention include: AAV vectors, poxviruses (e.g., vaccinia virus), modified ankara virus (MVA), NYVAC, and fowlpox (e.g., chickenpox or canarypox).

[0214] Some embodiments of the present invention include a method of delivering a C3 dsRNA agent into cells using a vector, and such a vector may be located in a pharmaceutically acceptable carrier that may, but does not necessarily, include a sustained-release matrix into which a gene delivery vector is embedded. In some embodiments, a vector for delivering C3 dsRNA can be generated from recombinant cells, and the pharmaceutical compositions of the present invention may include one or more cells that generate a C3 dsRNA delivery system.

[0215] Pharmaceutical compositions of C3 dsRNA or ssRNA drugs

[0216] Some embodiments of the present invention include pharmaceutical compositions containing a C3 dsRNA agent or a C3 antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing a C3 dsRNA agent or a C3 antisense polynucleotide agent can be used in the methods of the present invention to reduce C3 gene expression and C3 activity in cells, and can be used to treat C3-related diseases or conditions. Such pharmaceutical compositions can be formulated according to the route of administration. Non-limiting examples of formulations for delivery methods are: formulations for subcutaneous delivery, formulations for systemic administration via parenteral delivery, formulations for intravenous (IV) delivery, formulations for intrathecal delivery, formulations for direct delivery to the brain, etc. Administration of the pharmaceutical compositions of the present invention to deliver a C3 dsRNA agent or a C3 antisense polynucleotide agent into cells can be performed in one or more ways, such as: topically (e.g., via a transdermal patch), pulmonaryly, for example, by inhalation or blowing in powder or aerosol, including via a nebulizer; intratracheally, intranasally, epidermally and transdermally, orally or parenterally. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous, for example, via an implanted device; or intracranial, for example, via intraparenchymal, intrathecal, or intraventricular administration. C3 dsRNA agents or C3 antisense polynucleotide agents may also be delivered directly to target tissues, such as the liver, kidneys, etc. It should be understood that "delivery of C3 dsRNA agents" or "delivery of C3 antisense polynucleotide agents" into cells includes, respectively, the direct delivery of C3 dsRNA agents or C3 antisense polynucleotide agents and the expression of C3 dsRNA agents in cells from a coding vector delivered to the cells, or the presence of C3 dsRNA or C3 antisense polynucleotide agents in cells by any suitable means. The preparation and use of formulations, as well as the means of delivering repressive RNA, are well known and routinely used in the art.

[0217] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier used for administering the therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. This term explicitly excludes cell culture media. For orally administered pharmaceuticals, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginate are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay gastrointestinal absorption. Pharmaceutical agents contained in pharmaceutical formulations will be further described below.

[0218] As used herein, terms such as “pharmacologically effective amount,” “therapeuticly effective amount,” and “effective amount” refer to the amount of the C3dsRNA agent or C3 antisense polynucleotide agent of the present invention that produces the intended pharmacological, therapeutic, or preventative outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective amount of a drug used to treat that disease or condition is the amount required to reduce that parameter by at least 10%. For example, a therapeutically effective amount of a C3dsRNA agent or C3 antisense polynucleotide agent can reduce C3 peptide levels by at least 10%.

[0219] Effective amount

[0220] The method of the present invention includes, in some aspects, contacting cells with an effective amount of a C3 dsRNA agent or a C3 antisense polynucleotide agent to reduce C3 gene expression in the contacted cells. Some embodiments of the method of the present invention include administering an effective amount of a C3 dsRNA agent or a C3 antisense polynucleotide agent to a subject to reduce C3 gene expression in the subject and treat the subject with a C3-related disease or condition. An “effective amount” for reducing C3 expression and / or treating a C3-related disease or condition is an amount required or sufficient to achieve the desired biological effect. For example, an effective amount of a C3 dsRNA agent or a C3 antisense polynucleotide agent for treating a C3-related disease or condition may be an amount required to (i) slow or stop the progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the present invention, an effective amount is the amount of C3 dsRNA agent or C3 antisense polynucleotide agent that, when administered to a subject requiring treatment for a C3-related disease or condition, results in a therapeutic response of prevention and / or treatment of the disease or condition. According to some aspects of the invention, an effective amount is the amount by which the C3 dsRNA reagent or C3 antisense polynucleotide reagent of the invention, when combined or co-administered with another therapeutic treatment for a C3-related disease or condition, results in a therapeutic response that prevents and / or treats that disease or condition. In some embodiments of the invention, the biological effect of treating a subject with the C3 dsRNA reagent or C3 antisense polynucleotide reagent of the invention can be the improvement and / or complete elimination of symptoms caused by a C3-related disease or condition. In some embodiments of the invention, the biological effect is the complete elimination of a C3-related disease or condition, for example, demonstrated by a diagnostic test indicating that the subject has no C3-related disease or condition. Non-limiting examples of detectable physiological symptoms include a reduction in lipid accumulation in the liver of a subject after administration of the reagent of the invention. Other art-known methods for assessing the status of a C3-related disease or condition can be used to determine the effect of the reagent and / or method of the invention on a C3-related disease or condition.

[0221] Typically, effective amounts of C3dsRNA reagents or C3 antisense polynucleotide reagents that reduce C3 peptide activity to levels sufficient to treat C3-related diseases or conditions are determined in clinical trials. Such clinical trials establish effective doses for test and control populations in blinded studies. In some embodiments, the effective amount is the amount that elicits the desired response, such as a reduction in the amount of C3-related disease or condition in cells, tissues, and / or subjects suffering from the disease or condition. Therefore, an effective amount of a C3dsRNA reagent or C3 antisense polynucleotide reagent used to treat C3-related diseases or conditions that can be treated by reducing C3 peptide activity can be an amount that, when administered, reduces the amount of C3 peptide activity in a subject to a level lower than that would be present in cells, tissues, and / or subjects without the administration of the C3 dsRNA reagent or C3 antisense polynucleotide. In some aspects of the invention, the level of C3 peptide activity and / or C3 gene expression present in cells, tissues, and / or subjects who have not been exposed to or administered the C3 dsRNA reagent or C3 antisense polynucleotide of the invention is referred to as a “control” amount. In some embodiments of the method of the present invention, the control dose for the subject is the subject's pre-treatment dose; in other words, the subject's level before administration of the C3 reagent can be the subject's control level and is used to compare it with its C3 peptide activity and / or C3 gene expression level after administration of siRNA to the subject. In the case of treating C3-related diseases or conditions, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in cells, tissues, and / or the subject. The reduction or elimination may be temporary or permanent. It should be understood that the status of C3-related diseases or conditions can be monitored using methods such as determining C3 peptide activity, C3 gene expression, symptom assessment, clinical testing, etc. In some aspects of the present invention, the desired response to treating C3-related diseases or conditions is to delay the onset of the disease or condition or even prevent the onset of the disease or condition.

[0222] The effective amount of compounds that reduce C3 peptide activity can also be determined by assessing the physiological effects of administration of a C3 dsRNA agent or C3 antisense polynucleotide agent on cells or subjects, such as a reduction in C3-related diseases or symptoms after administration. The efficacy of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention can be determined using subject assays and / or symptom monitoring, which can be administered in the form of the pharmaceutical compounds of the present invention, and to determine whether there is a response to treatment. In one non-limiting example, the related disease is paroxysmal nocturnal hemoglobinuria (PNH), a relatively rare disease comprising acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobinuria, bone marrow failure, and a tendency to thrombosis (prone to blood clot formation). Another non-limiting example is that, before and after treatment of subjects with the C3 dsRNA agent of the present invention, one or more liver function tests known in the art can be used to determine the subject's C3-related lipid imbalance status.

[0223] Some embodiments of the present invention include methods for determining the efficacy of the dsRNA agent or C3 antisense polynucleotide agent of the present invention administered to a subject, said methods being determined by assessing and / or monitoring one or more “physiological characteristics” of a C3-related disease or condition in the subject. Non-limiting examples of physiological characteristics of a C3-related disease or condition are C3 mRNA levels and C3 protein levels. Standard methods for determining such physiological characteristics are known in the art, including but not limited to blood tests, imaging studies, physical examinations, etc.

[0224] It should be understood that the amount of C3 dsRNA agent or C3 antisense polynucleotide agent administered to the subject may be adjusted, at least in part, based on the results of measurements of the subject's disease and / or condition status and / or physiological characteristics. The therapeutic dose can be changed, for example, by altering the composition of the C3 dsRNA agent or C3 antisense polynucleotide agent administered separately, by changing the route of administration, by changing the time of administration, etc., to increase or decrease the amount of C3 dsRNA agent or C3 antisense polynucleotide agent. The effective amount of C3 dsRNA agent or C3 antisense polynucleotide agent will vary depending on the specific condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of treatment, the nature of any co-treatments, the specific route of administration, and other factors within the knowledge and expertise of the healthcare professional. For example, the effective amount may depend on the desired level of C3 polypeptide activity and / or C3 gene expression effective for treating C3-related diseases or conditions. Those skilled in the art can determine the effective amount of a specific C3 dsRNA agent or C3 antisense polynucleotide agent used in the methods of the present invention empirically without excessive experimentation. Based on the teachings provided herein, effective prophylactic or therapeutic treatment regimens can be planned to effectively treat specific subjects by selecting from a variety of C3 dsRNA or C3 antisense polynucleotide reagents of the present invention and weighing factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred route of administration. As used in embodiments of the present invention, the effective amount of the C3 dsRNA or C3 antisense polynucleotide reagent of the present invention can be the amount that produces the desired biological effect in the cells upon contact with them.

[0225] It should be recognized that C3 gene silencing can be determined in any cell expressing C3, whether constitutively or through genome engineering, and by any suitable assay. In some embodiments of the invention, by administration of the C3 dsRNA agent of the invention, C3 gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the invention, by administration of the C3 dsRNA agent of the invention, C3 gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.

[0226] Dosage

[0227] The C3 dsRNA agent and the C3 antisense polynucleotide agent are delivered in the pharmaceutical composition at a dose sufficient to inhibit C3 gene expression. In some embodiments of the invention, the dose of the C3 dsRNA agent or the C3 antisense polynucleotide agent is in the range of 0.01 to 200.0 mg / kg body weight per day for the recipient, typically in the range of 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, and 4 to 15 mg / kg body weight per day (inclusive). For example, C3 The single-dose dosage of dsRNA or C3 antisense polynucleotide agents can be approximately: 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, etc. kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5. 5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11m g / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / k g, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg, to 50mg / kg body weight. .

[0228] Various factors can be considered when determining the dosage and timing of administration of the C3 dsRNA agent of the present invention. The absolute amount of the C3 dsRNA agent or C3 antisense polynucleotide agent administered will depend on various factors, including co-treatment, dose number, and individual subject parameters, including age, physical condition, body size, and weight. These are factors well known to those skilled in the art and can be resolved with routine experiments. In some embodiments, a maximum dose may be used, i.e., the highest safe dose based on reasonable medical judgment.

[0229] In some embodiments, the method of the present invention may include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of a C3 dsRNA agent or a C3 antisense polynucleotide agent. In some cases, the pharmaceutical compound (e.g., a C3 dsRNA agent or a C3 antisense polynucleotide agent) may be administered to the subject at least daily, every other day, weekly, every other week, monthly, etc. The dose may be administered once daily or multiple times daily, for example, 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the C3 dsRNA agent or C3 antisense polynucleotide agent may be administered as two, three or more sub-dose administrations at appropriate intervals throughout the day, or even using continuous infusion or delivery via a controlled-release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention may be administered to the subject once or more daily, once or more weekly, once or more monthly, or once or more annually.

[0230] In some aspects, the methods of the present invention include administering a pharmaceutical compound alone; in combination with one or more other C3 dsRNA reagents or C3 antisense polynucleotide reagents; and / or in combination with other pharmaceutical therapies or treatment activities or regimens administered to a subject suffering from a C3-related disease or condition. The pharmaceutical compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the present invention may be sterile and contains a quantity of a C3 dsRNA reagent or C3 antisense polynucleotide reagent that reduces the activity of the C3 polypeptide to a level sufficient to produce the desired response in a weight or volume unit suitable for administration to the subject. The dose of the pharmaceutical composition containing the C3 dsRNA reagent or C3 antisense polynucleotide reagent administered to the subject may be selected according to various parameters to reduce C3 protein activity, particularly based on the route of administration used and the subject's condition. Other factors include the required duration of treatment. If the subject's response at the initial dose is insufficient, a higher dose may be used (or the dose may be effectively increased via a different, more localized delivery route) within the limits of patient tolerance.

[0231] treat

[0232] The terms “C3-related diseases,” “C3-related diseases and conditions,” and “diseases and conditions caused and / or regulated by C3” as used in this article are intended to include any disease associated with the C3 gene or protein. Such diseases may be caused by, for example, overproduction of the C3 protein, mutations in the C3 gene, abnormal cleavage of the C3 protein, or abnormal interactions between C3 and other proteins or other endogenous or exogenous substances. Exemplary C3-related diseases include, but are not limited to: C3 glomerulonephropathy (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgAN), age-related macular degeneration (AMD), rheumatoid arthritis (RA), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), dysbiosis-related periodontitis, malaria-related anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative diseases.

[0233] In some aspects of the invention, the C3 dsRNA agent or C3 antisense polynucleotide agent of the invention is administered to the subject at one or more times before or after a C3-related disease or condition. In some aspects of the invention, the subject is at risk of developing or having a C3-related disease or condition. A subject at risk of developing a C3-related disease or condition is a subject with an increased probability of developing a C3-related disease or condition compared to a control risk level. In some embodiments of the invention, the risk level may be statistically significant compared to the control risk level. At-risk subjects may include, for example, subjects who are or will be subjects with pre-existing diseases and / or genetic abnormalities that make them more susceptible to developing a C3-related disease or condition than control subjects without pre-existing diseases or genetic abnormalities; subjects with a family and / or personal history of a C3-related disease or condition; and subjects who have previously received treatment for a C3-related disease or condition. It should be understood that a pre-existing disease and / or genetic abnormality that makes a subject more susceptible to C3-related diseases or conditions can be a disease or genetic abnormality that, when present, has previously been identified as having a higher likelihood of developing a C3-related disease or condition.

[0234] It should be understood that C3 dsRNA agents or C3 antisense polynucleotide agents can be administered to subjects based on their individual medical conditions. For example, healthcare providers may assess C3 levels measured in samples obtained from the subject and determine that it is desirable to reduce the subject's C3 levels by administering the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention. In this example, C3 levels can be considered a physiological characteristic of C3-related diseases even if the subject has not been diagnosed with one (e.g., the diseases disclosed herein). Healthcare providers may monitor changes in the subject's C3 levels as a measure of the efficacy of the administered C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention. In a non-limiting example, biological samples (e.g., blood or serum samples) may be obtained from the subject, and the subject's C3 levels may be determined in the samples. The C3 dsRNA agent or C3 antisense polynucleotide agent may be administered to the subject, and a blood sample may be obtained from the subject after administration, using the sample to determine the C3 level, and the result may be compared with the result determined in a sample taken before (before) administration. The decrease in C3 levels in the subjects' later samples compared to pre-treatment levels indicates that the administered C3 dsRNA or C3 antisense polynucleotide agent was effective in reducing the subjects' C3 levels.

[0235] Some embodiments of the present invention include adjusting treatment, including administering the dsRNA agent or C3 antisense polynucleotide agent of the present invention to a subject, based at least in part on an assessment of changes in one or more physiological characteristics of a C3-related disease or condition in the subject due to treatment. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or C3 antisense polynucleotide agent of the present invention on the subject can be determined and used to help adjust the amount of the dsRNA agent or C3 antisense polynucleotide agent of the present invention subsequently administered to the subject. In a non-limiting example, the dsRNA agent or C3 antisense polynucleotide agent of the present invention is administered to a subject, the subject's C3 level is measured after administration, and based at least in part on the measured level, the amount of the dsRNA agent or C3 antisense polynucleotide agent to be increased needs to be determined to increase the physiological effect of the administered agent, such as reducing or further reducing the subject's C3 level. In another non-limiting example, the subject is given the dsRNA agent or C3 antisense polynucleotide agent of the present invention, the subject's C3 level is measured after administration, and at least in part based on the measured level, a lower amount of the dsRNA agent or C3 antisense polynucleotide agent needs to be administered to the subject.

[0236] Therefore, some embodiments of the present invention include assessing changes in one or more physiological characteristics of a subject resulting from prior treatment in order to adjust the amount of the dsRNA agent or C3 antisense polynucleotide agent of the present invention subsequently administered to the subject. Some embodiments of the method of the present invention include 1, 2, 3, 4, 5, 6 or more physiological characterizations of C3-related diseases or conditions to assess and / or monitor the efficacy of the administered C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention, and optionally using these measurements to adjust one or more of the following: the dosage, administration regimen, and / or administration frequency of the dsRNA agent or C3 antisense polynucleotide agent of the present invention to treat the subject's C3-related disease or condition. In some embodiments of the method of the present invention, the desired result of administering an effective amount of the dsRNA agent or C3 antisense polynucleotide agent of the present invention to a subject is to reduce the subject's C3 mRNA level, the subject's C3 protein level, paroxysmal nocturnal hemoglobinuria (PNH), a relatively rare disease including acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, the physiological characteristics of hemoglobinuria, bone marrow failure, and thrombotic tendency (predisposition to thrombosis).

[0237] As used herein, when referring to a C3-related disease or condition, the terms “treatment” or “treated” or “being treated” may refer to preventive treatment that reduces the likelihood of a subject having a C3-related disease or condition, or to treatment performed after a subject has developed a C3-related disease or condition in order to eliminate or reduce the level of the C3-related disease or condition, prevent the C3-related disease or condition from becoming more severe (e.g., more serious), and / or slow the progression of the subject’s C3-related disease or condition compared to subjects who have not received treatment to reduce the subject’s C3 peptide activity.

[0238] Certain embodiments of the agents, compositions, and methods of the present invention can be used to inhibit C3 gene expression. The terms “inhibit,” “silence,” “reduce,” “downregulate,” and “knock down” used herein with respect to C3 gene expression refer to altering C3 gene expression, for example, by one or more of the following: when cells, cell populations, tissues, organs, or subjects are contacted (e.g., treated with) the C3 dsRNA reagent or the C3 antisense polynucleotide reagent of the present invention, wherein the levels of RNA transcribed from the gene, the levels of active C3 expressed, and the levels of C3 polypeptides, proteins, or protein subunits translated from mRNA in the cells, cell populations, tissues, organs, or subjects are reduced, compared to control levels of RNA transcribed from the C3 gene, active C3 expressed, or C3 translated from mRNA in the cells, cell populations, tissues, organs, or subjects. In some embodiments, the control level is the level in cells, tissues, organs, or subjects that have not been contacted with the C3 dsRNA reagent or the C3 antisense polynucleotide reagent (e.g., treated with it).

[0239] Application method

[0240] Various routes of administration for C3 dsRNA or C3 antisense polynucleotide agents can be used in the methods of the present invention. The specific route of administration chosen depends at least in part on the specific condition being treated and the dose required to achieve the therapeutic effect. Generally, the methods of the present invention can be implemented using any medically acceptable route of administration, i.e., any route that produces a level that effectively treats a C3-related disease or condition without causing clinically unacceptable adverse reactions. In some embodiments of the present invention, the C3 dsRNA or C3 antisense polynucleotide agent can be administered via oral, enteral, mucosal, subcutaneous, and / or parenteral routes. The term “parenteral” includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via a gastric tube), skin, vagina, rectum, sublingual, and inhalation. Delivery routes of the present invention can include intrathecal, intraventricular, or intracranial. In some embodiments of the present invention, the C3 dsRNA agent or C3 antisense polynucleotide agent can be placed in a sustained-release matrix and administered by placing the matrix in the subject. In some aspects of the invention, C3 dsRNA agents or C3 antisense polynucleotide agents can be delivered to subject cells using nanoparticles coated with delivery agents targeting specific cells or organelles. Various delivery means, methods, and agents are known in the art. Non-limiting examples of delivery methods and agents are also provided elsewhere herein. In some aspects of the invention, the term "delivery" in relation to C3 dsRNA agents or C3 antisense polynucleotide agents can refer to the administration of one or more "naked" C3 dsRNA agent or C3 antisense polynucleotide agent sequences to cells or a subject, and in other aspects of the invention, "delivery" refers to administration to cells or a subject via transfection, delivery to a subject of cells containing a C3 dsRNA agent or C3 antisense polynucleotide agent, delivery to cells and / or a subject of a vector encoding a C3 dsRNA agent or C3 antisense polynucleotide agent, etc. Delivery of C3 dsRNA agents or C3 antisense polynucleotide agents using transfection may include administration of a vector to cells and / or a subject.

[0241] In some methods of the present invention, one or more C3 dsRNA agents or C3 antisense polynucleotide agents may be administered in formulation form, which may be administered in a pharmaceutically acceptable solution form, typically containing pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the present invention, the C3 dsRNA agent or C3 antisense polynucleotide agent may be formulated together with another therapeutic agent for simultaneous administration. According to the methods of the present invention, the C3 dsRNA agent or C3 antisense polynucleotide agent may be administered in the form of a pharmaceutical composition. Typically, the pharmaceutical composition comprises a C3 dsRNA agent or C3 antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the effectiveness of the bioactivity of the active ingredient (e.g., the ability of the C3 dsRNA agent or C3 antisense polynucleotide agent to inhibit C3 gene expression in cells or a subject). Various methods of administration and delivery of dsRNA or C3 antisense polynucleotide agents for therapeutic purposes are known in the art and can be used in the methods of the present invention.

[0242] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in pharmaceuticals, salts should be pharmaceutically acceptable, but non-pharmaceuticalally acceptable salts may be conveniently used to prepare their pharmaceutically acceptable salts and are not excluded from the scope of this invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Furthermore, pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth salts, such as sodium, potassium, or calcium salts.

[0243] Some embodiments of the method of the present invention include direct administration of one or more C3 dsRNA agents or C3 antisense polynucleotide agents to tissues. In some embodiments, the tissue to which the compound is administered is a tissue in which C3-related diseases or conditions exist or may occur, a non-limiting example being the heart. Direct tissue administration can be achieved by direct injection or other means. Many orally delivered compounds naturally reach and pass through the liver and kidneys, and some embodiments of the treatment methods of the present invention include oral administration of one or more C3 dsRNA agents to a subject. C3 dsRNA agents or C3 antisense polynucleotide agents, whether administered alone or in combination with other therapeutic agents, can be administered once or in multiple doses. If administered multiple times, C3 dsRNA agents or C3 antisense polynucleotide agents can be administered via different routes. For example, although not intended to be limiting, the first (or first few) doses can be administered subcutaneously, and one or more additional doses can be administered orally and / or systemically.

[0244] For embodiments of the present invention requiring systemic administration of C3 dsRNA or C3 antisense polynucleotide agents, the C3 dsRNA or C3 antisense polynucleotide agents can be formulated for parenteral administration by injection, such as by bolus or continuous infusion. The injectable formulation can be in unit dose form, such as ampoules or multi-dose containers, with or without preservatives. The C3 dsRNA agent formulation (also referred to as a pharmaceutical composition) can be in the form of a suspension, solution, or emulsion in an oily or aqueous carrier, and can contain formulations such as suspending agents, stabilizers, and / or dispersants.

[0245] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral carriers include sodium chloride solutions, Ringer's glucose, glucose and sodium chloride, lactated Ringer's solutions, or non-volatile oils. Intravenous carriers include fluids and nutritional supplements, electrolyte supplements (such as Ringer's glucose-based supplements), etc. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases. Other forms of administration (such as intravenous administration) may have lower doses. If a subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or the dose may be increased effectively through different, more localized delivery routes). Multiple doses can be administered daily as needed to achieve appropriate systemic or local levels of one or more C3dsRNA agents or C3 antisense polynucleotide agents and to achieve an appropriate reduction in C3 protein activity.

[0246] In other embodiments, the method of the present invention includes using a delivery carrier, such as biocompatible microparticles, nanoparticles, or implants suitable for implantation into a recipient (e.g., a subject). Exemplary biodegradable implants that may be useful according to this method are described in PCT Publication No. WO95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for containing biomacromolecules.

[0247] In the methods of this invention, non-biodegradable and biodegradable polymer matrices can be used to deliver one or more C3 dsRNA agents or C3 antisense polynucleotide agents to a subject. In some embodiments, the matrix may be biodegradable. The matrix polymer may be a natural or synthetic polymer. The polymer can be selected based on the desired release time period, typically from a few hours to a year or longer. Typically, release times ranging from a few hours to three to twelve months can be used. The polymer may optionally be in the form of a hydrogel that can absorb up to about 90% of its weight in water, and may further optionally be crosslinked with multivalent ions or other polymers.

[0248] Generally, in some embodiments of the present invention, C3 dsRNA agents or C3 antisense polynucleotide agents can be delivered using bioerodible implants by diffusion or by degradation of a polymer matrix. Exemplary synthetic polymers for such uses are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver C3 dsRNA agents or C3 antisense polynucleotide agents using methods known in the art. Bioadhesive polymers such as bioerodible hydrogels (see H.S. W. H., C.P. Pathak and J.A. Hubell in Macromolecules, 1993, 26, 581-587, whose teachings are incorporated herein by reference) can also be used to deliver C3 dsRNA agents or C3 antisense polynucleotide agents to treat C3-related diseases or conditions. Other suitable delivery systems may include timed-release, delayed-release, or sustained-release delivery systems. Such systems avoid repeated administration of C3 dsRNA agents or C3 antisense polynucleotide agents, thereby increasing convenience for subjects and healthcare professionals. Many types of release delivery systems are available and are known to those skilled in the art. (See, for example: U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teachings of each patent are incorporated herein by reference). Furthermore, pump-based hardware delivery systems can be used, some of which are suitable for implantation.)

[0249] The use of long-release implants may be suitable for prophylactic treatment in subjects, as well as for subjects at risk of recurrent C3-related disease or condition. Long-release, as used herein, refers to an implant constructed and positioned to deliver therapeutic levels of C3 dsRNA or C3 antisense polynucleotide agents for a duration of at least 10, 20, 30, 60, 90 days, six months, one year, or longer. Long-release implants are well known to those skilled in the art and include some of the release systems described above.

[0250] Therapeutic formulations of C3 dsRNA or C3 antisense polynucleotide drugs can be prepared by mixing molecules or compounds of desired purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers, and stored in lyophilized or aqueous forms. [Remington's Pharmaceutical Sciences, Vol. 1] 21 [Version, (2006)]. Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the doses and concentrations used and include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethyl chloride; benzalkonium chloride, benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl parabens such as methyl or propyl parabens; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10). (1 residue) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as... Or polyethylene glycol (PEG).

[0251] Cells, subjects and controls

[0252] The methods of this invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some aspects of this invention, the subject is a human or vertebrate mammal, including but not limited to dogs, cats, horses, cattle, goats, mice, rats, and primates such as monkeys. Therefore, this invention can be used to treat C3-related diseases or conditions in human and non-human subjects. In some aspects of this invention, the subject can be a farm animal, zoo animal, domesticated animal, or non-domesticated animal, and the methods of this invention can be used in veterinary prevention and treatment programs. In some embodiments of this invention, the subject is a human, and the methods of this invention can be used in human prevention and treatment programs.

[0253] Non-limiting examples of subjects to whom this invention can be applied are subjects diagnosed with, suspected of having, or at risk of having a disease or condition associated with higher than expected C3 expression and / or activity, also referred to as “elevated C3 expression levels.” Non-limiting examples of diseases and conditions associated with higher than expected C3 expression and / or activity are described elsewhere herein. The methods of this invention can be applied to subjects diagnosed with a disease or condition associated with higher than expected C3 expression and / or activity at the time of treatment, or subjects considered at risk of having or developing a disease or condition associated with higher than expected C3 expression and / or activity. In some aspects of the invention, the disease or condition associated with higher than expected C3 expression and / or activity is an acute disease or condition, and in other aspects of the invention, the disease or condition associated with higher than expected C3 expression and / or activity is a chronic disease or condition.

[0254] In one non-limiting example, the C3 dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of developing statin-resistant hypercholesterolemia, a condition requiring reduction of C3 expression. The method of the present invention can be applied to subjects diagnosed with or considered to be at risk of developing or progressing to the disease or condition during treatment.

[0255] In another non-limiting example, the C3 dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of developing hyperlipidemia, a disease requiring reduction of C3 expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of developing or progressing to the disease or condition.

[0256] Cells to which the methods of this invention can be applied include in vitro, in vivo, and isolated cells. Cells may be present in the subject's body, in cultures, and / or suspensions, or in any other suitable state or condition. Cells to which the methods of this invention can be applied may be hepatocytes, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some aspects of this invention, cells to which the methods of this invention can be applied are healthy, normal cells, which are unknown to be diseased cells. In some embodiments of this invention, the cells to which the methods and compositions of this invention are applied are hepatocytes, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, and / or kidney cells. In some aspects of this invention, control cells are normal cells, but it should be understood that cells suffering from a disease or condition may also be used as control cells in certain circumstances, such as when comparing the results of treated cells suffering from a disease or condition with untreated cells suffering from the same disease or condition.

[0257] According to the method of the present invention, the level of C3 peptide activity can be determined and compared with a control level of C3 peptide activity. The control can be a predetermined value, which can take various forms. It can be a single cutoff value, such as the median or mean. It can be established based on comparison groups, such as a group with normal levels of C3 peptide and / or C3 peptide activity and a group with increased levels of C3 peptide and / or C3 peptide activity. Another non-limiting example of a comparison group can be a group with one or more symptoms or diagnoses of a C3-related disease or condition; a group without one or more symptoms or diagnoses of such disease or condition; a group of subjects treated with the siRNA of the present invention; or a group of subjects not treated with the siRNA of the present invention. Typically, the control can be based on seemingly healthy normal individuals or seemingly healthy cells of appropriate age. It should be understood that, in addition to predetermined values, the control according to the present invention can be a material sample tested in parallel with the experimental material. Examples include samples from a control population or control samples manufactured for simultaneous testing with the experimental sample. In some embodiments of the invention, the control may include cells or subjects that have not been exposed to or treated with the C3 dsRNA agent of the invention, and in this case, the control level of C3 peptide and / or C3 peptide activity may be compared with the level of C3 peptide and / or C3 peptide activity in cells or subjects exposed to the C3 dsRNA agent or C3 antisense polynucleotide agent of the invention.

[0258] In some embodiments of the invention, the C3 peptide level measured for a subject may be a control level, compared with the C3 peptide level measured for the same subject at different times. In a non-limiting example, the C3 level is measured in a biological sample obtained from a subject who has never received C3 treatment according to the invention. In some embodiments, the biological sample is a serum sample. The C3 peptide level measured in the sample obtained from the subject may serve as a baseline or control for the subject. In the treatment method of the invention, after administering one or more C3 dsRNA agents to a subject, one or more additional serum samples may be obtained from the subject, and the C3 peptide level in the subsequent samples may be compared with the subject's control / baseline level. This comparison can be used to assess the onset, progression, or remission of C3-related disease or condition in the subject. For example, a higher C3 peptide level in a baseline sample obtained from a subject than the level obtained from that subject after administering the C3 dsRNA agent or C3 antisense polynucleotide agent of the invention to the same subject indicates remission of the C3-related disease or condition and indicates the efficacy of the administered C3 dsRNA agent of the invention in treating the C3-related disease or condition.

[0259] In certain aspects of the invention, one or more values ​​of the C3 peptide and / or C3 peptide activity levels determined for a subject can be used as control values ​​and later compared among the same subject to assess changes in “baseline” C3 peptide activity. Therefore, when an initial level is used as a control level for that subject, the initial C3 peptide level and / or initial C3 peptide activity level can be used to demonstrate and / or determine the ability of the methods and compounds of the invention to reduce the level of C3 peptide and / or C3 peptide activity in the subject.

[0260] Using the method of the present invention, the C3 dsRNA agent and / or C3 antisense polynucleotide agent of the present invention can be administered to a subject. The efficacy of administration and treatment of the present invention can be assessed when the level of C3 peptide in a serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of C3 peptide in a serum sample obtained from the subject at a previous time point, or compared to the level of a non-contact control (e.g., the level of C3 peptide in a control serum sample). It should be understood that both the level of C3 peptide and the level of C3 peptide activity are related to the level of C3 gene expression. Some embodiments of the method of the present invention include administering an effective amount of the C3 dsRNA and / or C3 antisense agent of the present invention to the subject to inhibit C3 gene expression and thereby reduce the level of C3 peptide and the level of C3 peptide activity in the subject.

[0261] In certain embodiments of the invention, the presence, absence, and / or amount (also referred to herein as level) of the C3 peptide in a biological sample obtained from a subject is included. This determination can be used to evaluate the efficacy of the treatment methods of the invention. For example, the methods and compositions of the invention can be used to determine the level of the C3 peptide in a biological sample obtained from a subject previously treated with the C3 dsRNA agent and / or C3 antisense agent of the invention. A reduction of at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more in the C3 peptide level determined in a serum sample obtained from a treated subject compared to the pre-treatment C3 peptide level determined for the subject or compared to the level in a non-contact control biological sample indicates the level of efficacy of the treatment administered to the subject.

[0262] In some embodiments of the invention, the physiological characteristics of a C3-related disease or condition determined for a subject may be control assays compared with physiological characteristic assays of the same subject at different time points. In non-limiting examples, physiological characteristics include, for example, the subject's C3 mRNA level and C3 protein level. The C3 mRNA level (and / or other physiological characteristics of the C3 disease or condition) determined from samples obtained from the subject may be used as a baseline or control for the subject. In the treatment methods of the invention, after administering one or more C3 dsRNA agents to the subject, one or more additional serum samples may be obtained from the subject, and the C3 mRNA level and / or C3 protein level in the subsequent samples may be compared with the subject's control / baseline level and / or ratio, respectively. Such comparisons can be used to assess the onset, progression, or remission of the subject's C3-related disease or condition. For example, if the C3 mRNA level in a baseline sample obtained from a subject is higher than the C3 mRNA level measured in a sample obtained from the same subject after administration of the C3 dsRNA agent or C3 antisense polynucleotide agent of the present invention, it indicates the regression of C3-related diseases or conditions and demonstrates the efficacy of the administered C3 dsRNA agent of the present invention in treating C3-related diseases or conditions.

[0263] In certain aspects of the invention, one or more physiological characteristic values ​​of a C3-related disease or condition identified for a subject can be used as control values ​​to allow for subsequent comparison of the physiological characteristics of the same subject, thereby allowing assessment of changes in the subject's physiological characteristics from a "baseline" state. Thus, a subject may have and / or have identified initial physiological characteristics, and the methods and compounds of the invention can be used to reduce the C3 peptide and / or C3 peptide activity levels of a subject, wherein the initial physiological characteristic measurements serve as a control for that subject.

[0264] Using the method of the present invention, the C3 dsRNA agent and / or C3 antisense polynucleotide agent of the present invention can be administered to subjects in an effective amount to treat C3 diseases or conditions. The efficacy of the administration and treatment of the present invention can be assessed by determining changes in one or more physiological characteristics of the C3 disease or condition. In a non-limiting example, the C3 mRNA level in the serum sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-administration level in the serum sample obtained from the subject at a previous time point, or compared to the level in a non-contact control (e.g., the C3 mRNA level in a control serum sample). It should be understood that the subject's C3 mRNA level and C3 protein level are each correlated with the C3 gene expression level. Some embodiments of the method of the present invention include administering an effective amount of the C3 dsRNA and / or C3 antisense agent of the present invention to a subject to inhibit C3 gene expression and thereby reduce the subject's C3 mRNA level, C3 protein level, or otherwise positively influence the physiological characteristics of the subject's C3-related disease or condition.

[0265] Some embodiments of the present invention include determining the presence, absence, and / or alteration of physiological characteristics of C3-related diseases or conditions using methods such as, but not limited to: (1) assessing the physiological characteristics of one or more biological samples obtained from one or more subjects; (2) imaging the subjects (e.g., but not limited to, acquiring liver images); and (3) performing a physical examination on the subjects. This determination can be used to evaluate the effectiveness of the treatment methods of the present invention.

[0266] medicine box

[0267] The scope of this invention also includes kits containing one or more C3 dsRNA agents and / or C3 antisense polynucleotide agents and instructions for their use in the methods of this invention. The kits of this invention may include one or more C3 dsRNA agents, C3 sense polynucleotides, and C3 antisense polynucleotide agents, which can be used to treat C3-related diseases or conditions. Kits containing one or more C3 dsRNA agents, C3 sense polynucleotides, and C3 antisense polynucleotide agents can be prepared for use in the treatment methods of this invention. The components of the kits of this invention may be packaged in an aqueous medium or in lyophilized form. The kits of this invention may include a carrier divided into multiple or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, etc., and tightly confining them therein. A first container device or a series of container devices may contain one or more compounds, such as C3 dsRNA agents and / or C3 sense or antisense polynucleotide agents. The second container device or a series of container devices may contain targeting agents, labeling agents, delivery agents, etc., which may be included as part of C3 dsRNA agents and / or C3 antisense polynucleotides in embodiments of the treatment methods of the present invention for administration.

[0268] The kit of the present invention may also include instructions. The instructions are typically in written form and provide guidance on how to implement the treatment contained in the kit and on making decisions based on that treatment.

[0269] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. Those skilled in the art will understand that the present invention is applicable to a variety of compositions and methods. Example

[0270] Example 1.

[0271] Phosphamide compound 2

[0272]

[0273] DMTrCl (232 g, 684 mmol, 1.0 equivalence) in pyridine (400 mL) was added to a pyridine (600 mL) solution of isomannitol (100 g, 684 mmol, 1.0 equivalence) of compound A. The mixture was stirred at 25 °C for 12 h. LCMS showed that compound A was completely consumed and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL), extracted with dichloromethane (500 mL x 2), and the combined organic phases were washed with brine (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound B (150 g, yield 48.9%) as a yellow solid.

[0274] 1 H NMR: EC4783-404-P1B1_C (400MHz, DMSO-d6) δppm 7.46 (br d, J=7.63Hz, 2H) 7.28-7.37 (m, 6H) 7.19-7.25 (m, 1H) 6.90 (br d,J=7.88Hz,4H)4.70(d,J=6.50Hz,1H)3.99-4.09(m,6H)3.88-3.96(m,2H)3.83(br dd,J=7.82,6.94Hz,1H)3.74(s,6H)3.41(brt,J=8.13Hz,1H)3.05(t,J=8.44Hz,1H)2.85(br t,J=7.50Hz,1H).

[0275] Under a nitrogen atmosphere at 25 °C, 2H-tetrazole (0.45 M, 436 mL, 1.1 eq) was added dropwise to a DCM (800 mL) solution of compound B (80.0 g, 178 mmol, 1.0 eq), followed by a DCM (200 mL) solution of compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 eq). The reaction mixture was stirred at 25 °C for 1.0 h. LC-MS showed that compound B was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20 °C and poured into ice-cold saturated NaHCO3 (500 mL), extracted with DCM (500 mL x 3), and the combined organic layers were washed with saturated NaHCO3 / salt water at a ratio of 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated under vacuum (35 °C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound 2 (77 g, 119 mmol, yield 66.5%) as a white solid.

[0276] 1 H NMR: EC4783-423-P1B1_C (400MHz, DMSO-d6) δppm 7.22 (br d, J=7.50Hz, 2H) 7.05

[0277] -7.14(m,6H)6.96-7.02(m,1H)6.67(br dd,J=8.82,1.81Hz,4H)3.95-4.07(m,2H)3.73

[0278] -3.83(m,1H)3.62-3.72(m,2H)3.48-3.53(m,6H)3.27-3.37(m,3H)3.11(s,6H)2.82(td,J=8.54,2.31Hz,1H)2.47-2.63(m,3H)2.28(br d,J=1.63Hz,3H)0.82-1.00(m,13H).

[0279] Phosphamide compound 1

[0280]

[0281] Compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) dissolved in DCM (5.0 mL) under a N2 atmosphere at 0–5 °C. The mixture was stirred at 25 °C for 1.0 h. LC-MS showed that compound B was completely consumed, with several new peaks appearing on the LC-MS, and approximately 70.9% of the desired compound was detected. The resulting reaction mixture was cooled to -20 °C and poured into a cold (0–5 °C) saturated NaHCO3 (5.0 mL) solution. Extraction was performed with DCM (5.0 mL * 2). The combined organic layers were washed with cold (0–5 °C) saturated NaHCO3 / salt water at a ratio of 1:1 (5.0 mL / 5.0 mL), dried over Na2SO4, and concentrated under vacuum to obtain a residue (~5 mL). The residue was purified by column chromatography (alkaline Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to give compound 1 (280 mg, 471 μmol, yield 42.3%) as a white solid.

[0282] 1 H NMR: EC10615-49-P1N (400MHz, DMSO-d6) δppm 7.44 (br d, J=7.63Hz, 2H), 7.31 (br t,J=7.94Hz,6H),7.18-7.26(m,1H),6.89(brd,J=8.00Hz,4H),4.08-4.13(m,1H),3.95-4 .03(m,1H),3.84-3.93(m,1H),3.77-3.83(m,1H),3.74(s,6H),3.43-3.53(m,3H),3.38(br d,J=6.75Hz,1H),2.94-3.04(m,1H),2.70-2.85(m,1H),1.09-1.15(m,12H),1.07(br s,3H).

[0283] Other phosphoramides can be prepared according to the methods described herein and / or existing technologies (e.g., but not limited to US426,220 and WO02 / 36743).

[0284] Example 2. Preparation of a solid carrier containing the phosphoramidite monomer of the present invention

[0285]

[0286] Represents the macroporous amyl methyl polyethylene resin carrier portion

[0287] Under nitrogen protection, 19.50 kg of dichloromethane was added to a 50 L glass reactor. Stirring was started, and the temperature was controlled at 20–30 °C. DMTrimann (1.47 kg), triethylamine (1.50 kg), 4-dimethylaminopyridine (0.164 kg), and succinic anhydride (1.34 kg) were added to the glass reactor. The mixture was kept at 20–30 °C for 18 h, and a sample was taken to terminate the reaction. A saturated sodium bicarbonate solution (22.50 kg) was added to the reaction system, and the mixture was stirred for 10–20 min, resulting in layer separation. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to obtain 1.83 kg of a gray to grayish-white solid residue.

[0288] Add N,N-dimethylformamide (23.50 kg) to a 100 L glass reactor, stir, and control the temperature at 20-30 °C. Under nitrogen protection, add the previous product O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg) to the 100 L glass reactor through a solid feeding funnel, stir for 10-30 minutes, and discharge the material into a 50 L zinc drum for later use. Macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Synthetic Technology Co., Ltd., batch number HA2X1209, loading 0.48 mmol / g) was added to the 100 L solid-phase synthesis reactor through a solid feed funnel. The temperature was controlled at 20–30 °C. N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc tank in the previous step were added to the solid-phase synthesis reactor. The reaction was maintained at this temperature, and the solid loading was monitored until it reached ≥250 μmol / g. The loading was detected by UV light. The mixture was filtered under nitrogen pressure, and the filter cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg). The filter cake was then left in the reactor. Add CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine and 30% N-methylimidazole and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) to an 80 L glass reactor and stir for 3–8 min before use. Repeat this operation three times. Cover the reactor and add acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) to a solid-phase synthesis reactor. Purge with nitrogen for 10–30 min and then filter. Repeat this operation four times. Purge the filter cake in the solid-phase synthesis reactor with nitrogen for 2–4 h and then transfer it to a 50 L filter press. Maintain the temperature at 15–30 °C and continue drying. After drying, a yellow to white solid product is obtained, weighing 3.516 kg.

[0289] Isomannitol residues are added to the 5' or 3' end of the oligonucleotide chain by methods well known to those skilled in the art, such as the invab method, and further added to the target group.

[0290] Example 3. Synthesis of C3 RNAi Agent

[0291] The C3 RNAi agent duplexes listed in Table 2-3 above are synthesized according to the following general procedure:

[0292] The sense and antisense sequences of siRNA were synthesized on an oligonucleotide synthesizer using a well-established solid-phase synthesis method based on phosphoramide chemistry. The elongation of the oligonucleotide chains was achieved through a four-step cycle: deprotection, condensation, capping, and oxidation or sulfidation steps for adding each nucleotide. Synthesis was performed using a controlled-aperture glass (CPG). The reaction is carried out on a solid support prepared by [the study / process]. The monomeric phosphoramide can be purchased from commercial sources or can be the phosphoramide compound in Example 1. The phosphoramide compound in this study can be attached as a monomeric phosphoramide to the 3' end and further attached to the CPG solid support. In the case of attachment to the 5' end, the phosphoramide compound can be used for the final coupling reaction and can be further bound to the target ligand if desired.

[0293] Phosphamides with GalNAc ligand clusters (GLS-5* or GLS-15* phosphoramides as non-limiting examples) are disclosed in WO2023 / 045995A1 (integrated herein). For siRNAs used for in vitro screening (Table 2), synthesis was performed at a scale of 2 μmol, while for siRNAs used for in vivo assays (Table 3), synthesis was performed at a scale of 5 μmol or greater. CPG solid carriers with GalNAc ligands attached were used when the GalNAc ligand (GLO-n phosphoramides as non-limiting examples are disclosed in WO2023 / 045995A1 (integrated herein)) was attached to the 3' end of the sense strand. The final coupling reaction is performed using GalNAc phosphorous amide with a GalNAc ligand (by way of non-limiting example, GLS-5* or GLS-15* attached to the 5' end of the sense chain, and phosphorous amides with GalNAc ligand clusters of GLS-5* or GLS-15* disclosed in WO2023 / 045995A1 (in its entirety incorporated herein by reference) attached to the 5' end of the sense chain. 3% trichloroacetic acid (TCA) in dichloromethane is used for deprotection of the 4,4'-dimethoxytriphenylmethyl protecting group (DMT). 5-Ethylthio-1H-tetrazole is used as an activator. THF / Py / H 2O I₂ in the pyridine / MeCN and phenylacetyl disulfide (PADS) in the pyridine / MeCN were used for oxidation and sulfidation reactions, respectively. Following the final solid-phase synthesis step, the oligomer bound to the solid support was cleaved, and protecting groups were removed by treatment with a 1:1 volume of 40 wt.% methylamine aqueous solution and 28% ammonium hydroxide solution. To synthesize siRNA for in vitro screening, the crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc, and ice-cold EtOH was added to precipitate the single-stranded product as a sodium salt, which could be used for annealing without further purification. To synthesize siRNA for in vivo testing, the crude single-stranded product was further purified by ion-paired reversed-phase HPLC (IP-RP-HPLC). The purified single-stranded oligonucleotide product from IP-RP-HPLC was converted to a sodium salt by dissolving in 1.0 M NaOAc and precipitated by adding ice-cold EtOH. Equimolar complementary sense and antisense oligonucleotides were annealed in water to form a double-stranded siRNA product, which was then lyophilized to obtain a fluffy white solid.

[0294] In some studies, methods of attaching a targeting group containing GalNAc (also referred to herein as a GalNAc delivery compound) to the 5' end of a sense chain include using GalNAc phosphoramide (GLS-5* or GLS-15* phosphoramide) in the final coupling step of a solid-phase synthesis, using, for example, the synthetic process used when performing oligonucleotide chain growth by adding nucleotides to the 5' end of a sense chain.

[0295] In some studies, methods for attaching a GalNAc-containing targeting group to the 3' end of a sense chain include using a solid support (CPG) containing GLO-n. Other methods involve attaching the GalNAc-containing targeting group to a CPG solid support via an ester bond, and then using the resulting CPG with the attached GalNAc targeting group during the synthesis of the sense chain, thereby obtaining a GalNAc targeting group attached to the 3' end of the sense chain.

[0296] The imann residue can be added to the 5' or 3' end of the oligonucleotide chain, and / or further added to the targeting group of GalNAc, by methods well known to those skilled in the art, such as the invab method.

[0297] Example 4. In vitro screening of C3 siRNA duplexes

[0298] Huh7 cells were digested with trypsin and adjusted to an appropriate density before being seeded into 96-well plates. Simultaneously, test or control siRNAs were transfected into the cells using Lipofectamine RNAiMax (Invitrogen-13778-150) according to the manufacturer's recommended protocol. The siRNAs were tested three times at two concentrations (0.6 nM and 0.08 nM). The siRNA-transfected cell samples were cultured for 24 hours, and then qPCR was performed to analyze the expression of the target genes at the mRNA level. The results are shown in Table 5.

[0299] Table 5 presents the results of in vitro studies on the inhibition of C3 expression using various C3 RNAi agents. The double-stranded sequences used correspond to those shown in Table 3.

[0300]

[0301] Example 5. In vivo assay of C3 siRNA double strands

[0302] On day 1, female C57BL / 6J mice (n=4 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding the human C3 and luciferase genes. On day 8, mice were subcutaneously injected with a single 3 mg / kg C3 siRNA reagent or PBS. Blood samples were collected on day 8, before siRNA administration, day 15, and day 22. Plasma samples were separated, and luciferase activity was measured according to the manufacturer's recommended protocol. Since human C3 expression levels are correlated with luciferase expression levels, the remaining percentage of C3 was calculated by comparing luciferase activity in samples from the siRNA treatment group before and after treatment, and normalized by changes in luciferase activity in the control group samples over the same time period. The results are summarized in Tables 6 and 7.

[0303] Table 6. Screening of single 3mpk subcutaneous doses of C3 siRNA in AAV-C3 transduced mice. The percentage reduction in human C3 in mouse serum was normalized based on C3 expression before siRNA administration and the PBS control group.

[0304]

[0305] Table 7. Screening of C3 siRNA single-dose 2mpk subcutaneous administration in AAV-C3 transduced mice. The percentage reduction of human C3 in mouse serum was normalized based on C3 expression before siRNA administration and the PBS control group.

[0306]

[0307] Example 6. In vivo testing of C3 siRNA double strands

[0308] On day 1, female C57BL / 6J mice (n=4 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding the human C3 and luciferase genes. On day 8, mice were subcutaneously injected with a single dose of 6 mg / kg C3 siRNA or PBS. Blood samples were collected on day 8, before siRNA administration, day 15, and day 22. Plasma samples were separated, and luciferase activity was measured according to the manufacturer's recommended protocol. Since human C3 expression levels are correlated with luciferase expression levels, the remaining percentage of C3 was calculated by comparing luciferase activity in the siRNA-treated group before and after treatment, and normalized by changes in luciferase activity in the control group over the same time period. Results are summarized in Table 8.

[0309] Table 8. Screening of single 6mpk subcutaneous doses of C3 siRNA in AAV-C3 transduced mice. The percentage reduction in human C3 in mouse serum was normalized based on C3 expression before siRNA administration and the PBS control group.

[0310]

[0311] Example 7. In vivo assay of C3 siRNA double strands

[0312] On day 1, female C57BL / 6J mice (n=4 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding the human C3 and luciferase genes. On day 8, mice were subcutaneously injected with a single dose of 6 mg / kg C3 siRNA or PBS. Blood samples were collected on day 15, prior to siRNA administration. Plasma samples were separated, and luciferase activity was measured according to the manufacturer's recommended protocol. Since human C3 expression levels are correlated with luciferase expression levels, the percentage of residual C3 was calculated by comparing luciferase activity in the siRNA-treated group before and after treatment, and normalized by changes in luciferase activity in the control group over the same time period. Results are summarized in Table 9.

[0313] Table 9. Screening of single 6mpk subcutaneous doses of C3 siRNA in AAV-C3 transduced mice. The percentage reduction in human C3 in mouse serum was normalized based on C3 expression before siRNA administration and the PBS control group.

[0314]

[0315]

[0316] Example 8. In vivo testing of C3 siRNA double strands in an NHP PD model.

[0317] Male cynomolgus monkeys (5-6 years old, weighing 5-7 kg, 3 monkeys per group) were used in the experiment. On day 0, each monkey was subcutaneously injected with a test sample dissolved in sterile physiological saline at a dose of 5 mg / kg. After fasting overnight, blood samples were collected on days -14 (before administration), -7 (before administration), day 0 (before administration), day 7, day 14, day 21, and day 28. Serum C3 protein concentration was measured using the ELISA method (Abcam). Figure 1 The percentage of C3 inhibition in the group that received the test siRNA duplex treatment is shown (normalized to the mean C3 protein level in serum samples before siRNA administration).

[0318] Example 9. In vivo assay of C3 siRNA double strands

[0319] On day 1, female C57BL / 6J mice (n=4 per group) were infected intravenously with an adeno-associated virus 8 (AAV8) vector solution encoding the human C3 and luciferase genes. On day 8, mice were subcutaneously injected with a single dose of 1, 3, or 6 mg / kg C3 siRNA or PBS. Blood samples were collected on day 8 (before siRNA administration), day 15, and day 22. Plasma samples were isolated, and luciferase activity was measured according to the manufacturer's recommended protocol. Since human C3 expression levels are correlated with luciferase expression levels, the percentage of residual C3 was calculated by comparing luciferase activity in the siRNA-treated group before and after treatment, and normalized by changes in luciferase activity in the control group over the same time period. Results are summarized in Table 10.

[0320] Table 10. Screening of single subcutaneous doses of C3 siRNA (1, 3, or 6 mpk) in AAV-C3 transduced mice. The percentage reduction in human C3 in mouse serum was normalized based on C3 expression before siRNA administration and the PBS control group.

[0321]

[0322] Example 10. In vivo testing of C3 siRNA double strands in an NHP PD model.

[0323] Male cynomolgus monkeys (5-6 years old, weighing 5-7 kg, 3 monkeys per group) were used in the experiment. On day 0, each monkey was subcutaneously injected with a test sample dissolved in sterile saline at a dose of 5 mg / kg. After fasting overnight, blood samples were collected on days -7 (before administration), day 0 (before administration), day 7, day 14, day 21, and day 28. Serum C3 protein concentration was measured using the ELISA method (Abcam). Figure 2 The percentage of C3 inhibition in the group that received the test siRNA duplex is shown (normalized to the mean C3 protein level in serum samples before siRNA administration).

[0324] Example 11. In vivo testing of C3 siRNA double strands in an NHP PD model.

[0325] Male cynomolgus macaques (5-6 years old, weighing 5-7 kg, 3 per group) were recruited for the experiment. Each monkey received a subcutaneous injection of a test sample prepared with sterile saline at a dose of 6 mg / kg on day 1. After fasting overnight, liver biopsies were collected on day -7 (before administration), day 29, and day 57. C3 mRNA levels were measured using qPCR. Figure 3 The percentage of C3 mRNA inhibition in the group receiving the tested siRNA duplex treatment is shown (normalized to mean C3 levels in liver biopsy samples taken 7 days prior to siRNA administration).

[0326] Example 12. Phosphamide 15 (enantiomers of phosphoramide-15-1 and phosphoramide-15-2)

[0327]

[0328] Benzoyl chloride (126 g, 893 mmol, 104 mL) was added to a solution of pyridine (735 g, 9.29 mol, 750 mL) and acetonitrile (1.50 L) containing uracil (50.0 g, 446 mmol). The reaction solution was stirred at 20–25 °C for 12.0 h, and TLC showed complete consumption of the uracil compound. The reaction mixture was concentrated under vacuum to obtain a residue. The residue was diluted with cold water (1.0 L) and extracted with ethyl acetate (1.0 L * 3). The combined organic layers were washed with brine (500 mL), dried over anhydrous sodium sulfate, and the residue was purified by column chromatography (SiO2, ethyl acetate / petroleum ether = 1 / 10 to 1 / 1) to give a white solid Phos-15-1A (63 g, yield 65.3%).

[0329] 1 H NMR:EC4783-420-P1N(400MHz,DMSO-d6)δppm 7.96(dd,J=8.4,1.2Hz,2H),7.76-7.81(m,1H),7.67(dd,J=7.6,5.6Hz,1H),7.58-7.64(m,2H),5.75(dd,J=7.6,1.2Hz,1H).

[0330] To a tetrahydrofuran (80 mL) solution of Phos-15-SM2 (4.0 g, 47.6 mmol) and compound Phos-15-1A (7.91 g, 36.6 mmol), triphenylphosphine (11.5 g, 43.9 mmol) and diethyl azodicarboxylate (7.64 g, 43.9 mmol, 7.98 mL) were added, and the mixture was stirred at 20–25 °C for 16 h. LC-MS showed complete consumption of compound Phos-15-1A. The reaction mixture was concentrated under reduced pressure to remove tetrahydrofuran. The residue was diluted with water (80 mL) and extracted with ethyl acetate (80 mL x 3). The combined organic phases were washed with brine (80 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by column chromatography (SiO2, MeOH / DCM = 0 / 10 to 1 / 10) to obtain compound Phos-15-1B (14 g, crude) as a white solid.

[0331] Under nitrogen protection, a mixture of compound Phos-15-1B (7.0 g, 9.30 mmol) and m-chloroperoxybenzoic acid (2.27 g, 11.1 mmol, 85% purity) in dichloromethane (70 mL) was heated at 0–5 °C. After 16 hours of reaction, TLC showed complete consumption of compound Phos-15-1B and a new spot of low polarity was detected. The pH of the reaction mixture was slowly adjusted to 7–8 with a saturated solution of NaHSO3 and NaHCO3 (1:1), followed by extraction with ethyl acetate (70 mL * 3), washing of the combined organic phases (700 mL) with brine, drying over anhydrous sodium sulfate, concentrating under reduced pressure, and the residue was subjected to silica gel column chromatography (100–200 mesh silica gel), eluting with ethyl acetate:petroleum ether (1:30–1:1) to give a white solid compound Phos-15-1C (1.2 g, crude).

[0332] To a solution of compound Phos-15-SM3 (4.0 g, 14.4 mmol) in tetrahydrofuran (24.0 mL), KSAc (1.81 g, 15.8 mmol) and tetrabutylammonium iodide (TBAI, 531.4 mg, 1.44 mmol) were added, and the resulting mixture was stirred at 70 °C for 4.0 h. LC-MS showed complete consumption of the starting material Phos-15-SM3 and detected a main peak with the desired target molecular weight. The reaction mixture was cooled and concentrated under reduced pressure. The solid residue was removed by filtration through a short silica gel pad and washed with ethyl acetate. The filtrate was concentrated under vacuum to give compound Phos-15-1D (3.50 g, 98.5% yield) as a brown oil. Compound Phos-15-1D can be used in the next step without further purification.

[0333] 1 H NMR: EC11950-13-P1B (400MHz, DMSO-d6) δppm 3.96-4.07 (m, 4H) 3.27 (d, J = 14.0Hz, 2H) 2.40 (s, 3H) 1.22 (t, J = 7.2Hz, 6H).

[0334] Potassium carbonate (1.11 g, 8.05 mmol) and compound Phos-15-1D (1.91 g, 8.45 mmol) were added to an ethanol (15.0 mL) solution of compound Phos-15-1C (1.20 g, 4.02 mmol) and stirred at 20-25 °C for 3.0 h. TLC showed that compound Phos-15-1C was completely consumed and a new spot with high polarity was detected. The resulting mixture was filtered, diluted with water (20 mL), extracted with dichloromethane (20 mL * 3), the combined organic layers were washed with brine, dried with anhydrous sodium sulfate, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (SiO2, MeOH / DCM = 1 / 100 to 10 / 100) to give compound Phos-15-1E as a brown oil (1.00 g, yield 65.7%, a 1:1 mixture of enantiomers -1E-1 and -1E-2).

[0335] 1 H NMR:EC10615-82-P1N1(400MHz,DMSO-d6)δppm 11.23(br s,1H),7.69(d,J=8.0Hz,1H),5.58(dd,J=8.0,1.6Hz,1H),4.93(q,J=8.8Hz,1H),3.96-4.17(m,5H),3.08-3.17(m,1H),3.03 (dd,J=14.0,2.0Hz,2H),2.38-2.47(m,1H),2.04-2.07(m,1H),1.82-1.90(m,1H),1.56-1.59(m,1H),1.25(t,J=6.8Hz,6H).

[0336] Compound Phos-15-1E can be chirally resolved to yield enantiomers Phos-15-1E-1 and Phos-15-1E-2. Resolution conditions: DAICELCHIRALPAK AD 40 mm column, 140 mL / min, ethanol:carbon dioxide = 35:75. It is understood that when enantiomers phosphoramidite-15-1 or phosphoramidite-15-2 are desired, they can be obtained simply by reacting the corresponding enantiomers Phos-15-1E-1 or Phos-15-1E-2 with a phosphorus reagent.

[0337] At room temperature and under nitrogen protection, a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (P reagent, 956 mg, 3.17 mmol, 1.01 mL) in dichloromethane (0.5 mL) was added to a solution of compound Phos-15-1E (400 mg, 1.06 mmol) and diisopropylamine tetrazolium salt (199 mg, 1.16 mmol) in dichloromethane (4.0 mL), and the mixture was stirred at 40 °C for 1.0 h. LC-MS showed that compound Phos-15-1E was completely consumed, several new peaks appeared on the LC-MS, and approximately 80% of the desired compound was detected. The resulting reaction mixture was cooled to -20°C and poured into a cold (0-5°C) saturated sodium bicarbonate aqueous solution (10 mL). Extraction was performed with dichloromethane (10 mL x 2), and the combined organic layers were washed with a cold (0-5°C) saturated sodium bicarbonate aqueous solution / saline solution (5 mL / 5 mL). The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum to give a residue (~2.0 mL). The residue was purified by column chromatography (alkaline Al₂O₃, MeOH / DCM = 1 / 80 to 1 / 40, 0.1% Et₃N) to give a colorless oily phosphoramidite-15 (350 mg, 0.6 mmol, 57.2% yield, a 1:1 mixture of enantiophosphoramidite-15-1 and enantiophosphoramidite-15-2).

[0338] Following the same synthetic method described above, using the corresponding Phos-15-1E-1 or Phos-15-1E-2 obtained by SFC separation and purification as starting materials, enantiophosphoramide-15-1 or enantiophosphoramide-15-2 can be obtained.

[0339] δppm 11.23(br s,1H),7.70(d,J=8.0Hz,1H),5.55-5.60(m,1H),4.89(q,J=8.4Hz,1H),4.29-4.42 (m,1H),3.99-4.09(m,4H),3.65-3.84(m,2H),3.53-3.62(m,2H),3.35-3.41(m,1H ),3.02(dd,J=14.0,8.0Hz,2H),2.76-2.79(m,2H),2.40-2.49(m,1H),2.15-2.25( m,1H),1.95-2.07(m,1H),1.65-1.75(m,1H),1.23-1.26(m,6H)1.12-1.21(m,12H).

[0340] The phosphoramide 15 compound (a 1:1 mixture of phosphoramide 15-1 and phosphoramide 15-2 in this paper) can be attached as a monomeric phosphoramide to the 5' end, in which case the phosphoramide compound can be used for the final coupling reaction, for example, to form a phos-15* nucleotide at the 5' end of the antisense sequence.

[0341] EQUIVALENTS

[0342] Although several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing functions and / or obtaining results and / or one or more advantages described herein, and each of these variations and / or modifications is considered to be within the scope of the invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended as examples, and actual parameters, dimensions, materials, and / or configurations will depend on the specific application using the teachings of this invention. Those skilled in the art will recognize, or be able to determine, many equivalents of the specific embodiments of the invention described herein using only conventional experimentation. Therefore, it should be understood that the foregoing embodiments are presented by way of example only and within the scope of the appended claims and their equivalents; the invention may be practiced in ways different from the specific descriptions and claims. The invention is directed toward each individual feature, system, article, material, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods (provided that these features, systems, articles, materials, and / or methods do not contradict each other) is included within the scope of the invention.

[0343] All definitions defined and used in this document should be understood as control dictionary definitions, definitions referenced in incorporated documents, and / or the general meaning of the defining terms.

[0344] The indefinite articles “a” and “an” used in this specification and claims, unless otherwise expressly stated, shall be understood as “at least one”.

[0345] The phrase “and / or” as used in the specification and claims shall be understood as “any one or both” of the combined elements, that is, the elements exist together in some cases and separately in others. Other elements may optionally exist in addition to those expressly identified in the “and / or” clause, whether related to or unrelated to the expressly identified elements, unless otherwise expressly stated.

[0346] All references, patents and patent applications and publications cited or mentioned in this application are incorporated herein by reference in their entirety.

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the antisense strand comprises a region complementary to a C3 RNA transcript, the complementary region comprising at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from one of the antisense sequences of any one of SEQ IDNOs: 25-28, 31-35, 39-41, 45-47; and optionally comprising a targeting ligand; wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary to each other.

2. The dsRNA agent according to claim 1, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides differing from one of the sense sequences of any one of SEQ ID NO: 2-5, 8-12, 16-18, 22-24 by 0, 1, 2 or 3 nucleotides.

3. The dsRNA agent according to any one of claims 1-2, wherein the sense strand and antisense strand comprise sequences listed in the form of double-stranded sequences, said double-stranded sequences being selected from sequences consisting of: (a) are sequences SEQ ID NO: 2 and 25, respectively; (b) are sequences SEQ ID NO: 3 and 26, respectively; (c) are sequences SEQ ID NO: 4 and 27, respectively; (d) are sequences SEQ ID NO: 8 and 31, respectively; (e) are sequences SEQ ID NO: 9 and 32, respectively; (f) are sequences SEQ ID NO: 10 and 33, respectively; (g) are sequences SEQ ID NO: 11 and 34, respectively; (h) are sequences SEQ ID NO: 12 and 35, respectively; (i) are sequences SEQ ID NO: 16 and 39, respectively; (j) are sequences SEQ ID NO: 17 and 40, respectively; (k) are sequences SEQ ID NO: 18 and 41, respectively; (l) are sequences SEQ ID NO: 22 and 45, respectively; (m) represent sequences SEQ ID NO: 23 and 46, respectively; and (n) are sequences SEQ ID NO: 24 and 47, respectively.

4. The dsRNA agent according to any one of claims 1-2, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18 or 19 consecutive nucleotides differing from formula (I) by 0, 1, 2 or 3 nucleotides, the nucleotide sequence of formula (I) being represented as: 5'-Z1UAUUCAUGAGCUUCGUAGZ2-3'(I), wherein Z1 is selected from one of C, G, A, U or is absent, and Z2 is a nucleotide sequence of 0-15 nucleotides in length.

5. The dsRNA agent according to any one of claims 1-2, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18 or 19 consecutive nucleotides differing from the nucleotide sequence of formula (III) by 0, 1, 2 or 3 nucleotides, the nucleotide sequence of formula (III) being represented as: 5'-Z5UGUUCAUUCUGAUUCCUUZ6-3'(III), wherein Z5 is selected from one of C, G, A, U or is absent, and Z6 is a nucleotide sequence of 0-15 nucleotides in length.

6. The dsRNA agent according to any one of claims 1-2, wherein the antisense strand of the dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 consecutive nucleotides differing from the nucleotide sequence of formula (V) by 0, 1, 2, or 3 nucleotides, the nucleotide sequence of formula (V) being represented as: 5'-Z9GUAGUAGAAUUUCUCUGUZ 10 -3'(V), where Z9 is selected from one of C, G, A, U or does not exist, Z 10 It is a nucleotide sequence with a length of 0-15 nucleotides.

7. The dsRNA agent according to any one of claims 1-6, wherein the dsRNA agent comprises at least one modified nucleotide.

8. The dsRNA agent according to any one of claims 1-7, wherein all or substantially all nucleotides of the sense strand and / or antisense strand are modified nucleotides.

9. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region partially complementary to the C3 RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, and wherein the sense strand contains a sequence that can be represented by formula (A): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ L N′ F N′ L N′ F N′ L N′ N1 N′ N2 N′ L N′ L N′ L N′ L N′ L (N′ L ) m′ -3′(A) Like: Each N′ F This indicates a nucleotide with 2'-fluorine modification; each N′ N1 and N′ N2 Independently representing modified or unmodified nucleotides; each N′ L The nucleotides m′ and n′ are independently selected from integers from 0 to 7, except for nucleotides with 2'-fluorine modification.

10. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to a portion of the C3 RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, and wherein the antisense strand contains a sequence that can be represented by formula (B): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′(B) in: Each N F This indicates a nucleotide with 2'-fluorine modification; each N M1 N M2 N M3 N M4 N M5 and N M6 Independently representing modified or unmodified nucleotides; each N L Independently represents a modified or unmodified nucleotide but not a 2'-fluorinated nucleotide, and n is an integer selected from 0 to 7.

11. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting C3 expression, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to the C3 RNA transcript, wherein, The complementary region comprises at least 15 consecutive nucleotides, wherein the dsRNA comprises a double strand represented by formula (C): Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ L N′ F N′ L N′ F N′ L N′ N1 N′ N2 N′ L N′ L N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M4 N L N L N L N M5 N L N M6 N L N L N F N L -5′ (C) Each chain is approximately 18 to 30 nucleotides in length; each N F and N′ F Independently represents a nucleotide modified with 2'-fluorine; N M1 N M2 N M3 N M4 N M5 、N′ N1 and N′ N2 Each can independently represent a modified or unmodified nucleotide; N′ N1 and N′ N2 It contains only one 2'-fluorine modified nucleotide; N M1 N M2 N M3 N M4 N M5 and N M6 It contains only three 2'-fluorinated nucleotides; each N L and N′ L Each nucleotide can be used independently to represent a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification, and m′, n′, and n are each an independent integer from 0 to 7.

12. The dsRNA agent according to any one of claims 1-11, wherein the one or more modified nucleotides are independently selected from: 2'-O-methyl nucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2'3'-seco nucleotide mimics, locked nucleotides, unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, debased nucleotides, ribitol, reverse nucleotides, reverse debased nucleotides, isomannitol nucleotides, reverse 2'-Ome nucleotides, reverse 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides, 3'-OMe nucleotides, nucleotides containing a 5'-thiophosphate group, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) group, 2'-amino-modified nucleotides, phosphamide esters, or nucleotides containing non-natural bases.

13. The dsRNA agent according to any one of claims 1-12, comprising an E-vinylphosphonate nucleotide located at the 5′ end of the guide strand.

14. The dsRNA agent according to any one of claims 1-13, wherein the dsRNA agent comprises at least one phosphate thioester nucleoside internucleotide bond.

15. The dsRNA agent according to any one of claims 1-14, wherein the sense strand comprises at least one phosphate thionucleotide internucleotide bond.

16. The dsRNA agent according to any one of claims 1-14, wherein the antisense strand comprises at least one phosphate thionucleotide internucleotide bond.

17. The dsRNA agent according to any one of claims 1-14, wherein the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.

18. The dsRNA agent according to any one of claims 1-14, wherein the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.

19. The dsRNA agent according to any one of claims 1-18, wherein the dsRNA comprises a duplex selected from AV04969, AV04970, AV04971, AV04972, AV04973, AV04974, AV04975, AV04976, AV04977, AV04978, AV04979, and AV04980, and wherein the duplex optionally comprises a targeting ligand.

20. The dsRNA agent according to any one of claims 1-19, wherein the sense strand and the antisense strand are complementary or substantially complementary, and the length of the complementary region is between 16 and 23 nucleotides.

21. The dsRNA agent according to any one of claims 1-20, wherein the length of the complementary region is 19-21 nucleotides.

22. The dsRNA agent according to any one of claims 1-21, wherein the length of each strand does not exceed 40 nucleotides.

23. The dsRNA agent according to any one of claims 1-21, wherein the length of each strand does not exceed 30 nucleotides.

24. The dsRNA agent according to any one of claims 1-21, wherein the length of each strand does not exceed 25 nucleotides.

25. The dsRNA agent according to any one of claims 1-21, wherein the length of each strand does not exceed 23 nucleotides.

26. The dsRNA agent according to any one of claims 1-25, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.

27. The dsRNA agent of claim 26, wherein one or more targeting groups or linking groups are conjugated to the sense strand.

28. The dsRNA agent according to any one of claims 26 or 27, wherein the targeting group or linking group comprises N-acetylgalactosamine (GalNAc).

29. The dsRNA agent according to any one of claims 26-28, wherein the targeting group comprises having the following structure: Each n” is independently selected from 1 or 2.

30. The dsRNA agent according to any one of claims 26-29, wherein the targeting group has the following structure:

31. The dsRNA agent according to any one of claims 1-30, wherein the dsRNA agent comprises a targeting group conjugated to the 5' end of the sense strand.

32. The dsRNA agent according to any one of claims 1-30, wherein the dsRNA agent comprises a targeting group conjugated to the 3' end of the sense strand.

33. The dsRNA agent according to any one of claims 1-30, wherein the antisense strand contains a reversed debasement residue at its 3' end.

34. The dsRNA agent according to any one of claims 1-30, wherein the sense strand comprises one or two reversed debase residues or imann residues at the 3' and / or 5' ends.

35. The dsRNA agent according to any one of claims 1-34, wherein the dsRNA agent has two blunt ends.

36. The dsRNA agent according to any one of claims 1-34, wherein at least one strand comprises a 3' overhang of at least one nucleotide.

37. The dsRNA agent according to any one of claims 1-34, wherein at least one strand comprises a 3' overhang of at least two nucleotides.

38. The dsRNA agent according to any one of claims 1-37, wherein the dsRNA comprises a double strand selected from the group consisting of: AD01444, AD01444-1, AD01444-2, AD01444-3, AD00193, AD00193-1, AD00193-2, AD00193-4, AD01424, AD01428, AD01447, AD01447-1, AD01447-2, AD01447-3.

39. The dsRNA agent according to any one of claims 1-38, wherein the C3 RNA transcript is SEQ ID NO:

1.

40. A composition comprising the dsRNA agent according to any one of claims 1-39.

41. The composition according to claim 49, further comprising a pharmaceutically acceptable carrier.

42. The composition according to claim 41, further comprising one or more additional therapeutic agents.

43. The composition of claim 42, wherein the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial.

44. The composition according to any one of claims 40-43, wherein the composition is formulated for subcutaneous administration or for intravenous (IV) administration.

45. A cell comprising the dsRNA agent of any one of claims 1-39, wherein the cell is optionally a mammalian cell, optionally a human cell.

46. ​​A method for inhibiting the expression of the C3 gene in cells, the method comprising: (i) Preparing cells containing an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-39 or the composition of any one of claims 40-44.

47. The method of claim 46, further comprising: (ii) The cells prepared in step (i) of claim 46 are maintained for a sufficient time to allow for the degradation of the mRNA transcript of the C3 gene, thereby inhibiting the expression of the C3 gene in the cells.

48. The method of any one of claims 46-47, wherein the cells are located in the subject and the dsRNA agent is administered subcutaneously to the subject.

49. The method according to any one of claims 46-47, wherein the cells are located in the subject and the dsRNA agent is administered to the subject via IV administration.

50. The method of claim 48 or 49, further comprising assessing the inhibition of the C3 gene after administration of the dsRNA agent to the subject, wherein the assessment method includes: (i) Identify one or more physiological characteristics of C3-related diseases or conditions in the subject, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of C3-related diseases or conditions and / or control physiological characteristics of C3-related diseases or conditions; The comparisons described therein indicate one or more instances of suppression of C3 gene expression in the subjects, either present or absent.

51. The method of claim 50, wherein the determined physiological characteristics are one or more of the following: the subject's C3 mRNA level and C3 protein level.

52. The method of claim 51, wherein one or more of the subject's C3 mRNA level and the subject's C3 protein level are reduced.

53. A method for inhibiting C3 gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-39 or a composition according to any one of claims 40-44.

54. The method of claim 53, wherein the dsRNA agent is administered subcutaneously to the subject.

55. The method of claim 53, wherein the dsRNA agent is administered to the subject via intravenous administration.

56. The method according to any one of claims 53-55, further comprising assessing the repression of the C3 gene after administration of the dsRNA agent, wherein the assessment method comprises: (i) Identify one or more physiological characteristics of the subject’s C3-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of C3-related diseases or conditions and / or control physiological characteristics of C3-related diseases or conditions; The comparisons described therein indicate one or more instances of suppression of C3 gene expression in the subjects, either present or absent.

57. A method for treating a disease or condition associated with the presence of C3 protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-39 or a composition according to any one of claims 40-44 to inhibit C3 gene expression.

58. The method of claim 57, wherein the disease or condition is one or more of the following: C3 glomerulonephritis (C3G), atypical hemolytic uremic syndrome (aHUS), immune complex-mediated glomerulonephritis (IC-mediated GN), C3 glomerulonephritis, post-infectious glomerulonephritis (PIGN), systemic lupus erythematosus, lupus nephritis, ischemia / reperfusion injury, IgA nephropathy (IgA N), age-related macular degeneration (AMD), rheumatoid arthritis (RA), antineutrophil cytoplasmic autoantibody-associated vasculitis (ANCA-AV), dysbiosis-related periodontitis, malaria-related anemia, paroxysmal nocturnal hemoglobinuria (PNH), sepsis, neuromyelitis optica (NMO), multifocal motor neuropathy (MMN), myasthenia gravis (MG), rheumatoid arthritis, and neurodegenerative diseases.

59. The method of claim 58, further comprising administering an additional treatment to the subject.

60. The method of claim 59, wherein the additional treatment comprises: Administering one or more C3 antisense polynucleotides to subjects, administering non-C3 dsRNA therapeutics to subjects, and inducing behavioral changes in subjects.

61. The method of claim 60, wherein the non-C3 dsRNA therapeutic agent is one or more of the following: a C5 inhibitor, such as an anti-complement component C5 antibody or its antigen-binding fragment (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918)) or a C5 peptide inhibitor (e.g., zilucoplan); a C3 peptide inhibitor, such as compstatin.

62. The method according to any one of claims 57-61, wherein the dsRNA agent is administered subcutaneously to the subject.

63. The method of any one of claims 57-61, wherein the dsRNA agent is administered to the subject via intravenous administration.

64. The method according to any one of claims 57-63, further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.

65. The method of claim 64, wherein the method for determining the efficacy of the treatment on the subject comprises: (i) Identify one or more physiological characteristics of the subject’s C3-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of C3-related diseases or conditions. The comparisons indicate the presence, absence, and level of efficacy of administering double-stranded RNA (dsRNA) agents to the subjects.

66. The method of claim 65, wherein the determined physiological characteristics are: the subject's C3 mRNA level and C3 protein level.

Images