Use of isopentenyl transferase fnpt1

Abstract

The application relates to application of an isopentenyl transferase FnPT1 and belongs to the technical field of enzymology. The isopentenyl transferase FnPT1 screened and verified by the application is different from most reported flavonoid isopentenyl transferases, the isopentenyl transferase FnPT1 can catalyze isopentenyl modification reaction of flavonoid glycoside which is a relatively large substrate, the isopentenyl transferase FnPT1 has potential application in flavonoid glycoside synthetic biology, and has important application value.

Description

Technical Field

[0001] This application relates to the fields of genetic engineering and enzymology, and in particular to the application of an isopentenyltransferase FnPT1. Background Technology

[0002] Flavonoid glycosides are important functional food supplements found in edible plants, possessing a variety of biological and pharmacological activities, including anti-atherosclerotic, anti-inflammatory, anti-tumor, anti-thrombotic, anti-osteoporosis, and antiviral effects. Isoprenyl modification is an important type of compound modification; compared to unisoprenated precursors, isoprenylation significantly enhances the affinity of aromatic compounds for cell membranes, thereby endowing them with a variety of biological activities.

[0003] Isopentenyltransferases are responsible for catalyzing isopentenylation reactions and are mainly divided into membrane-bound proteins from plant sources and soluble proteins from microorganisms. Compared with plant-derived isopentenyltransferases, microbial-derived isopentenyltransferases have advantages such as clear genetic background, ease of molecular manipulation, and generally broad substrate applicability, and have been extensively studied, with rapid progress in recent years. However, isopentenyltransferases capable of catalyzing the isopentenylation of flavonoid glycosides have not yet been reported. Summary of the Invention

[0004] In view of this, this application provides an application of isopentenyltransferase FnPT1, which provides a new possibility for the preparation of isopentenyl flavonoid glycosides and can effectively overcome the defects of the prior art.

[0005] The first aspect of this application provides an isopentenyltransferase gene FnPT1, the nucleotide sequence of which isopentenyltransferase gene FnPT1 is shown in SEQ ID NO.1. Specifically, the isopentenyltransferase gene FnPT1 is derived from... Fusarium nygamai .

[0006] The second aspect of this application also provides a protein encoded by the isopentenyltransferase gene FnPT1, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] The third aspect of this application also provides a recombinant vector, recombinant microorganism, or transgenic cell line containing the above-mentioned isopentenyltransferase gene FnPT1.

[0008] The fourth aspect of this application also provides a method for preparing the above-mentioned isopentenyltransferase FnPT1, comprising the following steps:

[0009] The isopentenyltransferase FnPT1 was prepared by using the recombinant vector, recombinant microorganism or transgenic cell line described above.

[0010] Specifically, the recombinant expression vector is pET-28a-FnPT1; the microorganism is Escherichia coli BL21(DE3), and the recombinant microorganism is Escherichia coli BL21(DE3) as the host, expressing isopentenyltransferase FnPT1 or containing a recombinant plasmid linked to the isopentenyltransferase gene FnPT1.

[0011] The fifth aspect of this application also provides the use of the above-mentioned isopentenyltransferase FnPT1 in any of the following:

[0012] (1) Catalyzes the formation of 6C-isopentenyl rutin from rutin;

[0013] (2) Catalyze the formation of 4'O-isopentenyl belamcine from belamcine;

[0014] (3) Catalyzes the formation of 6C-isopentenyl genistein from genistein;

[0015] (4) Catalyzes the formation of 4O-isopentenyltrifolin from trifolin;

[0016] (5) Catalyzes the formation of 4'O-isopentenyl glutenin from polydipsia glycoside;

[0017] The nucleotide sequence of the isopentenyltransferase gene FnPT1 is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the isopentenyltransferase gene FnPT1 is shown in SEQ ID NO.2.

[0018] The sixth aspect of this application also provides a method for synthesizing an isopentenyl modified product, comprising the following steps:

[0019] The flavonoid glycoside substrate and the isopentenyl donor were mixed with the above-mentioned isopentenyl transferase FnPT1 to generate an isopentenyl modified product.

[0020] The flavonoid glycoside substrate is selected from at least one of sophoroside, belamcanda chinensis glycoside, genistein, trifolin glycoside, and styrax glycoside; the isopentenyl donor is dimethylallyl pyrophosphate.

[0021] Specifically, a method for synthesizing an isopentenyl-modified product includes the following steps:

[0022] Under the catalysis of isopentenyl transferase FnPT1, isopentenyl-modified sophorenoic acid, irisin, genistein, trifolinin, and polydipsia glycoside were synthesized using sophorenoic acid, irisin, genistein, trifolinin, and polydipsia glycoside as substrates and dimethylallyl pyrophosphate (DMAPP) as isopentenyl donor.

[0023] The seventh aspect of this application also provides a reagent or kit for isopentenyl modification of flavonoid glycosides, comprising the above-mentioned isopentenyl transferase gene FnPT1 and / or the above-mentioned recombinant vector, recombinant microorganism or transgenic cell line.

[0024] Compared with the prior art, this application has the following advantages:

[0025] The isopentenyltransferase FnPT1 screened and validated in this application differs from most reported flavonoid isopentenyltransferases. This isopentenyltransferase FnPT1 can catalyze the isopentenyl modification reaction of relatively large substrates such as flavonoid glycosides. This isopentenyltransferase FnPT1 has the potential to be applied in the synthetic biology of flavonoid glycosides and has important application value. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in this application or the prior art, the drawings used in the description of this application or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0027] Figure 1 Electrophoresis diagram of the PCR product of the isopentenyltransferase gene FnPT1;

[0028] Figure 2 The chemical structural formulas of 15 flavonoid glycoside substrates are: rutin, luteolin, cirsin, quercetin, guavaside, kaempferol, sagein, iridoside, genistein, puerarin, styracin, verbascoside, hesperidin, trifolin, and styracin.

[0029] Figure 3 The figure shows the HPLC results for the detection of rutin catalyzed by isopentenyltransferase FnPT1.

[0030] Figure 4 Figure 1 shows the negative control results of HPLC detection of rutin catalyzed by isopentenyltransferase FnPT1;

[0031] Figure 5 The image shows the HPLC results for detecting isopentenyltransferase FnPT1-catalyzed belamcanda glycosides.

[0032] Figure 6 Figure 1 shows the negative control results of HPLC detection of isopentenyltransferase FnPT1 catalyzing belamcanda glycosides;

[0033] Figure 7 The image shows the HPLC results for the detection of genistein catalyzed by isopentenyltransferase FnPT1.

[0034] Figure 8 Figure 1 shows the negative control results of HPLC detection of isopentenyltransferase FnPT1 catalyzing dysoxidine;

[0035] Figure 9 The image shows the HPLC results for detecting trifolin glycosides catalyzed by isopentenyltransferase FnPT1.

[0036] Figure 10 Figure 1 shows the negative control results of HPLC detection of trifolin glycoside catalyzed by isopentenyltransferase FnPT1;

[0037] Figure 11 The figure shows the HPLC results for detecting isopentenyltransferase FnPT1 catalyzing polysaccharide;

[0038] Figure 12 Figure 1 shows the negative control results of HPLC detection of isopentenyltransferase FnPT1 catalyzing polygalactosidase;

[0039] Figure 13 The results of secondary mass spectrometry identification of rutin catalyzed by isopentenyltransferase FnPT1;

[0040] Figure 14 The image shows the results of secondary mass spectrometry identification of isopentenyltransferase FnPT1 catalyzing belamcanda glycosides;

[0041] Figure 15 The image shows the results of secondary mass spectrometry identification of dysoxin catalyzed by isopentenyltransferase FnPT1.

[0042] Figure 16 The image shows the results of secondary mass spectrometry identification of trifolin glycosides catalyzed by isopentenyltransferase FnPT1.

[0043] Figure 17 The image shows the results of secondary mass spectrometry identification of isopentenyltransferase FnPT1 catalyzing polyoxin;

[0044] Figure 18 The H spectrum of 6C-isopentenyl jugnan;

[0045] Figure 19 The C-chromatogram of 6C-isopentenyl jugnanoside is shown.

[0046] Figure 20 The HSQC spectrum of 6C-isopentenyl jugnan;

[0047] Figure 21 The HMBC spectrum of 6C-isopentenyl jugnan;

[0048] Figure 22 The HCl spectrum of 4'O-isopentenyl belamcanda chinensis glycoside;

[0049] Figure 23 The C-chromatogram of 4'O-isopentenyl belamcanda chinensis glycoside;

[0050] Figure 24 The HSQC spectrum of 4'O-isopentenyl belamcanda chinensis glycoside;

[0051] Figure 25 The HMBC spectrum of 4'O-isopentenyl belamcanda glycoside;

[0052] Figure 26 The H spectrum of 6C-isoprenyl genistein;

[0053] Figure 27 The C-chromatic spectrum of 6C-isopentenyl genistein;

[0054] Figure 28 The HSQC spectrum of 6C-isoprenyl genistein;

[0055] Figure 29 The HMBC spectrum of 6C-isoprenyl genistein;

[0056] Figure 30 The H spectrum of 4O-isopentenyltrifolin glycoside;

[0057] Figure 31 The C-chromatogram of 4O-isopentenyltrifolin glycoside is shown.

[0058] Figure 32 The HSQC spectrum of 4O-isopentenyltrifolin glycoside;

[0059] Figure 33 The HMBC spectrum of 4O-isopentenyltrifolin glycoside;

[0060] Figure 34 The HCl spectrum of 4'O-isopentenyl buspirone;

[0061] Figure 35 The C-chromatogram of 4'O-isopentenyl buspirone;

[0062] Figure 36 The HSQC spectrum of 4'O-isopentenyl styrax glycoside;

[0063] Figure 37 The HMBC spectrum of 4'O-isopentenyl buspirone;

[0064] Figure 38 This is an electrophoresis diagram of the isopentenyltransferase FnPT1 protein. Detailed Implementation

[0065] To make the objectives, technical solutions, and advantages of this application clearer, the technical solutions of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0066] Unless otherwise specified, the experimental methods used in the embodiments of this application are all conventional methods.

[0067] In the following examples, unless otherwise specified, all raw materials can be obtained by commercial purchase or conventional methods.

[0068] (1) pET-28a Escherichia coli expression vector (purchased from Shanghai Sangon Biotech Co., Ltd., catalog number: B540183-0001); (2) high-fidelity PCR enzyme PrimeSTAR ® Max DNA Polymerase (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: R047S); (3) Restriction endonuclease DPNI (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 1235A); (4) In-Fusion ®Snap Assembly Master Mix (purchased from Takara Biotech (Beijing) Co., Ltd., catalog number: 638948); (5) Escherichia coli DH5α (purchased from Shanghai Sangon Biotech Co., Ltd., catalog number: B528413-0100); (6) Kanamycin (purchased from Beijing Merida Technology Co., Ltd., catalog number: M1120-5g); (7) Plasmid Mini Kit for plasmid extraction I (purchased from Beijing Nobleride Technology Co., Ltd., item number: D6943-01); (8) Escherichia coli BL21 (DE3) competent cells (purchased from Shanghai Sangon Biotech Co., Ltd., item number: B528414-0010); (9) Isopropyl-β-D-thiogalactoside (IPTG, Shanghai Myriel Biochemical Technology Co., Ltd., item number: M15211-25G); (10) Sodium chloride (purchased from Shanghai Sangon Biotech Co., Ltd., item number: A100241-0500); (11) Glycerol (purchased from Hainan Qingfeng Biotechnology Co., Ltd., item number: IG0910-500mg); (12) Imidazole (purchased from Shanghai Myriel Biochemical Technology Co., Ltd.) Company, item number: M12951-100G (13) Dithiothreitol (purchased from Shanghai Xinbo Chemical Technology Co., Ltd., item number: LB838605-1g); (14) Magnesium chloride (purchased from Hainan Qingfeng Biotechnology Co., Ltd., item number: S27919-500g); (15) Ethyl acetate (purchased from Hainan Haidaosen Technology Co., Ltd., item number: A00016); (16) Acetonitrile (purchased from Agilent Technologies China Co., Ltd., item number: 5191-5100); (17) Formic acid (purchased from Agilent Technologies China Co., Ltd., item number: G2453-85060); (18) Methanol (purchased from Agilent Technologies China Co., Ltd., item number: 5191-5110).

[0069] Example 1: Construction of FnPT1 vector

[0070] By searching the NCBI database and combining Fusarium nygamaiWhole genome sequence analysis revealed the isopentenyltransferase encoding gene FnPT1 (GenBank accession number: PNP74897.1). The full-length sequence of the gene was synthesized using a chemical synthesis method. Using pET28a-For (TGAGCAATAACTAGCATAACCCCTTGGG, SEQ ID NO.3) and pET28a-Rev (TAGTGAGTCGTATTAATTTCGCGGGATC, SEQ ID NO.4) as forward and reverse primers, and with the pET-28a *E. coli* expression vector as a template, the empty pET-28a fragment was amplified. Using T7-For (TAATACGACTCACTATAGGG, SEQ ID NO.5) and T7-Rev (GCTAGTTATTGCTCAGCGG, SEQ ID NO.6) as forward and reverse primers, and with the chemically synthesized FnPT1 gene sequence as a template (this template sequence was obtained from the NCBI protein database, search number PNP74897.1, subsequently synthesized by Sangon Biotech (Shanghai) Co., Ltd., and subsequently purchased from Sangon Biotech (Shanghai) Co., Ltd. for this application), the target FnPT1 gene fragment was amplified. High-fidelity PCR enzyme PrimeSTAR was used. ® Max DNA Polymerase amplification yielded the pET-28a empty vector fragment and the target gene FnPT1 fragment. Specific PCR systems and procedures were followed according to the instructions for the PCR enzymes used. The PCR-generated target gene products were subjected to agarose gel electrophoresis, and the results are shown below. Figure 1 As shown.

[0071] The obtained fragments (the amplified pET-28a empty vector fragment and the target gene FnPT1 fragment) were excised using the restriction endonuclease DPNI to remove the template DNA (the template DNA consisted of the pET-28a E. coli expression vector and the chemically synthesized FnPT1 gene sequence). This step aims to eliminate the influence of the template DNA on the subsequent ligation (this step can also be skipped). Refer to the instructions for the specific restriction enzyme for the recommended digestion system. The digested products were then processed using In-Fusion... ® Seamless ligation was performed using Snap Assembly MasterMix; the specific ligation system was described in the instructions for the ligase used. The ligation product was transformed into *E. coli* DH5α using the heat shock method. Positive single clones were initially screened by kanamycin resistance and colony PCR. Positive single clones were cultured, and plasmids were extracted using the Plasmid Mini Kit I. The extracted plasmids were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The correctly sequenced plasmid is the pET-28a vector containing the FnPT1 gene sequence.

[0072] Example 2: Expression and collection of recombinant FnPT1 protein

[0073] Recombinant plasmid pET-28a-FnPT1 was transformed into *E. coli* BL21(DE3) competent cells for protein overproduction. Cells were cultured in 2000 ml culture flasks containing 1000 ml liquid LB medium and 50 μg / ml kanamycin at 37°C and 200 rpm. When the culture grew to OD... 600 When the concentration reached 0.6-0.8, the cells were transferred to an ice-water bath for 45 min, and gene expression was induced with isopropyl-β-D-thiogalactoside (IPTG). The final concentration of IPTG was 0.2 mM, and the cells were cultured at 16 °C for 22 h. Cells were collected by centrifugation at 10,000 rpm for 5 min at 4 °C.

[0074] Cells were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM sodium chloride, 5% glycerol (v / v), 3 mM imidazole), with 20 ml of lysis buffer added per liter of cells. Cells were then sonicated on ice using an ultrasonic cell disruptor (NY-JY92-IIN, enpei, Changzhou, China) (55% power, on: 3 s, off: 3 s, for 45 min). To obtain soluble protein, the lysis buffer was centrifuged at 10,000 rpm for 15 min at 4°C. The supernatant was then passed through a Ni-NTA protein purification column. Contaminating proteins were removed using protein wash buffer (50 mM Tris-HCl, pH 7.5, containing 100 mM sodium chloride, 5% glycerol, and 20 mM imidazole), and the target protein was eluted using protein elution buffer (50 mM Tris-HCl, pH 7.5, containing 100 mM sodium chloride, 5% glycerol, and 250 mM imidazole). The elution buffer containing the target protein was concentrated using a 30 kDa centrifuge filter (Amicon Ultra-15, Millipore, Shanghai, China), and the concentrated protein was desalted using protein desalting buffer (50 mM Tris-HCl, pH 7.5, containing 100 mM sodium chloride, 10% glycerol, and 2 mM dithiothreitol). Protein concentration was determined using a micro spectrophotometer (Colibri, Berthold, Beijing, China). The purified protein was stored at -80°C and verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The results are shown below. Figure 38 As shown. Figure 38The supernatant is the supernatant collected by centrifugation after sonication of the cell lysis buffer; the precipitate is the sediment collected by centrifugation after sonication of the cell lysis buffer; the filtrate is the supernatant flowing through the Ni-NTA protein purification column; the washing buffer is the washing buffer to remove impurities; and the elution buffer is the elution buffer for eluting the target protein FnPT1.

[0075] Example 3: Catalytic activity of isopentenyltransferase FnPT1 on different flavonoid glycoside substrates

[0076] Using 15 different flavonoid glycosides as substrates, the corresponding chemical structural formulas are as follows: Figure 2 As shown. Enzyme activity reactions were performed in 150 µL batches to determine the relative activity against flavonoid glycosides. The reaction mixture contained 50 mM Tris-HCl (pH 7.5), 10 mM magnesium chloride, 500 µM substrate, 1 mM dimethyl allyl pyrophosphate (DMAPP), and 150 µg of purified isopentenyltransferase FnPT1. The negative control reaction mixture was the same, except that 150 µg of purified isopentenyltransferase FnPT1 was replaced with 150 µg of inactivated isopentenyltransferase FnPT1. The mixture was incubated at 37 °C for 4 h, followed by extraction with an equal volume of ethyl acetate (three times). The supernatant of the product was collected by centrifugation at 10,000 rpm, 4 °C for 5 min. The organic phase (supernatant) was then evaporated to dryness using a vacuum centrifuge (ZL3-1K, Kecheng, Hunan, China). The product was redissolved in 150 μl of acetonitrile and filtered through a 0.22 µm organic nylon microporous membrane to remove impurities before HPLC analysis.

[0077] HPLC analysis was performed using an Agilent InfinityLab Poroshell 120 SB-C18 column (3.0 × 100 mm, 2.7 μm, 600 bar) HPLC system (Hitachi / Chromaster, Japan). The flow rate was 0.5 ml / min, the column temperature was set to 30 °C, and the injection volume was 10 μl. The mobile phase consisted of solvent A (ultrapure water) and solvent B (acetonitrile). The elution program for HPLC analysis was as follows: 0–5 min, 10% B; 5–8 min, 10–35% B; 8–25 min, 35–70% B; 25–26 min, 70–100% B; 26–30 min, 100% B; 30–31 min, 100–10% B; 31–37 min, 10% B.

[0078] The isopentenyltransferase FnPT1 can catalyze the isopentenylation modification of five flavonoid glycosides, namely, safflower glycoside, genistein, trifolin glycoside, and buperidin, with the following results: Figures 3-12 As shown.

[0079] Example 4: Identification of products of sophoroside, belamcanda chinensis glycoside, genistein, trifolin glycoside, and styrax glycoside catalyzed by isopentenyltransferase FnPT1.

[0080] The products of sophoroside, irisin, genistein, trifolinin, and polygalin catalyzed by isopentenyltransferase FnPT1 were preliminarily identified using secondary mass spectrometry. Then, the products were separated and purified using a semi-preparative separation column, and identified by 1H NMR spectroscopy. The results are shown below. Figures 13-37 As shown in the figure and as shown in Table 1-5.

[0081] Table 1 shows the NMR assignments of 6C-isopentenyl juglucan.

[0082]

[0083] It should be noted that * in the table represents signal loss, and 2'' in the table represents a position with only one O and no C or H. Therefore, signals without C and H are represented as empty segments in the table. The same applies to empty segments in other tables.

[0084] Table 2 shows the NMR assignments of 4'-O-isopentenyl iridoside.

[0085]

[0086] Table 3 shows the NMR assignments of 6C-isopentenyl genistein.

[0087]

[0088] Table 4 shows the NMR assignments of 4O-isopentenyltrifolin.

[0089]

[0090] Table 5 shows the NMR assignments of 4'-O-isopentenyl cuspidatum glycoside.

[0091]

[0092] Mass spectrometry analysis was performed using an ion trap time-of-flight mass spectrometer (LCMS-IT-TOF, Shimadzu, Japan) equipped with an ACQUITY UPLC HSS-C18 column (2.1 × 150 mm, 1.8 μm). The mobile phase consisted of solvent A (ultrapure water containing 0.5% formic acid) and solvent B (acetonitrile). The elution program was as follows: 0–3 min, 10% B; 3–16 min, 10–95% B; 16–20 min, 95% B; 20–21 min, 95–10% B; 21–27 min, 10% B. In positive ion mode, ionization of the analyte was achieved using an electron spray ionization interface with a collision voltage of 50 eV. The mass scan range was set to m / z 100–1000.

[0093] Semi-preparative conditions: Agilent ZORBAX SB-C18 column (9.4 × 150 mm, 5 μm); flow rate 4 mL / min; injection volume 500 μL; mobile phase A was ultrapure water, mobile phase B was methanol; gradient elution program was 0–2 min, 10% B; 2–6 min, 10–45% B; 6–13 min, 45–50% B; 13–40 min, 50–70% B; 40–60 min, 70–100% B.

[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit them. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of this application.

Claims

1. A method for synthesizing an isopentenyl-modified product, characterized in that, Includes the following steps: Flavonoid glycoside substrates and isopentenyl donors were mixed with isopentenyl transferase FnPT1 to generate isopentenyl modified products. The flavonoid glycoside substrate is selected from at least one of irisin, genistein, trifolinin, and polygalin; the isopentenyl donor is dimethylallyl pyrophosphate. The nucleotide sequence of the isopentenyltransferase FnPT1 is shown in SEQ ID NO.1; the amino acid sequence of the isopentenyltransferase FnPT1 is shown in SEQ ID NO.

2. Catalyzing the formation of 4'O-isopentenyl iridoside from belamcanda chinensis; catalyzing the formation of 6C-isopentenyl iridoside from genistein; catalyzing the formation of 4O-isopentenyl trifolin from trifolin; catalyzing the formation of 4'O-isopentenyl trifolin from polydipsia glycoside.

Images