Application of SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 7 and related to pig lactation ability
By identifying the SNP molecular marker rs699535761 (g. 112468621 A>G) on pig chromosome 7, the problem of the difficulty in rapidly improving sow lactation capacity using traditional breeding methods was solved, achieving rapid improvement in sow lactation capacity and accelerating the breeding process, thereby increasing piglet survival rate and breeding efficiency.
Patent Information
- Application Number
- CN202511869042.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-11
- Publication Date
- 2026-02-10
AI Technical Summary
Traditional phenotypic breeding methods are difficult to quickly improve sow lactation capacity, leading to malnutrition and decreased survival rate of piglets, which cannot meet the needs of modern pig farming for rapid and efficient improvement.
The SNP molecular marker rs699535761 (g. 112468621 A>G) located on chromosome 7 of pigs was provided. Pigs with the genotype GG of this SNP molecular marker were selected for breeding to improve the lactation capacity of sows.
It significantly improves the total litter weight gain and lactation capacity of sows at 7 days of age, shortens the breeding process, increases the survival rate and weaning weight of piglets, and improves the efficiency and economic benefits of breeding production.
Smart Images

Figure CN121496069A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular markers, and relates to application of a SNP molecular marker related to lactation capacity of pigs on a pig chromosome 7. BACKGROUND
[0002] At present, sow reproductive performance has become one of the core indicators of attention in the pig industry. With the iteration of genetic improvement technology and the improvement of feeding management level, the litter size of sows has increased significantly, but the survival rate of piglets has decreased, and the weaning weight of piglets does not meet the standard. This is because the increase in litter size puts higher requirements on the lactation capacity of sows, and insufficient milk supply will directly lead to nutritional deficiency of piglets, and further lead to a decrease in survival rate.
[0003] Therefore, while pursuing high reproductive capacity, it is particularly important to improve the lactation performance of sows. Good lactation capacity not only ensures the nutritional supply of piglets, improves the survival rate, but also promotes the increase of weaning weight and the improvement of group uniformity, thereby shortening the fattening cycle and improving the overall production efficiency of breeding. High lactation capacity sows can also significantly reduce the dependence on starter feed, reduce feed consumption and waste, reduce feeding costs, and help reduce energy consumption and emissions, promoting the development of the pig industry towards green and sustainable direction.
[0004] However, lactation capacity, as a typical quantitative trait, is regulated by multiple genes and is easily affected by environmental factors. Traditional phenotypic selection methods are slow and time-consuming, and are difficult to meet the rapid and efficient improvement needs of modern pig industry.
[0005] In production practice, the total weight gain of 7-day-old litters is generally used as a phenotypic index of sow lactation performance. Compared with the total weight gain of 21-day-old litters, the total weight gain of 7-day-old litters can more accurately reflect the early lactation capacity of sows. At this stage, piglets mainly rely on milk supply, and the growth rate is obviously affected by the milk yield of sows, while at 21 days of age, some piglets have started to eat solid feed and are easily disturbed by exogenous nutrition. Therefore, the total weight gain of 7-day-old litters can be used as a direct and stable index to evaluate the nutritional supply capacity of sows during lactation. SUMMARY
[0006] The purpose of the present application is to provide a SNP molecular marker located on pig chromosome 7 and significantly related to the lactation capacity of pigs and the application thereof.
[0007] According to one aspect of the present application, a SNP molecular marker related to the lactation capacity of pigs located on pig chromosome 7 is provided, the site of which is rs699535761, corresponding to the A>G mutation (single base mutation, also named as: g. 112468621 A>G) at position 112468621 bp on chromosome 7 of the international pig reference genome version 11.1; the genotype of the SNP molecular marker is AA, GA or GG.
[0008] The SNP molecular marker provided by this invention is significantly correlated with the lactation capacity of sows. Specifically, sows with the GG genotype have significantly higher lactation capacity than sows with the AA and GA genotypes. Therefore, by identifying the single nucleotide polymorphism of this SNP molecular marker and / or the genotype of this SNP molecular marker, the total litter weight gain and / or lactation capacity traits at 7 days of age can be identified in pigs. Furthermore, by selecting pigs with the GG genotype of the SNP molecular marker, the pig breeding process can be accelerated, achieving genetic improvement in pigs.
[0009] According to a second aspect of the present invention, an application is provided for detecting the SNP molecular markers of the present invention, the application comprising at least one of the following items (1) to (6): (1) Identify the total litter weight gain of pigs at 7 days of age; (2) Prepare products for identifying the total litter weight gain of pigs at 7 days of age; (3) Identify the lactation capacity trait of pigs; (4) Prepare products for identifying the lactation performance traits of pigs; (5) Pig genetic improvement, based on the selection of pigs with the SNP molecular marker genotype GG to improve the total litter weight gain and milk production at 7 days of age; (6) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of the genotype of the SNP molecular marker of the present invention to assist in the genetic improvement of pigs.
[0010] In some embodiments, the product for detecting the SNP molecular markers of the present invention may include at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers of the present invention.
[0011] In some embodiments, the reagents used to detect the SNP molecular markers of the present invention may include at least one of the following: primers or probes for detecting the SNP molecular markers of the present invention.
[0012] In some embodiments, the primer pair used to detect the SNP molecular markers of the present invention includes an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer pair can specifically amplify a fragment containing the single nucleotide polymorphism at position 36 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to identify whether the single nucleotide at position 36 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 112468621 bp on chromosome 7 of the International Pig Reference Genome Version 11.1, is A or G.
[0013] In some embodiments, the kit for detecting the SNP molecular markers of the present invention may include primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, as well as dNTPs, DNA polymerase, and Mg. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.
[0014] In some implementations, the pig is a Large White pig.
[0015] According to a third aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 7 of pigs that are associated with pig lactation; (2) Select individuals with the SNP molecular marker genotype GG and eliminate individuals with the genotypes AA and GA, so as to increase the frequency of the allele G at the SNP molecular marker locus in each generation, thereby improving the lactation capacity of offspring pigs.
[0016] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.
[0017] In some implementations, the pig in step (1) is a Large White pig.
[0018] In some implementations, step (1), determining the genotype of the SNP molecular marker on chromosome 7 of the pig that is associated with pig lactation capacity, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were sequenced, and the single nucleotide type of the SNP molecular marker site in the pig was determined based on the sequencing results, thus identifying the genotype of the SNP molecular marker.
[0019] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides a SNP molecular marker g.112468621 A>G located on chromosome 7 of pigs that is related to pig lactation capacity, and verifies its effect on pig lactation capacity trait. It helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of pig lactation capacity trait, realize rapid improvement of sow lactation performance, improve piglet survival rate and weaning weight, thereby accelerating the breeding process of Large White pig breed, meeting the needs of the pig industry for reproductive performance and production efficiency, and ultimately improving breeding efficiency and enterprise core competitiveness.
[0020] (2) This invention provides a method for pig genetic improvement by selecting the dominant allele of the SNP molecular marker g.112468621 A>G located on chromosome 7 of pigs and associated with pig lactation. By selecting the dominant allele G of this SNP, the genetic progress of Large White pigs can be accelerated, the breeding cycle can be shortened, and thus the reproductive performance of sows and the economic benefits of breeding can be effectively improved. The results show that there are significant differences in lactation traits among different genotypes of sows. Using the total litter weight gain at 7 days of age as the phenotypic indicator of lactation, the average total litter weight gain at 7 days of age of GG sows was 15.72 kg, which was significantly higher than that of GA sows (11.83 kg) and AA sows (11.87 kg). Compared with AA sows, GG sows gained an average of about 3.85 kg more per litter, an increase of about 32.4%, and their lactation capacity and breeding efficiency were significantly improved. If, during the breeding process, individuals of the AA type (SNP molecular marker g.112468621 A>G) that affect lactation capacity are gradually selected to become GG type individuals, it can significantly increase sow milk production and promote the improvement of piglet weaning weight and uniformity. Under the conditions of large-scale pig farms with tens of thousands of pigs, this improvement will result in a large number of weaned piglets gaining extra weight, providing significant economic benefits to the pig farming industry, ultimately improving enterprise efficiency and enhancing core competitiveness. Attached Figure Description
[0021] Figure 1 This is a genome-wide association study (GWAS) plot of porcine lactation capacity on chromosome 7 in French Large White sows; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value; Figure 2 This is a graph showing the results of the analysis of differences in lactation capacity among different genotypes of pigs; among them, ** express P <0.001. Detailed Implementation
[0022] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.
[0023] Example 1: Identification and Validation of SNP Molecular Markers Related to Porcine Lactation Capacity (1) Experimental pig herd The experimental pig population used in this invention consisted of 98 purebred French Large White sows from Guangdong Guangken Livestock Group Co., Ltd., representing the core group of the breeding pig division. The herd's pedigree was meticulously recorded, and all individuals were in good condition and exhibiting normal production performance. The pigs were raised under standardized conditions. They had free access to feed and water, and the feeding methods and rearing conditions were all conventional.
[0024] (2) Phenotypic measurement Record the parity, total number of piglets born, number of live piglets, and number of piglets at 7 days of age of the sows. Collect ear samples from the sows and store them in cryovials at -80°C.
[0025] At the same time, the birth weight and total litter weight gain at 7 days of age of 1,649 piglets were measured.
[0026] This invention uses total litter weight gain (kg) at 7 days of age as an indicator of lactation capacity. Since total litter weight gain at 7 days of age is affected by piglet mortality, introduction, and emigration, to ensure the accuracy of the lactation phenotype, this invention sets the formula for determining lactation capacity as follows: Lactation capacity (kg) = Total litter weight gain at 7 days of age (kg) = Piglet weight at pen (7-day weight - Birth weight) + Death weight (Death weight - Birth weight) + Introduction weight (7-day weight - Piglet weight at introduction) + Exit weight (Exit weight - Birth weight).
[0027] (3) Extraction of porcine genomic DNA Ear tissue samples from each French Large White pig were collected to extract whole-genome DNA using the standard phenol-chloroform method. The DNA from 98 purebred French Large White pigs was analyzed for quality and concentration using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.
[0028] (4) Pig SNP genotyping Whole-genome resequencing of a pig population was performed using the BGI Genomics T7 platform at a sequencing depth of 15×, yielding raw paired-end sequencing data. The sequencing sequences were aligned to the international pig reference genome version 11.1 using BWA software, and variant detection was performed using GATK to obtain an initial SNP dataset. Subsequently, preliminary quality control of the SNPs was performed using bcftools and GATK VariantFiltration. Loci with quality depth (QD) less than 2.0, alignment quality (MQ) less than 40.0, Fisher's exact test (FS) greater than 60.0, sequence relative error (SOR) greater than 3.0, alignment quality rank deviation (MQRankSum) less than -12.5, and read position deviation (ReadPosRankSum) less than -8.0 were all removed. The original number of SNPs was 19,862,545. This step effectively removed low-quality and potentially erroneous SNPs, allowing for the construction of high-confidence genotypes.
[0029] Further rigorous quality control of the genotype data was performed using PLINK v1.9, specifically: SNPs with a deletion rate exceeding 15% were removed; individuals with a deletion rate exceeding 10% were removed; SNPs with a minor allele frequency less than 0.01 were removed; and deviations from Hardy-Weinberg equilibrium were observed. P ≤10 -6 High-quality SNPs and individual data obtained after quality control were used for subsequent population genetics and association analysis.
[0030] (5) Genome-wide association analysis (GWAS) To reduce the influence of population stratification and kinship on the results, this invention employs GEMMA software for linear mixture model (LMM) single-marker regression analysis. A genome similarity matrix is introduced as a random effect in the model to correct for population stratification effects, achieving genome-wide association analysis of the lactation trait. Referring to the significance threshold of the human genome, the significance threshold for the association between SNPs and the lactation trait is set to 1 × 10⁻⁶. -5 .
[0031] GWAS analysis results are as follows Figure 1 As shown.
[0032] from Figure 1 It is known that in Large White pigs, there is a significant SNP on chromosome 7 that affects the trait of lactation (total litter weight gain at 7 days of age), with the strongest association being g. 112468621 A>G (rs699535761, P =3.1×10 -6The nucleotide sequence shown in SEQ ID NO:1 is the 36th nucleotide from the 5' end, corresponding to the A>G mutation at position 112468621 bp on chromosome 7 of the International Pig Reference Genome Version 11.1.
[0033] (6) Analyze the association between different genotypes and the lactation capacity (total litter weight gain at 7 days of age) phenotype of Large White pigs to verify the effect of the SNP molecular marker g. 112468621 A>G on the lactation capacity (total litter weight gain at 7 days of age) trait of sows. The results are shown in Table 1. Figure 2 As shown.
[0034] Table 1 shows that the SNP site g. 112468621 A>G is highly significantly correlated with lactation capacity (total litter weight gain at 7 days of age). P The value <0.01 indicates that this molecular marker significantly affects the lactation capacity of pigs. Assisted selection at this SNP site in pigs can increase the lactation capacity of the population, thereby accelerating the breeding process of Large White pigs.
[0035] Additionally, according to Table 1, Figure 2 It is also known that the average lactation capacity of individuals with the GG type is significantly higher than that of individuals with the GA and AA types.
[0036] As a key indicator for measuring the reproductive performance of breeding pigs and the growth performance of their offspring, lactation capacity directly affects the nutritional supply to piglets. Sows with strong lactation capacity can provide piglets with more milk, which not only effectively promotes healthy growth and development but also further improves their weaning survival rate, laying the foundation for increased livestock production efficiency. Therefore, in the breeding process, it is necessary to gradually cull AA and AG type sows while retaining GG type sows to increase the frequency of the G allele at this locus generation by generation, thereby improving the overall lactation capacity of the herd and promoting increased pig production efficiency.
[0037] Table 1 Correlation analysis between SNP molecular markers and traits
[0038] (7) Effect analysis This invention provides a SNP molecular marker that can significantly improve the lactation performance of Large White pigs. Using this molecular marker for marker-assisted selection can effectively accelerate the improvement of lactation performance in Large White and other breeds of sows. If individuals with the AA and GA types of molecular markers affecting lactation performance are gradually selected into GG types, the milk yield of sows can be significantly increased, leading to higher weaning weight and survival rate of piglets.
[0039] Lactation capacity is a crucial indicator of sow reproductive performance and piglet health. Good lactation performance not only improves piglet survival rate, weaning weight and uniformity, but also shortens the fattening cycle and reduces creep feed demand and feeding costs. Therefore, improving sow lactation capacity offers significant economic benefits and sustainable development potential for the pig industry. Utilizing the SNP molecular markers of this invention, and by selecting dominant alleles (G), the overall production efficiency of commercial pigs can ultimately be improved, thereby increasing enterprise profits and enhancing core competitiveness.
[0040] Example 2: Methods for genetic improvement of pigs The nucleotide sequence of the target fragment containing the SNP molecular marker g. 112468621 A>G associated with porcine lactation capacity is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.
[0041] SEQ ID NO:1 CGATTAGACCCCTAGCCTGGGAACCTCCATATGCC R TGAGAGCGGCCCTAGAAAAGGCAAAAAGACAAAAAAAAAAGAAAGAAATTGCTGTTTTCCTTCCCAAGTCAGCATACTCTTATTAGGAGATGCGCATGTGTGCACCCCCACCCCACCCACTTATAA In this sequence, R indicates a mutation site, which can be A or G, representing an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.
[0042] Upstream primer-F: 5'-CGATTAGACCCCTAGCCTGG-3' (SEQ ID NO:2); Downstream primer-R: 5'- TTATAAGTGGGGTGGGGTGG-3' (SEQ ID NO:3).
[0043] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of SNP molecular markers related to lactation in pigs. (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.
[0044] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.
[0045] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.
[0046] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 36 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 112468621 bp on chromosome 7 of the International Swine Reference Genome Version 11.1, was A or G, thus determining the genotype of the pig to be tested with the SNP molecular marker g. 112468621 A>G.
[0047] S2. Select pigs with the SNP molecular marker genotype GG as parents for breeding.
[0048] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.
Claims
1. The application of a product for detecting SNP molecular markers located on porcine chromosome 7 that are associated with porcine lactation capacity, characterized in that, The SNP molecular marker site is rs699535761, and the application includes at least one of the following items (1) to (6): (1) Identify the total litter weight gain of pigs at 7 days of age; (2) Prepare products for identifying the total litter weight gain of pigs at 7 days of age; (3) Identify the lactation capacity trait of pigs; (4) Prepare products for identifying the lactation performance traits of pigs; (5) Pig genetic improvement, based on breeding pigs with the SNP molecular marker genotype GG to improve the total litter weight gain and / or lactation capacity at 7 days of age; (6) Prepare a product for assisting in the genetic improvement of pigs, said product being based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pigs.
2. The application according to claim 1, characterized in that, The product for detecting SNP molecular markers located on porcine chromosome 7 that are associated with porcine lactation includes at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.
3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.
4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:
3.
5. The application according to any one of claims 1 to 4, characterized in that, The pig in question is a Large White pig.
6. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 7 of pigs that are associated with pig lactation; (2) Select individuals with the SNP molecular marker genotype GG; The site of the SNP molecular marker is rs699535761.
7. The method for genetic improvement of pigs according to claim 6, characterized in that, In step (1), the method for determining the genotype of the SNP molecular markers related to porcine lactation located on chromosome 7 includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:
3. The amplification products were sequenced, and the genotypes of SNP molecular markers related to pig lactation located on pig chromosome 7 were determined based on the sequencing results.
8. The method for genetic improvement of pigs according to claim 6 or 7, characterized in that, The pig in question is a Large White pig.