A recombinant lactobacillus casei expressing a sialyltransferase st6galnac1

Abstract

The application discloses a recombinant lactobacillus casei expressing sialyltransferase ST6GALNAC1, and belongs to the field of genetic engineering and microbial technology. The recombinant bacterium is obtained by cloning the ST6GALNAC1 gene into a pPG612 vector and electrotransforming the ST6GALNAC1 gene into lactobacillus casei ATCC393. Experiments show that the engineering bacterium can significantly enhance glycosylation modification of intestinal mucus protein MUC2, improve expression of tight junction proteins (ZO-1, Occludin and Claudin-1), inhibit activation of a p38 / MAPK inflammatory pathway, and regulate intestinal flora structure, thereby effectively relieving intestinal injury and systemic inflammatory response caused by salmonella. The application provides a strain basis and technical support for development of a new type of oral microecological preparation.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and microbial technology, and in particular to a recombinant Lactobacillus casei expressing sialyltransferase ST6GALNAC1. Background Technology

[0002] Salmonella typhimurium ( Salmonella typhimurium As a Gram-negative enteric pathogen, the global prevalence of this bacterium poses a significant public health challenge. Epidemiological data shows that this bacterium causes approximately 93 million cases of gastroenteritis worldwide each year, of which about 150,000 develop into fatal systemic infections. Its pathogenicity stems from multiple virulence mechanisms: firstly, it invades intestinal epithelial cells through adhesins (such as FimA) and invaders (such as InvA) mediated by the type III secretion system (T3SS); secondly, it survives within host cells and forms a replication microenvironment using SPI-2 virulence island-related effector proteins (such as SifA). More seriously, the latest WHO monitoring shows that the bacterium has reached a resistance rate of 65% to fluoroquinolones and over 40% to third-generation cephalosporins, making the development of alternative therapies an urgent priority.

[0003] Probiotics, as beneficial microorganisms, have been extensively studied and applied to regulate the gut microbiota and enhance host immune function. They inhibit the growth and colonization of pathogens through various mechanisms, including competing for adhesion sites, secreting antimicrobial substances, and regulating immune responses. In recent years, the development of genetically engineered probiotics has provided new insights into the prevention and treatment of intestinal pathogen infections. By introducing specific functional genes into probiotics, their ability to fight pathogens can be enhanced, while reducing dependence on traditional antibiotics and lowering the risk of drug resistance.

[0004] The intestinal physiological barrier is a crucial foundation for defense against pathogenic bacterial infections. The mucus layer formed by mucin secreted by goblet cells is the first line of defense, and maintaining its physiological and immunological functions is essential. However, mucin is highly susceptible to damage by pathogens, partly due to the inhibited glycosylation modification of MUC2, which is severely disrupted by pathogens. Therefore, strengthening or maintaining the normal function of MUC2 glycosylation modification has become a potential target for preventing and controlling intestinal pathogenic bacterial infections. Mucin is an important component of the intestinal mucosal barrier, with MUC2 being the main gel-forming mucin secreted by goblet cells. The O-glycan modification of MUC2 plays a central role in the mucus barrier function; the diversity and complexity of its glycan structure enable it to regulate the interaction between the host and microorganisms. Pathogenic bacteria such as Salmonella Typhimurium (… Salmonella typhimuriumMucin can weaken the mucus layer by breaking down mucins, thereby disrupting the intestinal barrier function. Furthermore, the glycosylation modification of mucins is closely related to pathogen adhesion and virulence. For example, the O-glycans of MUC2 can influence pathogenicity by modulating pathogen adhesion and virulence. Therefore, maintaining the glycosylation modification of MUC2 not only helps enhance the barrier function of the mucus layer but also inhibits pathogen infection by modulating pathogen adhesion and virulence.

[0005] Probiotics such as *Lactobacillus casei* have the effect of regulating intestinal immunity and barrier function, but their natural strains have limited anti-infective capabilities. ST6GALNAC1 is a sialyl transferase that can enhance the glycosylation modification of mucin MUC2 and improve mucus barrier function. Literature searches have revealed no research reports on the introduction of the ST6GALNAC1 gene into *Lactobacillus casei* for the purpose of combating Salmonella infection. Summary of the Invention

[0006] The purpose of this invention is to provide a recombinant Lactobacillus casei expressing sialyltransferase ST6GALNAC1 and its application in enhancing intestinal barrier function and resisting Salmonella infection, thereby addressing the problems existing in the prior art. This invention develops a novel biological agent based on genetically engineered probiotics, which achieves multi-dimensional prevention and control of Salmonella infection by enhancing MUC2 glycosylation modification, repairing the intestinal barrier, regulating mucosal immunity, and reshaping the microbiota balance, thus replacing or adjuvanting traditional antibiotic therapy.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] One of the technical solutions of the present invention is a recombinant expression vector of the sialyl transferase ST6GALNAC1 gene, wherein the recombinant expression vector uses the Lactobacillus shuttle vector pPG612 as a backbone and contains the sialyl transferase ST6GALNAC1 gene.

[0009] The nucleotide sequence of the sialyl transferase ST6GALNAC1 gene is shown in SEQ ID NO.3.

[0010] The second technical solution of the present invention is a recombinant Lactobacillus casei with the sialyltransferase ST6GALNAC1 gene, wherein the recombinant Lactobacillus casei is Lactobacillus casei ATCC393 as the starting strain and contains the recombinant expression vector.

[0011] The third technical solution of the present invention is the application of the recombinant expression vector or the recombinant Lactobacillus casei in the preparation of sialic acid transferase.

[0012] The fourth technical solution of the present invention is a method for preparing sialyl transferase, which uses the recombinant expression vector or the recombinant Lactobacillus casei to prepare sialyl transferase under the induction of lactose.

[0013] The fifth technical solution of the present invention is the application of the recombinant expression vector or the recombinant Lactobacillus casei in the preparation of drugs for preventing and treating diseases caused by Salmonella typhimurium.

[0014] The sixth technical solution of the present invention is a drug for preventing and treating diseases caused by Salmonella typhimurium, comprising the recombinant expression vector or the recombinant Lactobacillus casei.

[0015] Based on the above technical solution, the present invention has the following technical effects:

[0016] 1. The novel functional engineered probiotic LC-pPG-ST6 constructed in this invention significantly enhances the adhesion and invasion ability of LS174T intestinal epithelial cells by expressing the sialyl transferase ST6GALNAC1 gene in Lactobacillus casei ATCC393. Its adhesion rate reaches 7.59%, approximately 1.55 times higher than wild-type Lactobacillus casei (4.88%), and significantly higher than Salmonella typhimurium (5.83%). It competitively inhibits the adhesion and invasion of Salmonella typhimurium onto intestinal epithelial cells, laying the foundation for the engineered bacteria to establish sustained colonization in the intestine and interact efficiently with intestinal epithelial cells. This solves the problems of traditional probiotics having weak intestinal colonization ability and difficulty in effectively antagonizing pathogenic bacteria.

[0017] 2. In the context of Salmonella typhimurium infection, the novel functional engineered probiotic LC-pPG-ST6 can significantly repair and enhance the intestinal epithelial cell barrier function. In in vitro experiments, it upregulated the expression of tight junction proteins Claudin-1, Occludin, and ZO-1 in LS174T cells by 0.52-fold, 5.1-fold, and 0.95-fold, respectively; increased the mRNA expression of the MUC2 gene by 0.88-fold; and increased the expression of glycosyltransferase genes B3GNT6 and C1GALT1 by 0.45-0.82-fold. In in vivo experiments, the expression of tight junction proteins ZO-1, Claudin-1, and Occludin in mouse ileum tissue was upregulated by 0.37-fold, 2.38-fold, and 4.02-fold, respectively, compared with the infection group; the mRNA expression of the MUC2 gene increased by 1.93-fold; and the expression of glycosyltransferase genes B3GNT6 and C1GALT1 increased by 2.53-fold and 36.82-fold, respectively. Meanwhile, this engineered bacterium can specifically inhibit the activation of the p38 / MAPK signaling pathway, reducing the p-p38 level in in vitro cells by 31% and the p38 level in mouse ileum tissue by 71% and the p-p38 level by 62% in vivo. It effectively blocks the transduction of inflammatory signals and solves the problem of intestinal barrier damage and excessive activation of inflammatory response caused by pathogenic bacterial infection. It has a more significant effect on barrier function repair than wild-type Lactobacillus casei.

[0018] 3. Using LC-pPG-ST6 as a functional delivery vector, oral inoculation can efficiently activate host mucosal and systemic immune responses. Flow cytometry analysis showed that it can increase IgA levels in the spleen, mesenteric lymph nodes, and Peyer's aggregated lymph nodes of mice. + B cell count increased 1.5-2.3 times, CD80 + CD86 + CD11c + The number of dendritic cells increased 2.02-2.36 times, CD3 + CD8 + The number of T cells increased by 2.12-2.79 times. ELISA showed that the serum IgG concentration in mice reached (10.49±1.54) g / L, and the IL-10 level increased to (135.64±0.32) pg / mL, significantly higher than that in the infection group. The serum TNF-α and IL-1β levels decreased to (34.06±2.14) pg / mL, significantly lower than those in the infection group. qPCR showed that the mRNA levels of TNF-α, IL-1β, and IL-6 genes in the mouse intestinal group decreased by 93%, 90%, and 99%, respectively. In addition, this engineered bacterium can regulate the structure of the intestinal flora, increase the abundance of Firmicutes, Bacteroidetes, and Lactobacillus, decrease the relative abundance of Salmonella, enrich the diversity of the intestinal flora, effectively alleviate the intestinal pathological damage caused by Salmonella typhimurium, increase the number of goblet cells, and maintain the integrity of the intestinal wall and villi. Compared to the shortcomings of traditional antibiotic treatments, such as difficulty in eliminating intracellular bacteria and easy induction of drug resistance, this engineered bacterium has multiple functions including immune activation, anti-inflammation, and microbiota regulation. It can be used as an oral probiotic for the prevention and control of Salmonella infection in livestock and poultry farming and for the intervention of intestinal infection-related diseases in humans. It can reduce antibiotic use and lower the risk of drug resistance. It has broad application prospects in the fields of medicine, animal husbandry, and food health care, and can generate significant social and economic benefits. Attached Figure Description

[0019] Figure 1 PCR amplification of the ST6 gene. Note: M: DL 2000 DNA Marker; 1: ST6; 2: Negative control.

[0020] Figure 2 PCR identification of recombinant plasmid pEASY-ST6. Note: M: DL 2000 DNA Marker; 1: pEASY-ST6; 2: negative control; 3: blank control.

[0021] Figure 3 PCR identification of recombinant plasmid pPG-ST6. Note: M: DL 2000 DNA Marker; 1-6: pEASY-ST6; 7: negative control.

[0022] Figure 4PCR identification of engineered probiotic Lc-pPG-ST6. Note: M: DL 5000 DNA Marker; 1-4: Lc-pPG-ST6; 5: negative control.

[0023] Figure 5 Identification of the engineered probiotic Lc-pPG-ST6 by double enzyme digestion. Note: M: DL 5000 DNA Marker; 1: Lc-pPG-ST6.

[0024] Figure 6 Western blot identification of the engineered probiotic LC-pPG-ST6. Note: M: protein marker; 1-2: LC-pPG-ST6; 3-4: negative control.

[0025] Figure 7 Immunofluorescence. Note: A: LC control; B: LC-pPG-ST6.

[0026] Figure 8 The effect of engineered probiotics on the survival rate of LS174T cells at different time points. Note: A: Co-culture for 2 h; B: Co-culture for 4 h; C: Co-culture for 6 h; D: Co-culture for 8 h.

[0027] Figure 9 The results show the adhesion ability of engineered probiotics.

[0028] Figure 10 To test the competitive invasion ability of engineered probiotics.

[0029] Figure 11 The effect of engineered probiotics on the expression of related proteins in LS174T cells. Note: A represents the Western blot results of Occludin, ZO-1, CLDN2, Claudin-1, p-38, p-p38, RhoB, and HSP90 proteins in cells; B and I represent the grayscale analysis results of protein expression after co-incubation of engineered bacteria and pathogenic bacteria: B: Occludin, C: ZO-1, D: CLDN2, E: Claudin-1, F: p-38, G: p-p38, H: RhoB, and I: HSP90 proteins.

[0030] Figure 12 The results show the effects of engineered probiotics on LS174T cells. Note: A: IL-6, B: IL-1β, C: TNF-α, D: IL-17, E: CXCL1, F: RT-PCR detection results of CCL2 gene mRNA levels.

[0031] Figure 13The results show the effects of engineered probiotics on LS174T cells. Note: A: Claudin-1, B: Occludin, C: ZO-1, D: CLDN-2 gene mRNA level RT-PCR detection results.

[0032] Figure 14 The results are from RT-PCR detection of p38 gene mRNA levels.

[0033] Figure 15 These are the results of RT-PCR detection of glycosylation transferase-related genes. Note: A: Fut-1; B: Fut-2; C: Fut-3; D: C2GnT1; E: C2GnT2; F: C2GnT3; G: B3GNT6; H: C1GALT1; I: GALNACT1; J: ST6GALNAC1; K: ST6GALNAC2.

[0034] Figure 16 The results are from RT-PCR detection of the MUC2 gene mRNA level.

[0035] Figure 17 The results show the detection of CD11c-positive dendritic cells in SP, MLN, and PPs. Note: A: SP; B: MLN; C: PPs.

[0036] Figure 18 The results show the detection of CD45 and IgA-positive B cells in SP, MLN, and PPs. Note: A: SP; B: MLN; C: PPs.

[0037] Figure 19 The results show the detection of CD3 and CD8 positive T cells in SP, MLN, and PPs. Note: A: SP; B: MLN; C: PPs.

[0038] Figure 20 The results show the expression of goblet cells in mouse intestinal epithelial cells. Note: A: Scatter plot of goblet cell flow cytometry detection in intestinal tissue of mice in each group; B: Detection results of goblet cell count in intestinal tissue of mice in each group.

[0039] Figure 21 The results show the expression of Paneth-like cells in mouse intestinal epithelial cells. Note: A: Scatter plot of Paneth-like cells detected by flow cytometry in intestinal tissue of mice in each group; B: Detection results of the number of Paneth-like cells in intestinal tissue of mice in each group.

[0040] Figure 22This study investigated the effects of a novel functional probiotic on the expression of tight junction proteins in the mouse gut. Note: A: Western blot analysis results of Occludin, ZO-1, Claudin-1, and β-actin protein expression levels; B: Gray-value analysis results of Occludin protein expression; C: Gray-value analysis results of ZO-1 protein expression; D: Gray-value analysis results of Claudin-1 protein expression.

[0041] Figure 23 The effect of novel functional probiotics on the expression of gut-associated proteins in mice. Note: A: Western blot results of p-38, p-p38, and β-actin protein expression levels; B: Gray-scale analysis results of p-38 protein expression; C: Gray-scale analysis results of p-p38 protein expression.

[0042] Figure 24 This study investigated the effects of a novel functional probiotic on the expression of glycosylation-related proteins in mice. Note: A: Western blot results of RhoB and β-actin protein expression levels; B: Gray-scale analysis results of RhoB protein expression.

[0043] Figure 25 The results are from an ELISA assay of IgG levels in mouse serum.

[0044] Figure 26 Results of RT-PCR detection of inflammation-related factors in mouse ileum tissue. Note: A: IL-6; B: TNF-α; C: IL-1β; D: CXCL1; E: CCL2; F: Reg3b; G: Reg3g.

[0045] Figure 27 The results of ELISA detection of serum IL-10 (A), TNF-α (B) and IL-1β (C) levels in mice are presented.

[0046] Figure 28 The results are from RT-PCR detection of genes related to the innate immune signaling pathway in the mouse gut.

[0047] Figure 29 The results show the RT-PCR detection of the expression level of tight junction protein genes in mouse intestines. Note: A: ZO-1; B: Occludin; C: Claudin1.

[0048] Figure 30 The results are from RT-PCR detection of glycosylation-related gene expression in mice. Note: A: Fut-1; B: Fut-2; C: st3gal4; D: C1GALT1; E: B3GNT6; F: Tff3; G: chst4; H: ST6GALNAC1.

[0049] Figure 31 The results of RT-PCR detection of MUC2 expression level in mouse ileum.

[0050] Figure 32 The results show the monitoring of changes in mouse body weight.

[0051] Figure 33 The images show the histopathological images of the duodenum of mice in each group.

[0052] Figure 34 The images show histopathological images of the jejunum of mice in each group.

[0053] Figure 35 The images show histopathological images of the ileum of mice in each group.

[0054] Figure 36 The images show histopathological images of the colon of mice in each group.

[0055] Figure 37 Results of colonic goblet cell staining in mice. Note: A: AB-PAS staining results of colonic goblet cells in each group of mice; B: Detection results of colonic goblet cell count in each group of mice.

[0056] Figure 38 The results of immunohistochemical detection of p-38 positive cells in mouse intestinal tissue are shown. Note: A: IHC microscopic examination results of p-38 positive cells in mouse intestinal tissue of each group; B: Analysis of the number of p-38 positive cells in mouse intestinal tissue of each group.

[0057] Figure 39 The results of immunohistochemical detection of p-p38 positive cells in mouse intestinal tissue are shown. Note: A: IHC microscopic examination results of p-p38 positive cells in mouse intestinal tissue of each group; B: Analysis of the number of p-p38 positive cells in mouse intestinal tissue of each group.

[0058] Figure 40 The results of immunohistochemical detection of Claudin-1 positive cells in mouse intestinal tissue are shown. Note: A: IHC microscopic examination results of Claudin-1 positive cells in mouse intestinal tissue of each group; B: Analysis of the number of Claudin-1 positive cells in mouse intestinal tissue of each group.

[0059] Figure 41 Immunohistochemical staining results of Occludin-positive cells in mouse intestinal tissue. Note: A: IHC microscopic examination results of Occludin-positive cells in mouse intestinal tissue of each group; B: Analysis of the number of Occludin-positive cells in mouse intestinal tissue of each group.

[0060] Figure 42The results of immunohistochemical detection of ZO-1 positive cells in mouse intestinal tissue are shown. Note: A: IHC microscopic examination results of ZO-1 positive cells in mouse intestinal tissue of each group; B: Analysis of the number of ZO-1 positive cells in mouse intestinal tissue of each group.

[0061] Figure 43 The results of immunohistochemical detection of RhoB-positive cells in mouse intestinal tissue are shown. Note: A: IHC microscopic examination results of RhoB-positive cells in mouse intestinal tissue of each group; B: Analysis of the number of RhoB-positive cells in mouse intestinal tissue of each group.

[0062] Figure 44 Immunohistochemical staining results of ST6GALNAC1 positive cells in mouse intestinal tissue. Note: A: IHC microscopic examination results of ST6GALNAC1 positive cells in mouse intestinal tissue of each group; B: Analysis of the number of ST6GALNAC1 positive cells in mouse intestinal tissue of each group.

[0063] Figure 45 Immunohistochemical staining results of ST6GALNAC2 positive cells in mouse intestinal tissue. Note: A: IHC microscopic examination results of ST6GALNAC2 positive cells in mouse intestinal tissue of each group; B: Analysis of the number of ST6GALNAC2 positive cells in mouse intestinal tissue of each group.

[0064] Figure 46 This is a graph showing the species composition analysis results of the mouse gut microbiota. Note: A: Phylum-level taxonomic composition analysis; B: Phylum-level species composition heatmap; C: Genus-level taxonomic composition analysis; D: Genus-level species composition heatmap. Detailed Implementation

[0065] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0066] This invention provides a recombinant expression vector for the sialyl transferase ST6GALNAC1 gene, wherein the recombinant expression vector uses the Lactobacillus shuttle vector pPG612 as a backbone and contains the sialyl transferase ST6GALNAC1 gene.

[0067] The nucleotide sequence of the sialyl transferase ST6GALNAC1 gene is shown in SEQ ID NO.3.

[0068] This invention also provides a recombinant Lactobacillus casei with the sialyltransferase ST6GALNAC1 gene, wherein the recombinant Lactobacillus casei is based on Lactobacillus casei ATCC393 and contains the recombinant expression vector.

[0069] The present invention also provides the application of the recombinant expression vector or the recombinant Lactobacillus casei in the preparation of sialic acid transferase.

[0070] This invention also provides a method for preparing sialyl transferase, which uses the recombinant expression vector or the recombinant Lactobacillus casei to prepare sialyl transferase under the induction of lactose.

[0071] In some specific implementations, the concentration of lactose in the culture medium is 0.02-0.04 g / mL.

[0072] The present invention also provides the use of the recombinant expression vector or the recombinant Lactobacillus casei in the preparation of drugs for preventing and treating diseases caused by Salmonella typhimurium.

[0073] This invention also provides a drug for preventing and treating diseases caused by Salmonella typhimurium, including the recombinant expression vector or the recombinant Lactobacillus casei.

[0074] This invention discloses a recombinant *Lactobacillus casei* LC-pPG-ST6 expressing the sialyltransferase ST6GALNAC1, its preparation method, and its application in the prevention or treatment of *Salmonella typhimurium* infection. This recombinant bacterium was obtained by cloning the ST6GALNAC1 gene into the pPG612 vector and then electroporating it into *Lactobacillus casei* ATCC393. Experiments show that this engineered bacterium significantly enhances the glycosylation modification of the intestinal mucin MUC2, increases the expression of tight junction proteins (ZO-1, Occludin, Claudin-1), inhibits the activation of the p38 / MAPK inflammatory pathway, and regulates the intestinal flora structure, thereby effectively alleviating intestinal damage and systemic inflammatory responses caused by *Salmonella*. This invention provides a strain basis and technical support for the development of novel oral probiotics.

[0075] This invention uses Lactobacillus casei ATCC393 as a chassis to construct a recombinant plasmid pPG-ST6 expressing the sialyl transferase ST6GALNAC1 gene, and prepares a new functional engineered probiotic LC-pPG-ST6. This engineered bacterium exhibits strong adhesion and invasion capabilities against LS174T intestinal epithelial cells, with high biosafety. Cell viability reached (96.2±1.2)% after 6 hours of co-culturing with cells at MOI 100. It competitively inhibits the adhesion and invasion of Salmonella typhimurium into intestinal epithelial cells, significantly upregulates the expression of tight junction proteins Claudin-1 (0.52-fold), Occludin (5.1-fold), and ZO-1 (0.95-fold) in LS174T cells, while simultaneously increasing the mRNA expression of the MUC2 gene (0.88-fold) and the expression of glycosyltransferase genes B3GNT6 and C1GALT1 (0.45-0.82-fold). Furthermore, it specifically inhibits MAPK signaling pathway activation, resulting in a 31% decrease in p-p38 levels.

[0076] After oral inoculation of Kunming mice, the engineered bacteria significantly increased the number of IgA+ B cells (1.5-2.3 times), CD80+CD86+CD11c+ dendritic cells (2.02-2.36 times), and CD3+CD8+ T cells (2.12-2.79 times) in the spleen (SP), mesenteric lymph nodes (MLN), and Pell's aggregated lymph nodes (PPs); and increased serum IgG concentration to (10.49±1.54) g / L and serum IL-10 The levels of TNF-α and IL-1β were reduced to (135.64±0.32) pg / mL, and the levels of TNF-α and IL-1β in the serum were reduced to (34.06±2.14) pg / mL. At the same time, the mRNA levels of TNF-α, IL-1β and IL-6 in mouse intestinal tissue were reduced by 93%, 90% and 99%, respectively. The expression of ZO-1 (0.37-fold), Claudin-1 (2.38-fold), Occludin (4.02-fold) and MUC2 gene mRNA (1.93-fold) in mouse ileum tissue was significantly upregulated, the levels of glycosyltransferase genes B3GNT6 (2.53-fold) and C1GALT1 (36.82-fold) were increased, and the levels of p38 (71%) and phosphorylated p38 (p-p38, 62%) were reduced. The intestinal pathological tissue damage caused by Salmonella typhimurium was alleviated, the number of goblet cells was increased, and the integrity of the intestinal wall and villi was maintained.

[0077] Furthermore, this engineered bacteria significantly reduced the expression of p38, p-p38, and RhoB proteins in mouse colon tissue, while enhancing the expression of tight junction proteins Claudin1, Occludin, and ZO-1, as well as glycosyltransferases ST6GALNAC1 and ST6GALNAC2 proteins. It also enriched gut microbiota diversity by increasing the abundance of Firmicutes, Bacteroidetes, and Lactobacillus in the gut, with the relative abundance of Salmonella in the experimental group being lower than that in the dirty cage group. The novel functional probiotic prepared in this invention can significantly alleviate intestinal damage and inflammation caused by Salmonella typhimurium infection, providing an effective intervention for the prevention and treatment of Salmonella infection and related intestinal diseases.

[0078] Example 1

[0079] I. Construction of recombinant plasmid pPG-ST6

[0080] 1. Primer design and target gene amplification

[0081] Based on the complete genome data of ST6GALNAC1 (NM_011371.2) in the NCBI database, we searched for ST6 gene sequence information. At the same time, based on the pPG612 expression vector sequence, we designed a pair of specific primers with restriction enzyme sites for upstream and downstream. The specific primer sequence information is as follows, with underlined sites representing restriction enzyme sites.

[0082] F: 5'- GCGGCCGC ATGCACCATCATCATCATCATCTGTTAGGGACCAGCCATCC -3' (Not I, SEQ ID NO.1);

[0083] R: 5'- CCGCGG ATGATGATGATGATGGTGCATGAGGAGCCCTTGCATTCTGT -3'(Sac II)(Sac II, SEQ ID NO. 2).

[0084] Changchun Kumei Biotechnology Co., Ltd. synthesized primers and used cDNA from fresh mouse colon tissue as a template for PCR amplification using upstream and downstream primers of the ST6 gene. The expected size of the ST6 gene fragment was 1665 bp. The amplification system is shown in Table 1.

[0085] Table 1 PCR amplification reaction system

[0086]

[0087] Total RNA was extracted from the colon tissue of 8-week-old C57BL / 6 mice, and cDNA was synthesized by reverse transcription. Using cDNA as a template, 2×PhantaMax Master Mix (12.5 μL) and forward and reverse primers (1 μL each) were used for transcribing. GCGGCCGC ATGCACCATCATCATCATCATCTGTTAGGGACCAGCCATCC -3' ( Not I);

[0088] R: 5'- CCGCGG ATGATGATGATGATGGTGCATGAGGAGCCCTTGCATTCTGT -3'( Sac II) A 25 μL PCR reaction system was prepared by combining template cDNA (2 μL) and sterile water (7.5 μL). The 1.65 kb ST6GALNAC1 gene fragment (SEQ ID NO.3) was amplified according to the program of "94℃ pre-denaturation for 5 min → 94℃ denaturation for 1 min → 67℃ annealing for 1 min → 72℃ extension for 10 min → 16℃ incubation". After verification by agarose gel electrophoresis, the target gene was recovered using a gel recovery kit.

[0089]

[0090] 2. Construction of cloning vectors and recombinant expression vectors

[0091] The ST6 target gene fragment recovered from the previous gel was ligated overnight at 16°C with the cloning vector pEASY-Blunt-Zero. The ligation system is shown in Table 2.

[0092] Table 2 Connection Reaction System

[0093]

[0094] Take 5 μL of the ligation product and transform it into MC1061 competent cells using a standard chemical transformation method. The specific steps are as follows: Remove MC1061 competent cells at -80℃ and thaw them on ice. Transfer the ligation product to the thawed competent cells, mix well, incubate on ice for 30 min, heat shock at 42℃ for 90 s, add 900 μL of LB liquid medium, shake on a 37℃ incubator for 2 h, centrifuge at 5000 rpm for 10 min, discard the supernatant, retain 50 μL of supernatant, aspirate the bacterial cell pellet, spread evenly on LB solid medium (50 μg / mL kanamycin), and incubate in an inverted incubator at 37℃ overnight. Pick single colonies overnight, extract plasmids according to the bacterial plasmid miniprep kit instructions, and perform PCR identification. Suspected plasmids were sent to Changchun Kumei Biotechnology Co., Ltd. for sequencing. After successful identification, the plasmid was named pEASY-ST6.

[0095] pEASY-ST6 and Lactobacillus shuttle vector pPG612 were double-digested with restriction endonucleases SacII and NotI, respectively (system: plasmid 20 μL, SacII 1 μL, NotI 1 μL, 10×flycut buffer 5 μL, sterile water 23 μL). After incubation at 37℃ for 6 h, the target gene and vector fragment were recovered by gel extraction.

[0096] The recombinant expression plasmid pPG-ST6 was obtained by ligating the target gene (7 μL), vector fragment (1 μL), T4 DNA ligase (1 μL), and 10×T4 DNA ligase buffer (1 μL) overnight at 16°C. The ligation was performed on LB agar plates containing 10 μg / mL chloramphenicol and incubated overnight at 37°C. Single colonies were picked, and plasmids were extracted for double enzyme digestion, PCR identification, and sequencing.

[0097] II. Preparation of the novel functional engineered probiotic LC-pPG-ST6

[0098] 1. Preparation of competent Lactobacillus casei cells

[0099] Lactobacillus casei ATCC393 was streaked onto antibiotic-free MRS solid medium and cultured anaerobically at 37°C until single colonies formed. Single colonies were picked and inoculated onto MRS liquid medium and cultured overnight at 37°C. Then, 2% of the inoculum was transferred to 200 mL of MRS liquid medium and cultured until the OD600 value was approximately 0.8.

[0100] After incubating the bacterial culture on ice for 30 min, centrifuge at 5000 rpm at 4℃ for 10 min to collect the bacterial cells. Wash twice with 30 mL of pre-chilled EPWB buffer, then wash once with 30 mL of pre-chilled EPB buffer. Finally, resuspend in 1 mL of pre-chilled EPB buffer, incubate on ice for 15 min, and aliquot into 200 μL / tube. Store at -80℃ for later use.

[0101] 2. Electroporation of recombinant plasmids and screening and identification of engineered bacteria

[0102] Mix 15 μL of recombinant plasmid pPG-ST6 with 200 μL of competent Lactobacillus casei cells, incubate on ice for 5 min, then transfer to a pre-cooled electroporation cuvette and electroporate at 2.7 kV and 5-6 ms. Immediately add 900 μL of MRS recovery medium containing 15% sucrose, incubate on ice for 15 min, and then anaerobic culture at 37°C for 6 h.

[0103] Spread 100 μL of bacterial culture onto an MRS agar plate containing 10 μg / mL chloramphenicol and anaerobic culture at 37°C for 24-36 h. Pick a single colony and inoculate it into MRS liquid medium containing 10 μg / mL chloramphenicol. Culture overnight at 37°C. Extract plasmids for PCR, double enzyme digestion identification and sequencing. Positive strains are the new functional engineered probiotic LC-pPG-ST6.

[0104] 3. Validation of recombinant protein expression in engineered bacteria

[0105] LC-pPG-ST6 was inoculated into MRS liquid medium containing 10 μg / mL chloramphenicol and cultured at 37°C. Then, it was transferred at a 3% inoculation rate to MRS liquid medium containing 2% (0.02 g / mL) lactose and 10 μg / mL chloramphenicol and anaerobically induced overnight at 37°C (the non-induced group was set as the negative control).

[0106] Take 30 mL of bacterial culture, centrifuge at 8000 rpm for 15 min at 4 °C, wash three times with 10 mL of sterile PBS, add 500 μL of lysozyme solution (100 mg / mL), and disrupt the cell wall at 37 °C for 1 h. Centrifuge at 8000 rpm for 15 min at 4 °C, take the supernatant, add 800 μL of 5×SDS-PAGE loading buffer, and boil at 100 °C for 15 min. Detect recombinant protein expression by Western blot (primary antibody Anti-His, dilution 1:3000; secondary antibody HRP goat anti-rabbit IgG, dilution 1:8000). Simultaneously, verify protein localization using indirect immunofluorescence (incubate with His-Tag solution at 37 °C for 4 h, wash with PBS, add FITC-labeled IgG, incubate at 37 °C in the dark for 4 h, fix with paraformaldehyde, and observe under a fluorescence microscope).

[0107] After optimizing induction conditions (lactose concentration, 37℃, 16 h), total protein was extracted from the Lc-pPG-ST6 recombinant strain using modified RIPA lysis buffer (containing 1% SDS and 1× protease inhibitor). The total bacterial protein concentration was quantified using the BCA method. Equal 30 μg protein samples were subjected to SDS-PAGE electrophoresis. Detection using a chemiluminescence imaging system after transfer showed that the strain exhibited a specific band in the 59.8-60.3 kDa region, similar to the expected theoretical molecular weight of ST6GALNAC1 protein. No corresponding band was observed in the negative control (empty vector strain) or the uninduced group. Figure 6 ).

[0108] III. In vitro functional validation of engineered probiotics (using LS174T intestinal epithelial cell model)

[0109] 1. Cell Culture and Processing

[0110] LS174T cells were revived and cultured in 1640 complete medium containing 10% fetal bovine serum and 1% penicillin-streptomycin antibiotics at 37°C in a 5% CO2 incubator. The medium was changed, passaged, and cryopreserved according to standard methods.

[0111] Cells were loaded at 2 × 10 5 Inoculate each well with one culture medium per well into a 24-well plate and incubate until the bacteria cover the bottom of the wells. Discard the complete culture medium, wash three times with pre-warmed PBS, and add LC-pPG-ST6, wild-type Lactobacillus casei (LC), and Salmonella typhimurium (ST) bacterial suspensions (5×10⁻⁶) at an MOI of 100. 7 (800 μL of incomplete culture medium was added to each well, and the cells were co-cultured for different times (2, 4, 6, 8 h) for subsequent detection.

[0112] 2. Biosafety testing (trypan blue staining method)

[0113] After co-culture, the culture medium was discarded, the cells were washed once with PBS, and trypsin was added to digest the cells. The single-cell suspension was mixed with trypan blue staining solution at a ratio of 9:1. The number of viable cells was counted using a hemocytometer, and the cell viability (number of viable cells / total number of cells × 100%) was calculated. The optimal co-culture time was determined to be 6 hours.

[0114] Adhesion and Invasion Capability Testing

[0115] Adhesion assay: After co-culturing cells and bacteria for 3 hours, wash three times with PBS to remove unadhesed bacteria, add 1% Triton X-100 to lyse cells for 30 minutes, serially dilute the lysis buffer and spread it on solid culture medium (MRS for lactic acid bacteria, LB for Salmonella), count colonies after incubation, and calculate the adhesion rate (number of adhered bacteria / number of inoculated bacteria × 100%).

[0116] Both LC and LC-pPG-ST6 effectively adhered to the surface of LS174T cells, significantly higher than the control group, with extremely significant differences. P <0.0001). Further analysis showed that the adhesion ability of the novel functional probiotic LC-pPG-ST6 was significantly higher than that of other probiotics. S. typhimurium ( P <0.05). S. typhimurium The cell adhesion rate of LC was 5.83%, that of pPG-ST6 was 4.88%, while the cell adhesion rate of LC-pPG-ST6 reached 7.59%. Figure 9 ).

[0117] Invasion experiment: After co-culturing for 3 hours, wash three times with PBS, add MEM medium containing 100 mg / mL gentamicin and incubate for 2 hours to kill surface bacteria. Subsequent operations are the same as the adhesion experiment. Count the number of invading bacteria and calculate the invasion rate (number of invading bacteria / number of inoculated bacteria × 100%).

[0118] S. typhimurium The invasion rates of LC-pPG-ST6 and LC-pPG-ST6 were (5.83%) and (7.59%), respectively, significantly higher than those of the blank control group (no invasive colonies were detected). P <0.01, P <0.0001). Multiple comparisons revealed that LC-pPG-ST6 has a relatively high invasiveness. S. typhimurium Increased by 30.1% P <0.05), while LC did not show significant invasive activity (4.88%) ( P >0.05) Figure 10 ).

[0119] Detection of cell barrier function and signaling pathway related indicators

[0120] Protein expression detection: Total protein was extracted from cells (lysed in RIPA lysis buffer on ice for 30 min, centrifuged at 4℃ and 12000 rpm for 30 min, and the supernatant was collected). After measuring the protein concentration by BCA method, SDS-PAGE electrophoresis and Western blot were performed to detect the expression levels of tight junction proteins (Claudin-1, Occludin, ZO-1), p38 / MAPK pathway-related proteins (p38, p-p38), RhoB, and HSP90 (primary antibody dilution ratio was 1:1000).

[0121] Compared with the control group, the LC-pPG-ST6 treatment group significantly increased the protein expression levels of Occludin (1.19±0.11), Claudin-1 (1.74±0.10), and ZO-1 (1.90±0.23). P <0.0001, P <0.001, P <0.01). The LC-pPG-ST6 treatment group significantly reduced the expression levels of total p38 protein (0.72±0.07) and its phosphorylated protein (0.66±0.08). P <0.01, P <0.001). S. typhimurium The expression level of RhoB protein in the infected group (1.64±0.11) was significantly higher than that in the control group. P <0.001), while the LC group (0.58±0.16) and the LC-pPG-ST6 group (0.30±0.10) both showed significant downregulation ( P <0.01, P <0.001). Regarding HSP90 expression, S. typhimurium The infection group (2.62±0.10) was significantly higher than that in the control group ( P <0.0001), while the LC-pPG-ST6 group (0.72±0.10) showed significantly reduced expression (P<0.01). Figure 11 ).

[0122] Gene expression detection: Total RNA was extracted from cells (according to the Simply P Total RNA Extraction Kit), and cDNA was synthesized by reverse transcription (according to the HiScript II 1st Strand cDNA Synthesis Kit system: Total RNA 1000ng, 2×RTMix 10μL, HiScript II Enzyme Mix 2μL, Oligo(dT)23 VN 1μL, Random hexamers 1μL, RNase-free water added to 20μL, reaction conditions 25℃ 5min→50℃ 45min→85℃ 5s). qRT-PCR was performed using ChamQ Universal SYBR qPCR Master Mix to detect the mRNA expression levels of MUC2, glycosyltransferase genes (B3GNT6, C1GALT1, etc.), and inflammatory factor genes (IL-6, IL-1β, TNF-α, etc.) (reaction system: 2×SYBRMix 10μL, forward and reverse primers 1μL each, cDNA 2μL, sterile water 6μL).

[0123] Compared with the blank control group, S. typhimurium IL-6 (2) in the infection group -ΔΔCt The mRNA expression levels of IL-1β (17.84±3.25), TNF-α (14.08±1.89), IL-17 (4.04±0.17), CXCL1 (11.36±1.07), and CCL2 (2.96±0.22) were all significantly increased. P <0.01, P <0.001, P <0.001, P <0.0001, P <0.0001, P <0.0001). (and) S. typhimurium Compared with the control group, the LC-pPG-ST6 treatment group significantly reduced the expression levels of IL-6 (2.17±0.56), IL-1β (2.62±0.19), TNF-α (1.17±0.15), IL-17 (0.18±0.02), CXCL1 (0.52±0.02), and CCL2 (0.006±0.001). P <0.01) Figure 12 ).

[0124] IV. In vivo functional verification of engineered probiotics (using the Kunming mouse infection model)

[0125] 1. Animal grouping and establishment of infection models

[0126] SPF-grade 4-week-old female Kunming mice (weighing 18-22g) were randomly divided into 7 groups (n=6):

[0127] Control group (administered by gavage with PBS), Salmonella typhimurium infection group (administered by gavage with 1×10⁻⁶ PBS) 8 CFU / mL bacterial suspension, 200μL / time, challenged twice at 24-hour intervals; 5-ASA drug treatment group (5-ASA, 200μL / animal administered by gavage daily after challenge, for 3 consecutive days); LC-pPG-ST6 treatment group (ST6, 2×100mg / v / animal administered by gavage daily after challenge). 8 CFU / animal, for 7 days), wild-type LC treatment group (LC, same dosage and course of treatment as ST6 group), wild-type LC dirty cage sharing group (D-LC, housed with LC group), LC-pPG-ST6 dirty cage sharing group (D-ST6, housed with ST6 group).

[0128] Mice were pretreated with 5 mg / mL streptomycin sulfate for 2 days before infection to clear intestinal symbiotic flora and enhance Salmonella colonization.

[0129] 2. Detection of immune function-related indicators

[0130] Flow cytometry analysis: After the last treatment, mice were euthanized, and spleens (SP), mesenteric lymph nodes (MLN), and Pell's aggregated lymph nodes (PPs) were harvested to prepare single-cell suspensions. Fluorescently labeled antibodies (CD80-PE, CD86-FITC, CD11c for detecting DCs; CD45R / B220-APC, IgA-FITC for detecting B cells; CD3-APC-cy7, CD4-APC, CD8-PE for detecting T cells) were added to each suspension. After incubation in the dark and washing, the number of each immune cell was detected by flow cytometry.

[0131] In the spleen (SP), CD11c levels were significantly higher in the LC-pPG-ST6 group (5.21±0.25%) compared to the 5-ASA group (4.73±0.13%). + The proportion of DCs was significantly higher than that of the control group (3.55±0.16%). P <0.0001, P <0.001), while the LC group (2.95±0.15%) and S. typhimurium The group (2.30±0.20%) was significantly lower than the control group ( P <0.05, P <0.001) Figure 17In mesenteric lymph nodes (MLNs), the LC-pPG-ST6 group (3.02±0.16%) and the 5-ASA group (3.21±0.18%) were significantly higher than those in the control group (1.85±0.08%). P <0.01, P <0.001), and the LC-pPG-ST6 group was significantly higher than that of the other group. S. typhimurium Group (1.51±0.05%) P <0.001) Figure 17 In the Pascal junctions (PPs), the LC-pPG-ST6 group (3.45±0.33%) was significantly higher than that in the Pascal junctions (PPs). S. typhimurium Group (1.65±0.11%) P <0.0001) and LC group (2.87±0.42%) P <0.0001), but there was no difference in the 5-ASA group (3.97±0.41%). P >0.05) Figure 17 (C)

[0132] In the spleen (SP), CD45 levels were higher in the LC-pPG-ST6 group (2.10±0.11%) and the 5-ASA group (1.37±0.14%). + IgA + The proportion of B cells was significantly higher than that in the control group (0.92±0.20%). P <0.0001, P <0.05), and the LC-pPG-ST6 group was significantly higher than that of the other two groups. S. typhimurium The group (0.93±0.12%), the LC group (1.10±0.07%), and the 5-ASA group ( P <0.0001, P <0.001, P <0.01)( Figure 18 (A) In the mesenteric lymph nodes (MLN), S. typhimurium The percentage in the group (0.76±0.23%) was significantly lower than that in the control group (2.17±0.08%). P <0.0001), while the LC-pPG-ST6 group (2.35±0.17%) showed no difference from the control group ( P >0.05)( Figure 18 In Pell's nodes (PPs), the LC-pPG-ST6 group (3.68±0.14%) and the 5-ASA group (4.05±0.11%) were significantly higher than those in the control group (2.70±0.23%). P <0.0001, P<0.001), and the LC-pPG-ST6 group is higher than S. typhimurium The percentages in the LC group (3.68±0.14%) and the LC group (2.99±0.12%) were significantly lower. P <0.001, P <0.01)( Figure 18 (C)

[0133] In mouse spleen (SP) ( Figure 19 CD3 in the 5-ASA group, LC group, and LC-pPG-ST6 group + CD8 + The proportions of T cells increased by (2.24±0.25)%, (1.63±0.07)%, and (2.29±0.10)% respectively compared to the control group. P <0.001, P <0.05, P <0.001), and S. typhimurium There was no statistically significant difference between the groups. P >0.05). The proportion of cells in the LC-pPG-ST6 group was significantly higher than that in the LC-pPG-ST6 group. S. typhimurium Group( P <0.0001) and LC group ( P <0.01), with no statistically significant difference compared to the 5-ASA group ( P >0.05); in mesenteric lymph nodes (MLN) ( Figure 19 (B), CD3 in each treatment group + CD8 + The proportion of T cells increased compared to the control group (5-ASA: 2.43±0.07%; LC: 1.87±0.16%; LC-pPG-ST6: 2.47±0.13%; all). P <0.01), S. typhimurium There was no significant difference between the group and the control group. P >0.05). The LC-pPG-ST6 group was significantly higher than... S. typhimurium Groups (difference of 1.88%) P <0.0001) and LC group (difference of 0.6%) P <0.01), with no significant difference from the 5-ASA group (difference of 0.04%). P >0.05); in Pell's knots (PPs) ( Figure 19 In the middle C group, only the 5-ASA group (2.20±0.15%) and the LC-pPG-ST6 group (2.28±0.23%) were significantly higher than the control group (both P <0.05), the LC-pPG-ST6 group was significantly higher than S. typhimuriumGroups (difference of 1.2%) P <0.001), but there was no statistically significant difference between the two groups. P >0.05).

[0134] ELISA assay: Mouse serum was collected and the concentrations of IgG, IL-10, TNF-α, and IL-1β in the serum were detected according to the ELISA kit instructions.

[0135] S. typhimurium The IgG level in the infection group (7.08±0.98 mg / mL) was significantly lower than that in the blank control group (9.97±2.27 mg / mL). P <0.05). The IgG concentration in the LC-pPG-ST6 intervention group recovered to 10.49±1.54 mg / mL, which was higher than that in the infection group ( P <0.05), while there was no statistically significant difference between the LC probiotic group (8.01±1.17 mg / mL) and the 5-ASA drug group (9.03±1.91 mg / mL) and the infection group. P >0.05)( Figure 25 ).

[0136] qRT-PCR detection: Mouse ileum tissue was collected, total RNA was extracted and reverse transcribed into cDNA, and qRT-PCR was used to detect the mRNA expression levels of inflammatory factors (IL-6, TNF-α, IL-1β), tight junction proteins (ZO-1, Occludin, Claudin-1), MUC2, and glycosyltransferase genes (B3GNT6, C1GALT1).

[0137] S. typhimurium The expression levels of IL-6, TNF-α, and IL-1β genes in the infected group were significantly higher than those in the control group (2). -ΔΔCt Values: 669.35±110.51 vs 1.67±0.45 P <0.0001), (487.26±68.81 vs 1.00±0.14, P <0.0001) and (24.12±1.75 vs 0.90±0.19, P <0.0001). The above indicators in the LC-pPG-ST6 intervention group were all significantly lower than those in the infection group (IL-6: 1.71±0.51, TNF-α: 1.97±0.20, IL-1β: 2.41±0.76, all <0.0001). P <0.0001, but still higher than the control group (both P <0.05)( Figure 26 ).

[0138] Regarding ZO-1 expression, the LC-pPG-ST6 group (2 -ΔΔCt Values ​​(4.05±0.63), 5-ASA group (5.14±0.66), and LC group (2.65±0.15) were all upregulated compared to the blank control group (1.00±0.09). P <0.0001, P <0.05, P <0.001), and the expression level of LC-pPG-ST6 was significantly higher than that of the Salmonella infection group (1.22±0.24, P <0.001). In Occludin expression, the 5-ASA group (1.34±0.06) was significantly higher than the blank control (1.00±0.08). P <0.01), the LC-pPG-ST6 group (0.86±0.10) showed an improvement compared to the infection group (0.59±0.02). P <0.01). Claudin-1 expression showed the most significant changes, with the LC-pPG-ST6 group (4.75±0.54), 5-ASA group (3.92±0.36), and LC group (6.95±0.61) all showing upregulation compared to the blank control (1.07±0.52). P <0.0001, P <0.001, P <0.0001), and the LC-pPG-ST6 group showed an increase compared to the infection group (4.75±0.54). P <0.0001)( Figure 29 LC-pPG-ST6 intervention significantly increased the expression level of the MUC2 gene in the ileum of mice. Compared with the blank control group (2... -ΔΔCt Compared with the LC group (10.92±1.15) and the LC-pPG-ST6 group (8.18±1.00), the relative expression levels of MUC2 mRNA were all increased in the 5-ASA group (8.04±0.99), the LC group (10.92±1.15), and the LC-pPG-ST6 group (8.18±1.00). P <0.0001)( Figure 31 ).

[0139] S. typhimurium Infection significantly altered the expression profile of glycosylation-related genes in the mouse ileum. Compared with the blank control group, S. typhimurium Infection group Fut1 (2 -ΔΔCt Values: 110.20±9.51 vs 1.00±0.09), Fut2 (78.52±3.04 vs 1.00±0.01), and st3gal4 (88.63±3.89 vs 1.00±0.12) expression levels were all increased (all P<0.0001), while C1GALT1 expression decreased (0.10±0.01 vs 1.02±0.25, P <0.001). After LC-pPG-ST6 intervention: Fucosylation regulation: Fut1 (2.04±0.45) and Fut2 (3.91±0.09) expression were both decreased compared with the infection group (both P <0.0001); Sialization modification: st3gal4 expression level (9.79±0.74) was lower than that in the infection group ( P <0.001); Mucin core synthesis: The expression levels of C1GALT1 (2.48±0.33) and B3GNT6 (6.16±0.41) were both increased compared with the infection group (both <0.001); P <0.0001); the expression levels of trefoil factors: TFF3 (6.89±0.40) and CHST4 (20.42±2.03) were both increased compared with the infection group (both <0.0001). P <0.0001)( Figure 30 ).

[0140] Western blot analysis: Total protein was extracted from mouse ileum tissue, and the expression levels of tight junction proteins (ZO-1, Occludin, Claudin-1), p38 / MAPK pathway-related proteins (p38, p-p38), and RhoB were detected.

[0141] LC-pPG-ST6 can synergistically upregulate the expression of Occludin, ZO-1, and Claudin-1. P <0.001), its effect strength is comparable to that of 5-ASA. Although the LC group significantly increased the expression of ZO-1 and Claudin-1 ( P <0.0001), but had no effect on Occludin (P>0.05). S typhimurium Occludin significantly inhibited infection ( P <0.001) and Claudin-1 ( P <0.05), but did not affect ZO-1 ( P >0.05) Figure 22 ).

[0142] LC-pPG-ST6 significantly inhibited Salmonella-induced p38 / MAPK pathway activation, as evidenced by decreased p38 protein expression. P <0.0001) and decreased p-p38 protein ( P <0.0001). 5-ASA selectively inhibits p-p38 protein ( P <0.0001) without affecting p38 transcription levels ( Figure 23 ).

[0143] S. typhimurium The expression level of RhoB protein in the infected group was significantly higher than that in the blank control group. P <0.0001), while the expression levels in the LC probiotic group and the novel engineered bacteria LC-pPG-ST6 group were lower than those in the infection group (both <0.0001). P <0.0001)( Figure 24 ).

[0144] 3. Intestinal tissue pathological examination

[0145] Tissues from the duodenum, jejunum, ileum, and colon of mice were collected, fixed in 4% paraformaldehyde, routinely embedded in paraffin, and sectioned (3 μm thick). Hematoxylin-eosin (HE) staining, periodic acid-Schiff (PAS) staining (to detect goblet cells), and immunohistochemical (IHC) staining (to detect p38, p-p38, Claudin1, Occludin, ZO-1, RhoB, ST6GALNAC1, and ST6GALNAC2 proteins) were performed. Intestinal pathological changes and protein expression were observed under a microscope.

[0146] Histopathological observation of the small intestine of mice showed that S. typhimurium Significant differences existed among the different treatment groups after infection. Compared with the healthy control group, the jejunum and ileum tissues of the model control group (LC group) mice showed typical pathological damage: significantly shortened villus length, reduced crypt depth, increased villus disintegration rate, reduced intestinal wall thickness, and accompanied by a large number of neutrophils and lymphocytes infiltrating. The pathological damage in the ST6 group and the 5-ASA positive control group was significantly reduced, the villus retention rate was stable, the intestinal wall thickness remained at a normal level, and the inflammatory cell infiltration was lower than that in the model group. The co-hospitalized groups (D-LC and D-ST6) showed mild damage characteristics in the ileum region, with a villus tip disintegration rate lower than that in the model group but higher than that in the healthy control group. Figure 33-35 ).

[0147] Histopathological observation of mouse colon showed that S. typhimurium Significant differences were observed in the degree of colonic damage among the groups after infection. In the model group, the colon showed significantly shortened villi length, reduced crypt depth, and submucosal edema. In the same-cage group, the mouse colonic villi were neatly arranged, the crypt structure was clear, and the intestinal wall structure was intact. In the D-ST6 group, the colonic villi of mice were shortened, and some crypts disappeared. Figure 36 ).

[0148] Quantitative analysis of colonic goblet cells showed that S. typhimurium Infection significantly disrupted mucus barrier homeostasis. The goblet cell density in the model group was 62.3% lower than that in the healthy control group (427±29 cells / HPF in the healthy group vs. 98±21 cells / HPF in the model group). P<0.0001). After probiotic intervention, the cell density in the ST6 group recovered to healthy levels (351±9 cells / HPF), while the D-LC and D-ST6 groups reached 195±36 and 229±17 cells / HPF, respectively (both... P <0.01 vs model group) Figure 37 ).

[0149] Immunohistochemical quantitative analysis showed that LC-pPG-ST6 improves intestinal mucosal barrier function through multi-target regulation. The expression level of p-p38 protein was significantly increased in the model group (AOD value 0.115±0.004 vs. 0.087±0.006 in the healthy group). P <0.0001), while the LC-pPG-ST6 group reduced it (0.077±0.006, P <0.001)( Figures 38-39 ).

[0150] Tight junction protein quantification showed that the AOD values ​​of Claudin1 (AOD 0.091±0.008 vs. model group 0.065±0.005), Occludin (0.065±0.004 vs. 0.06±0.004), and ZO-1 (0.081±0.075 vs. 0.085±0.076) were all increased in the ST6 group (all... P <0.01)( Figures 40-42 ).

[0151] ST6GALNAC1 / 2 expression in the LC-pPG-ST6 group was increased compared to the model group (AOD 0.110±0.007 vs 0.086±0.004) and (0.064±0.002 vs 0.063±0.004), respectively, while RhoB protein expression was decreased. P <0.001)( Figures 43-45 ).

[0152] 4. Intestinal flora analysis

[0153] Fresh fecal samples were collected from mice, total bacterial DNA was extracted, and 16S rRNA gene sequencing was performed. The α diversity (Shannon index, Chao1 index), β diversity (PCoA, NMDS analysis), and species composition (relative abundance at the phylum and genus levels) of the gut microbiota were analyzed to assess the impact of engineered bacteria on the balance of the gut microbiota.

[0154] Firmicutes ( Firmicutes ) and Bacteroidetes ( BacteroidetesFirmicutes constituted a significant proportion of all phyla, representing the dominant bacterial group in the mouse gut. Among all groups, Firmicutes exhibited the highest relative abundance, as follows: Control group 44.69%, ST group 47.13%, ASA group 35.47%, Lc group 36.31%, Lc_ST6 group 59.08%, D_Lc group 33.74%, and D_Lc_ST6 group 36.66%. The novel functional probiotic LC-ST6 group showed the highest relative abundance of Firmicutes, reaching 59.08%. Bacteroidetes The relative abundance of Bacteroidetes was second only to [other phyla] at the phylum level. Firmicutes (Firmwallis phylum), of which the Control group accounted for 47.04%, the ST group for 34.62%, the ASA group for 15.58%, the Lc group for 31.08%, the Lc_ST6 group for 22.01%, the D_Lc group for 27.19%, and the D_Lc_ST6 group for 6.75%. Among these, the ST, Lc, and Lc_ST6 groups showed the highest relative abundance of Bacteroidetes. Figure 46 (AB).

[0155] Lactobacillus The relative abundance of *Lactobacillus* was the highest among all genus groups: 15.18% in the Control group, 4.69% in the ST group, 5.74% in the ASA group, 17.08% in the Lc group, 37.74% in the Lc_ST6 group, 1.94% in the D_Lc group, and 20.32% in the D_Lc_ST6 group. Compared with the co-cage groups, the relative abundance of *Lactobacillus* in the experimental groups was higher than that in the dirty cage groups, with the highest relative abundance of *Lactobacillus* in the novel functional probiotic Lc-ST6 group, reaching 37.74%. Furthermore, we observed harmful bacteria at the genus level. Salmonella The relative abundance of Salmonella was low, with 0.08% in the Control group, 5.21% in the ST group, 5.77% in the ASA group, 9.69% in the Lc group, 5.40% in the Lc_ST6 group, 24.58% in the D_Lc group, and 21.15% in the D_Lc_ST6 group. Figure 46 Medium CD).

[0156] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of a recombinant Lactobacillus casei in the preparation of a drug for inhibiting Salmonella typhimurium, characterized in that, The recombinant Lactobacillus casei uses Lactobacillus casei ATCC393 as the starting strain and contains a recombinant expression vector containing the sialyl transferase ST6GALNAC1 gene. The recombinant expression vector uses the Lactobacillus shuttle vector pPG612 as its backbone and contains the sialyl transferase ST6GALNAC1 gene. The nucleotide sequence of the sialyl transferase ST6GALNAC1 gene is shown in SEQ ID NO.3.

Images